Wednesday, 03 Jul 2013

Revision as of 07:43, 26 September 2013 by Dohs (Talk | contribs)

7/03/13 BioBrick Design Presentation and Grad Adviser Meeting

Designed a biobrick with:
- C terminus His-tagged kerA
  - CATCATCATCATCATCAT
- Prefix: gaattcgcggccgcttctagag
- Suffix: tactagtagcggccgctgcag
Moreover, the bio brick must include
- Eliminated EcoRI and PstI restriction sites from kerA nucleotide seq
  - EcoRI (gaattc--814) and PstI (ctgcag--978)
  - Conserved aa seq + biobrick prefix + suffix
- Secretion signal peptide
- Inducible promoter
We also presented a feasible timeline of our project, which included:
- Assembly of biobrick and transformation into E. coli
- Transformation of B. subtilis
- Keratinase isolation and keratinase assays
- kerA mutagenesis for optimization of the keratinase