Team:Bielefeld-Germany/Labjournal/June
From 2013.igem.org
(Difference between revisions)
Line 132: | Line 132: | ||
====Organization==== | ====Organization==== | ||
*Let’s go to Lyon, flights are booked for the [https://2013.igem.org/Europe/Pre-Jamboree European jamboree in Lyon] from October 11 to 13, 2013. | *Let’s go to Lyon, flights are booked for the [https://2013.igem.org/Europe/Pre-Jamboree European jamboree in Lyon] from October 11 to 13, 2013. | ||
- | *We will participate at | + | *We will participate at [http://www.bio.nrw.de/studentconvention BioNRW pHD Student Convention] in Düsseldorf at July 13. |
Line 140: | Line 140: | ||
====Mediators==== | ====Mediators==== | ||
*Glycerol dehydrogenase | *Glycerol dehydrogenase | ||
- | **Cloning of GldA into pSB1C3 shipping vector with [[Team:Bielefeld-Germany/Labjournal/Molecular#NEB | + | **Cloning of GldA into pSB1C3 shipping vector with [[Team:Bielefeld-Germany/Labjournal/Molecular#NEB BioBrick Assembly Kit | NEB BioBrick assembly Kit]] did not work as expected. |
- | **Screening of colonies with [[Team:Bielefeld-Germany/Labjournal/Molecular#Colony PCR | colony PCR]] and | + | **Screening of colonies with [[Team:Bielefeld-Germany/Labjournal/Molecular#Colony PCR | colony PCR]] and plasmid [[Team:Bielefeld-Germany/Labjournal/Molecular#Restriction analysis | restriction analysis]] shows re-ligated pSB1C3 shipping vector. |
**Bands are at size of 2000 bp, the length of linear pSB1C3. | **Bands are at size of 2000 bp, the length of linear pSB1C3. | ||
- | [[Image:IGEM_Bielefeld_Religierter_pSB1C3_restriktion.jpg|200px|thumb|left| <p align="justify">'''Figure 2: | + | [[Image:IGEM_Bielefeld_Religierter_pSB1C3_restriktion.jpg|200px|thumb|left| <p align="justify">'''Figure 2: Agarose gel with [https://www.neb.com/products/n3232-1-kb-dna-ladder NEB 1 kb DNA Ladder] as marker. Bands are showing [[Team:Bielefeld-Germany/Labjournal/Molecular#Restriction analysis | restriction analysis]] from cloning of GldA into pSB1C3 shipping vector with [[Team:Bielefeld-Germany/Labjournal/Molecular#NEB BioBrick Assembly Kit | NEB BioBrick assembly Kit]]. Assembly did not work, only one band at the size of 2000 bp showing re-ligated pSB1C3. '''</p>]] |
- | ** | + | **Primer design for pSB1C3 according an universal usable backbone for [[Team:Bielefeld-Germany/Labjournal/Molecular#Gibson assembly | Gibson Assembly]] with Prefix and Suffix specific overlaps: |
***Forward Primer pSB1C3 (23 bp): TACTAGTAGCGGCCGCTGCAGTC | ***Forward Primer pSB1C3 (23 bp): TACTAGTAGCGGCCGCTGCAGTC | ||
***Reverse Primer pSB1C3 (23 bp): CTCTAGAAGCGGCCGCGAATTCC | ***Reverse Primer pSB1C3 (23 bp): CTCTAGAAGCGGCCGCGAATTCC | ||
Line 154: | Line 154: | ||
====Porines==== | ====Porines==== | ||
- | *Cloning of OprF into pSB1C3 shipping vector with [[Team:Bielefeld-Germany/Labjournal/Molecular#NEB | + | *Cloning of OprF into pSB1C3 shipping vector with [[Team:Bielefeld-Germany/Labjournal/Molecular#NEB BioBrick Assembly Kit | NEB BioBrick assembly Kit]] did not work as expected. |
- | *Screening of colonies with [[Team:Bielefeld-Germany/Labjournal/Molecular#Colony PCR | colony PCR]] and | + | *Screening of colonies with [[Team:Bielefeld-Germany/Labjournal/Molecular#Colony PCR | colony PCR]] and plasmid [[Team:Bielefeld-Germany/Labjournal/Molecular#Restriction analysis | restriction analysis]] shows re-ligated pSB1C3 shipping vector as described for GldA cloning. |
====Nanowires==== | ====Nanowires==== | ||
*Successful genomic DNA isolation of ''Geobacter sulfurreducens'' strain. | *Successful genomic DNA isolation of ''Geobacter sulfurreducens'' strain. | ||
- | *Successful PCR with | + | *Successful PCR with forward and reverse primer GSU 1491-1495 and GSU 1496-1505 on the appropriate gene-cluster of ''Geobacter sulfurreducens''. |
<div align="center"> | <div align="center"> | ||
{| class="wikitable" style="text-align: center" | {| class="wikitable" style="text-align: center" | ||
