From 2013.igem.org
(Difference between revisions)
|
|
Line 1: |
Line 1: |
- | =='''7/03/13 BioBrick Design Presentation and Grad Adviser Meeting'''==
| |
| | | |
- | *Designed a biobrick with:
| |
- | **C terminus His-tagged kerA
| |
- | ***CATCATCATCATCATCAT
| |
- | **Prefix: gaattcgcggccgcttctagag
| |
- | **Suffix: tactagtagcggccgctgcag
| |
- | *Moreover, the bio brick must include
| |
- | **Eliminated EcoRI and PstI restriction sites from kerA nucleotide seq
| |
- | ***EcoRI (gaattc--814) and PstI (ctgcag--978)
| |
- | ***Conserved aa seq + biobrick prefix + suffix
| |
- | **Secretion signal peptide
| |
- | **Inducible promoter
| |
- | *We also presented a feasible timeline of our project, which included:
| |
- | **Assembly of biobrick and transformation into E. coli
| |
- | **Transformation of B. subtilis
| |
- | **Keratinase isolation and keratinase assays
| |
- | **kerA mutagenesis for optimization of the keratinase
| |
Latest revision as of 08:16, 26 September 2013