Team:UNITN-Trento/Notebook/Labposts/06/04
From 2013.igem.org
(Difference between revisions)
(One intermediate revision not shown) | |||
Line 1: | Line 1: | ||
{ | { | ||
- | "date" : "2013-06- | + | "date" : "2013-06-06", |
- | "author" : "thomas- | + | "author" : "thomas-emil", |
- | "title" : " | + | "title" : "First SAMsynthase extraction attempt - FAILED ", |
- | "content" : " | + | "content" : "We tried to amplify the SAMsynthase gene from an extract of E.coli genomic DNA (strain MG1655). In order to do that we exploited two primers previoursly designed and synthetized.'''Foward:''' GCCGCTTCTAGAGAAGGAGGAACTACTATGGCAAAACACCTTTTT'''Reverse:''' CTGCAGCGGCCGCTACTAGTATTATTACTTCAGACCGGCAGFor the protocol used see the <html><a href=\"https://2013.igem.org/Team:UNITN-Trento/Protocols#Phusion-PCR\">Phusion PCR protocol</a></html>..When the reaction finished, we tested the presence of the aplificate product througt an electrophoresis analisys (adding 2 µl of LD for 10 µl of DNA).<B>Results:</B>{{:Team:UNITN-Trento/Templates/Styles/Spoiler|Gel Image|<html><img id=\"post_img\" src=\"https://static.igem.org/mediawiki/2013/0/0a/Tn-20130605-gelschifo.jpg\" /></html>}}As you can see from our gel image, our product is not present.The next move will be to try to amplify using a TAQ polymerase and we hope that this will work!", |
- | "tags" : " | + | "tags" : "SAMsynthetase" |
} | } |
Latest revision as of 09:33, 3 October 2013
{ "date" : "2013-06-06", "author" : "thomas-emil", "title" : "First SAMsynthase extraction attempt - FAILED ", "content" : "We tried to amplify the SAMsynthase gene from an extract of E.coli genomic DNA (strain MG1655). In order to do that we exploited two primers previoursly designed and synthetized.Foward: GCCGCTTCTAGAGAAGGAGGAACTACTATGGCAAAACACCTTTTTReverse: CTGCAGCGGCCGCTACTAGTATTATTACTTCAGACCGGCAGFor the protocol used see the Phusion PCR protocol..When the reaction finished, we tested the presence of the aplificate product througt an electrophoresis analisys (adding 2 µl of LD for 10 µl of DNA).Results:
As you can see from our gel image, our product is not present.The next move will be to try to amplify using a TAQ polymerase and we hope that this will work!", "tags" : "SAMsynthetase" }