Team:Bielefeld-Germany/Labjournal/June

From 2013.igem.org

(Difference between revisions)
 
(44 intermediate revisions not shown)
Line 5: Line 5:
__NOTOC__
__NOTOC__
 +
<div id=globalwrapper style="padding-left:20px; padding-right:20px">
 +
<div id="leftcol" style="width:750px; float:left; overflow:auto;">
<html>
<html>
-
<head>
 
-
 
-
<script>
 
-
 
-
</script>
 
-
</head>
 
-
 
-
 
<style>
<style>
-
h1{padding:10px 350px;}
+
h1{margin-top:20px;}
</style>
</style>
-
</html>
 
-
<div id=globalwrapper style="padding-left:20px; padding-right:20px">
 
-
<div id="leftcol" style="width:750px; float:left; overflow:auto;">
 
-
<html>
 
<h1>June</h1>
<h1>June</h1>
</html>
</html>
Line 27: Line 17:
===Milestones===
===Milestones===
-
<br><br><br><br>
 
 +
*Starting lab work on the sub-project [[Team:Bielefeld-Germany/Project/Porins|Porins]].
 +
*Successful PCR on ''oprF'' gene from ''Pseudomonas fluorescens''. The ''oprF'' with pre- and suffix overlaps could be amplified from genome.
 +
*Planning of our [[Team:Bielefeld-Germany/HumanPractice|Human Practice]] projects started and the first participations are fixed.
 +
*MFC: Designing of 3D models of MFC´s and visited a hacker space in order to print it in a 3D printer.
 +
<br><br>
 +
===Week 5===
-
 
-
 
-
===Week 5===
 
====Organization====
====Organization====
 +
*iGEM-Team Bielefeld will support the ‘CeBiTec Student Academy’ from August 26th to 30th  with an own experiment.
-
*iGEM-Team Bielefeld will support the ‘CeBiTec Pupil Academy’ from 26.-30. August with an own experiment.
 
====MFC====
====MFC====
-
 
+
*Constructed a resistor box with different potentiometers and LEDs in order to be able to test our fuel cells
-
 
+
-
====Mediators====
+
-
 
+
-
 
+
-
====Cytochromes====
+
-
 
+
-
 
+
-
====Biosafety====
+
-
 
+
====Porines====
====Porines====
-
*Primerdesign for isolation of OprF from ''Pseudomonas fluorescens'' strain, with overlaps for Biobrick Prefix and Suffix:
+
*Primer design for isolation of ''oprF'' from ''Pseudomonas fluorescens'' strain, with overlaps for BioBrick Prefix and Suffix:
-
*Forward Primer OprF (49 bp): GAATTCGCGGCCGCTTCTAGATGAAACTGAAAAACACCTTGGGCTTTGC
+
*Forward primer ''oprF'' (49 bp): GAATTCGCGGCCGCTTCTAGATGAAACTGAAAAACACCTTGGGCTTTGC
-
*Reverse Primer OprF (51 bp): CTGCAGCGGCCGCTACTAGTATTACTTAGCTTGGGCTTCAACCTGCGCTTC
+
*Reverse primer ''oprF'' (51 bp): CTGCAGCGGCCGCTACTAGTATTACTTAGCTTGGGCTTCAACCTGCGCTTC
-
 
+
-
 
+
-
 
+
-
 
+
 +
====Nanowires====
 +
*Primer design for isolation of gene-cluster GSU 1491-1495, GSU 1496-1505 and GSU Promoter-1496-1505 from ''Geobacter sulfurreducens'', containing overlaps for BioBrick Prefix and Suffix:
 +
**Forward GSU 1491-1495 (45 bp):<br> GAATTCGCGGCCGCTTCTAGATGCAGGCTAGCAGACTGGGAGAAC
 +
**Reverse GSU 1491-1495 (38 bp): <br>CTGCAGCGGCCGCTACTAGTATCACTCCTCATCCATGC
 +
**Forward GSU 1496-1505 (42 bp): <br>GAATTCGCGGCCGCTTCTAGAGTTGGCCAATTACCCCCATAC
 +
**Reverse GSU 1496-1505 (51 bp): <br>CTGCAGCGGCCGCTACTAGTATCATAAACGAACCTCGTCCCAAGGCATCAG
 +
**Forward GSU Promoter-1496-1505 (52 bp):<br> GAATTCGCGGCCGCTTCTAGAGGATAGGATCCGTCACCGAGTGCGAACTGCC
 +
<br><br>
===Week 6===
===Week 6===
====Organization====
====Organization====
-
*Thanks to NEB Biolabs for the free iGEM kit with many useful laboratory things for all German iGEM teams.
+
*Thanks to NEB for the [http://www.neb-online.de/index.php/en/neb-announcements/231-igem-2013 free iGEM kit] with many useful laboratory things for all german iGEM teams.
*We are working on our first press release.
*We are working on our first press release.
-
*Having a short radio contribution in the Bielefeld university campus radio (radio 87.9 hertz).
+
*Having a short radio contribution in the Bielefeld university campus radio ([http://www.radiohertz.de/beta-site radio 87.9 hertz]).
====MFC====
====MFC====
-
 
