Wednesday, 03 Jul 2013

From 2013.igem.org

(Difference between revisions)
(Created page with "=='''7/03/13 BioBrick Design Presentation and Grad Adviser Meeting'''== *Designed a biobrick with: **C terminus His-tagged kerA ***CATCATCATCATCATCAT **Prefix: gaattcgcggccgcttc...")
(7/03/13 BioBrick Design Presentation and Grad Adviser Meeting)
 
Line 1: Line 1:
-
=='''7/03/13 BioBrick Design Presentation and Grad Adviser Meeting'''==
 
-
*Designed a biobrick with:
 
-
**C terminus His-tagged kerA
 
-
***CATCATCATCATCATCAT
 
-
**Prefix: gaattcgcggccgcttctagag
 
-
**Suffix: tactagtagcggccgctgcag
 
-
*Moreover, the bio brick must include
 
-
**Eliminated EcoRI and PstI restriction sites from kerA nucleotide seq
 
-
***EcoRI (gaattc--814) and PstI (ctgcag--978)
 
-
***Conserved aa seq + biobrick prefix + suffix
 
-
**Secretion signal peptide
 
-
**Inducible promoter
 
-
*We also presented a feasible timeline of our project, which included:
 
-
**Assembly of biobrick and transformation into E. coli
 
-
**Transformation of B. subtilis
 
-
**Keratinase isolation and keratinase assays
 
-
**kerA mutagenesis for optimization of the keratinase
 

Latest revision as of 08:16, 26 September 2013