- | |+Table1: Standard Phusion PCR Master Mix for amplification of Geobacter sulfurreducens gene cluster GSU 1491-1495 and GSU 1496-1505. | + | |+Table1: Standard Phusion PCR Master Mix for amplification of ''Geobacter sulfurreducens'' gene cluster GSU 1491-1495 and GSU 1496-1505. |
|Component || Volume | |Component || Volume | ||
|- | |- | ||
Line 210: | Line 210: | ||
*Clearly visible band at size of 7200 bp, the length of gene cluster GSU 1491-1495. | *Clearly visible band at size of 7200 bp, the length of gene cluster GSU 1491-1495. | ||
*Clearly visible band at size of 9000 bp, the length of gene cluster GSU 1496-1505. | *Clearly visible band at size of 9000 bp, the length of gene cluster GSU 1496-1505. | ||
- | *Several bands at smaller sizes suggest alternative primer binding sites in the genome of Geobacter sulfurreducens. | + | *Several bands at smaller sizes suggest alternative primer binding sites in the genome of ''Geobacter sulfurreducens''. |
*GSU 1491-1495 and GSU 1496-1505 PCR products were isolated and purified by gel extraction. | *GSU 1491-1495 and GSU 1496-1505 PCR products were isolated and purified by gel extraction. | ||
<br> | <br> | ||
- | [[File:iGEM_Bielefeld_2013_26.06.13_Wires.jpg|left|300px|thumb|'''Figure 4:''' | + | [[File:iGEM_Bielefeld_2013_26.06.13_Wires.jpg|left|300px|thumb|'''Figure 4:''' Agarose gel from PCR on the gene-clusters GSU 1491-1495 and GSU 1496-1505 of ''Geobacter sulfurreducens'' strain. Ladder: GeneRuler™ 1 kb DNA Ladder from Thermo Scientific.]] |
<br> | <br> | ||
- | *Inoculation of new cultivation tubes, containing [https://2013.igem.org/Team:Bielefeld-Germany/Labjournal/Molecular#Geobacter_Medium ''Geobacter''-medium] with ''Geobacter sulfurreducens'' culture for higher concentrated PCR-template production by whole genome isolation. Cultivation at | + | *Inoculation of new cultivation tubes, containing [https://2013.igem.org/Team:Bielefeld-Germany/Labjournal/Molecular#Geobacter_Medium ''Geobacter''-medium] with ''Geobacter sulfurreducens'' culture for higher concentrated PCR-template production by whole genome isolation. Cultivation at 35°C on a rotary shaker with 110 rpm. |
<br><br><br><br> | <br><br><br><br> | ||
<br><br><br><br> | <br><br><br><br> |
Revision as of 22:01, 4 October 2013
June
Milestones
- Starting lab work on the sub-project Porins.
- Successful PCR on OprF gene from Pseudomonas fluorescens. OprF with Pre- and Suffix overlaps could be amplified from genome.
- Planning of our Human Practice projects started and the first participations are fixed.
Week 5
Organization
- iGEM-Team Bielefeld will support the ‘CeBiTec Student Academy’ from 26.-30. August with an own experiment.
MFC
Mediators
Porines
- Primer design for isolation of OprF from Pseudomonas fluorescens strain, with overlaps for BioBrick Prefix and Suffix:
- Forward Primer OprF (49 bp): GAATTCGCGGCCGCTTCTAGATGAAACTGAAAAACACCTTGGGCTTTGC
- Reverse Primer OprF (51 bp): CTGCAGCGGCCGCTACTAGTATTACTTAGCTTGGGCTTCAACCTGCGCTTC
Nanowires
- Primer design for isolation of gene-cluster GSU 1491-1495, GSU 1496-1505 and GSU Promoter-1496-1505 from Geobacter sulfurreducens, containing overlaps for BioBrick Prefix and Suffix:
- Forward GSU 1491-1495 (45 bp):
GAATTCGCGGCCGCTTCTAGATGCAGGCTAGCAGACTGGGAGAAC - Reverse GSU 1491-1495 (38 bp):
CTGCAGCGGCCGCTACTAGTATCACTCCTCATCCATGC - Forward GSU 1496-1505 (42 bp):
GAATTCGCGGCCGCTTCTAGAGTTGGCCAATTACCCCCATAC - Reverse GSU 1496-1505 (51 bp):
CTGCAGCGGCCGCTACTAGTATCATAAACGAACCTCGTCCCAAGGCATCAG - Forward GSU Promoter-1496-1505 (52 bp):
GAATTCGCGGCCGCTTCTAGAGGATAGGATCCGTCACCGAGTGCGAACTGCC
- Forward GSU 1491-1495 (45 bp):
Week 6
Organization
- Thanks to NEB for the [http://www.neb-online.de/index.php/en/neb-announcements/231-igem-2013 free iGEM kit] with many useful laboratory things for all german iGEM teams.
- We are working on our first press release.
- Having a short radio contribution in the Bielefeld university campus radio ([http://www.radiohertz.de/beta-site radio 87.9 hertz]).