+
*Connected film canister cells in series and parallel to increase voltage/current
 +
*Tested different redox mediators in our fuel cell
====Mediators====
====Mediators====
*Glycerol dehydrogenase
*Glycerol dehydrogenase
-
**Isolation of shipping vector pSB1C3 out of 2013 Distribution Kit Plate 5 Well 3A with insert Part RFP (J04450) for better transformation characterization (Distribution Kit BioBrick isolation).  
+
**Isolation of shipping vector pSB1C3 out of 2013 Distribution Kit Plate 5 Well 3A with insert Part RFP (<bbpart>J04450</bbpart>) for better transformation characterization ([http://parts.igem.org/Help:2013_DNA_Distribution Distribution Kit BioBrick isolation]).  
-
**Transformation of <partinfo>BBa_J04450</partinfo> into ''Escherichia coli'' KRX strain.
+
**[[Team:Bielefeld-Germany/Labjournal/Molecular#Transformation via electroporation| Transformation]] of <partinfo>BBa_J04450</partinfo> into ''Escherichia coli'' KRX strain.
-
**Plasmid isolation of <partinfo>BBa_J04450</partinfo>.
+
**[[Team:Bielefeld-Germany/Labjournal/Molecular#Used Kits | Plasmid isolation]] of <partinfo>BBa_J04450</partinfo>.
-
 
+
-
 
+
-
====Cytochromes====
+
-
 
+
-
 
+
-
====Biosafety====
+
-
 
+
-
 
+
-
====Porines====
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
 +
<br><br>
===Week 7===
===Week 7===
-
 
-
====Organization====
 
-
*Nothing organizational.
 
====MFC====
====MFC====
-
 
+
*Constructed a stack of five film canister cells which was able to make a LED glow faintly
-
 
+
-
====Mediators====
+
-
 
+
====Cytochromes====
====Cytochromes====
-
*Cultivation of Shewanella oneidensis MR-1 in liquid LB medium at 30 °C
+
*Cultivation of ''Shewanella oneidensis'' MR-1 in liquid LB medium at 30 °C
-
*Isolation of genomic DNA from S. oneidensis
+
*Isolation of genomic DNA from ''S. oneidensis'' and dilution to the subsequently used PCR template:  
-
**4-2006-451: Conc.:453.1 ng/µl    OD260/280: 1.92    OD260/230:2.78
+
**4-2006-453: 5.5ng/µl
-
**4-2006-452: Conc.:447.1 ng/µl    OD260/280: 1.92    OD260/230:2.67
+
-
**Dilution to PCR template: 4-2006-453: 5.5ng/µl
+
-
*Amplification of the mtrCAB cluster
+
*Amplification of the ''mtrCAB'' cluster with [https://2013.igem.org/Team:Bielefeld-Germany/Labjournal/Molecular#Used_enzymes Phusion polymerase]
-
**Gradient: 55.8-56.7-57.8-59.1-60.4-61.7-62.9-63.9
+
**Annealing: Gradient [55.8 - 56.7 - 57.8 - 59.1 - 60.4 - 61.7 - 62.9 - 63.9]
-
**Clear Bands at the expected 5.2kb
+
**Elongation: 1:15 min
 +
**Notes: Clear Bands at the expected 5.2 kb, the annealing temperature seems not to have an effect.
-
*PCR-CleanUp
+
*[https://2013.igem.org/Team:Bielefeld-Germany/Labjournal/Molecular#Used_Kits PCR-CleanUp]
-
**PCR-cleanup of No.2 and No.5 with Macherey-Nagel-Kit and NanoDrop-Measurement
+
**Lane2: 4-2106-451: 7.4 ng/µl
**Lane2: 4-2106-451: 7.4 ng/µl
**Lane5: 4-2106-451: 8.5 ng/µl
**Lane5: 4-2106-451: 8.5 ng/µl
-
 
