Team:UC Chile/Team Members

From 2013.igem.org

(Difference between revisions)
Line 295: Line 295:
                                 <h4>XY - ATGGCCAACTAAGAGTTG GCACTCGCCATGTAA</h4>
                                 <h4>XY - ATGGCCAACTAAGAGTTG GCACTCGCCATGTAA</h4>
                                 <table>
                                 <table>
-
                                     <tr><td class="col1"><b>Occupation</b></td><td>:</td><td>Physicist.
+
                                     <tr><td class="col1"><b>Occupation</b></td><td>:</td><td>Physicist.</td></tr>
-
                                     <tr><td class="col1"><b>iGEM</b></td><td>:</td><td>Mathematical modeling and Human Practice organization.
+
                                     <tr><td class="col1"><b>iGEM</b></td><td>:</td><td>Mathematical modeling and Human Practice organization.</td></tr>
-
                                     <tr><td class="col1"><b>Likes to</b></td><td>:</td><td>Argue and annoy. Watch Slam Dunk and Captain Tsubasa, drink “mate” and read about politics.
+
                                     <tr><td class="col1"><b>Likes to</b></td><td>:</td><td>Argue and annoy. Watch Slam Dunk and Captain Tsubasa, drink “mate” and read about politics.</td></tr>
-
                                     <tr><td class="col1"><b>Frustrated Dream</b></td><td>:</td><td>Have a good voice, be able to draw, recognize colors, have good eyesight and more time.
+
                                     <tr><td class="col1"><b>Frustrated Dream</b></td><td>:</td><td>Have a good voice, be able to draw, recognize colors, have good eyesight and more time.</td></tr>
-
                                     <tr><td class="col1"><b>Fun fact</b></td><td>:</td><td>Not a funny guy.
+
                                     <tr><td class="col1"><b>Fun fact</b></td><td>:</td><td>Not a funny guy.</td></tr>
-
                                     <tr><td class="col1"><b>Lab mistake</b></td><td>:</td><td>Nobody knows how he made a gel that didn’t solidify.
+
                                     <tr><td class="col1"><b>Lab mistake</b></td><td>:</td><td>Nobody knows how he made a gel that didn’t solidify.</td></tr>
                                 </table>
                                 </table>
                             </div>
                             </div>

Revision as of 16:41, 26 September 2013

Wiki-IGEM

Team Members

Magdalena Ribbeck

XX - ATGGCAGGCGATGCACTGGAAAACGCA  AGAATTTAATAAGAGTGTAAG

Occupation:Civil Engineer in Biotechnology.
iGEM:Videogame realization and lab work.
Likes to:Write, read about psychology, to draw and to practice Judo.
Frustrated Dream:To be a writer.
Fun fact:Reads “Origin of species”, Charles Darwin, for fun.
Lab mistake:Spill chloroform on Valentina.

Valentina Frenkel

XX - GTCGCCCTTGAGAACACAATTAATGCC TTCAGAGAGAATAAAGAGCTC

Occupation:Civil Engineer in Biotechnology.
iGEM:Primer design. Wiki and videogame development. Lab work.
Likes to:Draw, watch anime and series, play Lucas arts games (Monkey island, Grim fandango, Full throttle, etc) and Pokemon.
Frustrated Dream:To be able to do better illustrations and play an instrument professionally.
Fun fact:She does not believe in photographs, she thinks she can get a better capture of the essence of people through her cute drawings.
Lab mistake:Use the whole stock pHnCBS1D instead of the dilution.

Felipe Ignacio Erices Canales

XY - TTTGAGCTTATACCCGAG GAAAGAATTTGTGAGTCT

Occupation:Civil Engineer in Biotechnology.
iGEM:Human translator to 1&0 and hunter of optimal sequences. Wiki programing and lab work.
Likes to:Do sports, eat pineapple and corn pizza, random Youtube videos, eat Inca Gold, share food, solve puzzles and do origami.
Frustrated Dream:Not to be ignored, try to keep the lab neat and be able to hibernate.
Fun fact:He can split an apple in half just with his hands.
Lab mistake:Run an important gel without the ladder.

Ilenne Del Valle.

XX - ATACTTGAAAACAACGAG GATGAATTG GTAGCGTTGCTAGAA

Occupation:Biochemist
iGEM:Prevention of future complications. Lab work organization and administration. Experimental design.
Likes to:Practice Judo and read.
Frustrated Dream:That the iGEM team doesn’t think that she is sending the emails while angry at them.
Fun fact:She has a really high rate of paper reading. She did an exchange program in US. She suffers for being the only vegetarian in a carnivorous group.
Lab mistake:Break a huge ellermeyer flask the very first day in the lab and in front of the boss.

Josefina Philippi

XX - TAATAAAGCGAATTTATAAACGCG CCACACATCCTGATACCTCCAATA

Occupation:Economist and Biologist.
iGEM:Team’s boss. Bureaucratics and lab experiment management.
Likes to:Cook, sitcom series, "The Little Prince" and the beach.
Frustrated Dream:To be a good singer.
Fun fact:She makes the lab explode with dry ice.
Lab mistake:Make a high concentrated RedGel Agarose and stain Lab notebook with chloroform.

Sebastián Álvarez

XY - AGCGAGTAAGCGTCTACTATTGCCAAT GCGTTGGTGGCCAGGGAGTAA

Occupation:Biologist.
iGEM:More that he can handle, but not enough to get credit for it.
Likes to:Swim (male marmaid aka marman), eat sushi, the amazing word of science fiction with authors like Isaac Asimov, comedy and staff.
Frustrated Dream:To grow a majestic beard, the manliest ever seen.
Fun fact:He won a masculinity contest of napkin folding and burnt a part of his hair trying to hear fire.
Lab mistake:Leave the centrifuge working with no tubes inside … all night long.

Javier Cillero

XY - TAAGCAGTTATTGAAAGG TGCATCCTACTTGAGCGCTAA

Occupation:Biologist.
iGEM:Lab work and experimental design.
Likes to:Play soccer, go to the stadium, walk under the rain and feel like a fish.
Frustrated Dream:To be a soccer player and be able to play any instrument.
Fun fact:He can make cigarette smoke rings. Has a collection of beer cans, USA, prepare!.
Lab mistake:He told us “I’m immune to those mistakes … noobies”. The next day he dropped ALL THE IMPORTANT TUBES, that took us months to do, and broke the containing box.

Belén Céspedes

XX - TAAGAGTTAGAAAAC TGCGAATCTCCCGAGGACGAGAGT

Occupation:Physicist.
iGEM:Mathematical modelling, Human Practices and paper traffic.
Likes to:Play with animals and plants, eat deserts and collect stuff. Drink Quatro Guaraná.
Frustrated Dream:To make a sound biosensor and cure the world from Malaria. Join Cirque du Soleil.
Fun fact:She can talk with animals, juggles and rides a monocycle. She’s allergic to everything.
Lab mistake:She transplant the Nicotianas and change the order of the plants so, we didn’t know which plants had the GFP. We had to redo all genomic extraction.

Manuel Álamo

XY - ATGGCCAACTAAGAGTTG GCACTCGCCATGTAA

Occupation:Physicist.
iGEM:Mathematical modeling and Human Practice organization.
Likes to:Argue and annoy. Watch Slam Dunk and Captain Tsubasa, drink “mate” and read about politics.
Frustrated Dream:Have a good voice, be able to draw, recognize colors, have good eyesight and more time.
Fun fact:Not a funny guy.
Lab mistake:Nobody knows how he made a gel that didn’t solidify.