MFC
Mediators
- Glycerol dehydrogenase
- Isolation of shipping vector pSB1C3 out of 2013 Distribution Kit Plate 5 Well 3A with insert Part RFP (<bbpart>J04450</bbpart>) for better transformation characterization ([http://parts.igem.org/Help:2013_DNA_Distribution Distribution Kit BioBrick isolation]).
- Transformation of <partinfo>BBa_J04450</partinfo> into Escherichia coli KRX strain.
- Plasmid isolation of <partinfo>BBa_J04450</partinfo>.
Week 7
MFC
Mediators
Cytochromes
- Cultivation of Shewanella oneidensis MR-1 in liquid LB medium at 30 °C
- Isolation of genomic DNA from S. oneidensis and dilution to the subsequently used PCR template:
- 4-2006-453: 5.5ng/µl
- Amplification of the mtrCAB cluster with Phusion polymerase
- Annealing: Gradient [55.8 - 56.7 - 57.8 - 59.1 - 60.4 - 61.7 - 62.9 - 63.9]
- Elongation: 1:15 min
- Notes: Clear Bands at the expected 5.2 kb, the annealing temperature seems not to have an effect.
- PCR-CleanUp
- Lane2: 4-2106-451: 7.4 ng/µl
- Lane5: 4-2106-451: 8.5 ng/µl
Porines
- Starting first cultivation of Pseudomonas fluorescens strain for complete genome isolation.
- Successful genome isolation of Pseudomonas fluorescens.
- Successful PCR with Forward and Reverse Primer OprF on the OprF gene of Pseudomonas fluorescens strain.
- OprF PCR product was isolated by agarose gel electrophoresis and purified.
- Bands are at expected size of 1300 bp.
Nanowires
- Anaerobic cultivation of Geobacter sulfurreducens strain DSM-12127 in nitrogen-gassed Geobacter-medium, which was suggested by the strain-supplier: German Collection of Microorganisms and Cell Cultures DSMZ, using 30 mL cultivation-tubes and silicone stoppers with upending rim.
Week 8
Organization
- Let’s go to Lyon, flights are booked for the European jamboree in Lyon from October 11 to 13, 2013.
- We will participate at [http://www.bio.nrw.de/studentconvention BioNRW pHD Student Convention] in Düsseldorf at July 13.
MFC
Mediators
- Glycerol dehydrogenase
- Cloning of GldA into pSB1C3 shipping vector with NEB BioBrick assembly Kit did not work as expected.
- Screening of colonies with colony PCR and plasmid restriction analysis shows re-ligated pSB1C3 shipping vector.
- Bands are at size of 2000 bp, the length of linear pSB1C3.
- Primer design for pSB1C3 according an universal usable backbone for Gibson Assembly with Prefix and Suffix specific overlaps:
- Forward Primer pSB1C3 (23 bp): TACTAGTAGCGGCCGCTGCAGTC
- Reverse Primer pSB1C3 (23 bp): CTCTAGAAGCGGCCGCGAATTCC
- Primer design for pSB1C3 according an universal usable backbone for Gibson Assembly with Prefix and Suffix specific overlaps:
Porines
- Cloning of OprF into pSB1C3 shipping vector with NEB BioBrick assembly Kit did not work as expected.
- Screening of colonies with colony PCR and plasmid restriction analysis shows re-ligated pSB1C3 shipping vector as described for GldA cloning.
Nanowires
- Successful genomic DNA isolation of Geobacter sulfurreducens strain.
- Successful PCR with forward and reverse primer GSU 1491-1495 and GSU 1496-1505 on the appropriate gene-cluster of Geobacter sulfurreducens.
Component | Volume |
H2O | to 50 µL |
Template (100 ng) | 20 µL |
Betain 5 M | 12.5 µL |
5 x Phusion GC Buffer | 10 µL |
DMSO | 2.5 µL |
Primer-Mix 10 mM | 2.5 µL |
10mM dNTP´s | 2 µL |
Phusion DNA Polymerase | 0.5 µL |
Step | Temperature | Time | Cycles |
Denaturation | 98 °C | 30 sec | |
Denaturation | 98 °C | 30 sec | 10 |
Annealing | 55 °C | 60 sec | 10 |
Elongation | 72°C | 270 sec | 10 |
Denaturation | 98 °C | 30 sec | 25 |
Annealing | 60 °C | 60 sec | 25 |
Elongation | 72 °C | 270 sec | 25 |
Elongation | 72 °C | 300 sec |
- Clearly visible band at size of 7200 bp, the length of gene cluster GSU 1491-1495.
- Clearly visible band at size of 9000 bp, the length of gene cluster GSU 1496-1505.
- Several bands at smaller sizes suggest alternative primer binding sites in the genome of Geobacter sulfurreducens.
- GSU 1491-1495 and GSU 1496-1505 PCR products were isolated and purified by gel extraction.
- Inoculation of new cultivation tubes, containing Geobacter-medium with Geobacter sulfurreducens culture for higher concentrated PCR-template production by whole genome isolation. Cultivation at 35°C on a rotary shaker with 110 rpm.