-
 
-
 
-
====Biosafety====
 
====Porines====
====Porines====
 +
*Starting first cultivation of ''Pseudomonas fluorescens'' strain for [[Team:Bielefeld-Germany/Labjournal/Molecular#Whole Genome Isolation | complete genome isolation]].
 +
*Successful [[Team:Bielefeld-Germany/Labjournal/Molecular#Whole Genome Isolation | genome isolation]] of ''Pseudomonas fluorescens''.
 +
*Successful PCR with forward and reverse primer ''oprF'' on the ''oprF'' gene of ''Pseudomonas fluorescens'' strain.
-
*Starting first cultivation of ''Pseudomonas fluorescens'' strain for complete [https://2013.igem.org/Team:Bielefeld-Germany/Labjournal/ProtocolsPrograms genome isolation.]
+
[[Image:IGEM_Bielefeld_Standard_Phusion_PCR_Master_MixLRO.jpg|300px|thumb|left|<p align="justify"> '''Table 1: Standard Phusion PCR Master Mix. '''</p>]]
-
*Successful [https://2013.igem.org/Team:Bielefeld-Germany/Labjournal/ProtocolsPrograms genome isolation] of ''Pseudomonas fluorescens''.  
+
[[Image:IGEM_Bielefeld_Standard_Phu_PCR_GldA_OprF.jpg|300px|thumb|center| <p align="justify">'''Table 2: Two step standard Phusion PCR program for ''gldA'' amplification. '''</p>]]
-
*Successful PCR with Forward and Reverse Primer OprF on the OprF gene of ''Pseudomonas fluorescens'' strain.
+
-
[[Image:IGEM_Bielefeld_Standard_Phusion_PCR_Master_MixLRO.jpg|200px|thumb|left| '''Table 1: Standard Phusion PCR Master Mix. ''']]
+
*''oprF'' PCR product was isolated by agarose gel electrophoresis and [[Team:Bielefeld-Germany/Labjournal/Molecular#Used Kits | purified]].
-
 
+
-
[[Image:IGEM_Bielefeld_Standard_Phu_PCR_GldA_OprF.jpg|200px|thumb|center| '''Table 2: Two step standard Phusion PCR programm for GldA amplification. ''']]
+
-
 
+
-
 
+
-
 
+
-
 
+
-
*OprF PCR product was isolated by Agarose gel electrophorese and purificated.
+
*Bands are at expected size of 1300 bp.
*Bands are at expected size of 1300 bp.
-
[[Image:IGEM_Bielefeld_OprF_standard_PCR.jpg|200px|thumb|left| '''Figure 1: Agarosegel from PCR on the OprF gene of ''Pseudomonas fluorescens'' strain with forward and reverse primer OprF. For Ladder we used GeneRuler™ 1 kb DNA Ladder fromThermo Scientific.  ''']]
+
[[Image:IGEM_Bielefeld_OprF_standard_PCR.jpg|200px|thumb|left| <p align="justify">'''Figure 1: Agarose gel from PCR on the ''oprF'' gene of ''Pseudomonas fluorescens'' strain with forward and reverse primer ''oprF''. As a Ladder we used [http://www.thermoscientificbio.com/nucleic-acid-electrophoresis/generuler-1-kb-dna-ladder-ready-to-use-250-to-10000-bp GeneRuler™ 1 kb DNA Ladder from Thermo Scientific].  '''</p>]]
 +
<br>
 +
<br>
 +
====Nanowires====
 +
*Anaerobic cultivation of ''Geobacter sulfurreducens'' strain DSM-12127 in nitrogen-gassed [https://2013.igem.org/Team:Bielefeld-Germany/Labjournal/Molecular#Geobacter_Medium ''Geobacter''-medium], which was suggested by the strain-supplier: German Collection of Microorganisms and Cell Cultures DSMZ, using 30 mL cultivation-tubes and silicone stoppers with upending rim.
 +
<br><br>
 +
===Week 8===
 +
====Organization====
 +
*Let’s go to Lyon, flights are booked for the [https://2013.igem.org/Europe/Pre-Jamboree European jamboree in Lyon] from October 11 to 13, 2013.
 +
*We will participate at [http://www.bio.nrw.de/studentconvention BioNRW pHD Student Convention] in Düsseldorf at July 13th.
-
 
-
 
-
 
-
 
-
 
-
<br><br><br><br>
 
-
<br><br><br><br>
 
-
<br><br><br><br>
 
-
<br><br><br><br>
 
-
<br><br><br><br>
 
-
<br><br><br><br>
 
-
 
-
===Week 8===
 
-
 
-
====Organization====
 
-
*Let’s go to Lyon, flights are booked for the European jamboree in Lyon from 11.-13. October 2013.
 
-
*We will participate at ‘BioNRW pHD Student Convention’ in Düsseldorf at 13. July.
 
====MFC====
====MFC====
-
 
+
*Started planning a new, air tight fue cell model with improved geometry.
====Mediators====
====Mediators====
*Glycerol dehydrogenase
*Glycerol dehydrogenase
-
 
+
**Cloning of ''gldA'' into pSB1C3 shipping vector with [[Team:Bielefeld-Germany/Labjournal/Molecular#NEB BioBrick Assembly Kit | NEB BioBrick assembly Kit]] did not work as expected.
-
**Cloning of GldA into pSB1C3 shipping vector with NEB Biobrick assembly Kit did not work as expected.
+
**Screening of colonies with [[Team:Bielefeld-Germany/Labjournal/Molecular#Colony PCR | colony PCR]] and plasmid [[Team:Bielefeld-Germany/Labjournal/Molecular#Restriction analysis | restriction analysis]] shows re-ligated pSB1C3 shipping vector.
-
**Screening of colonies with colony PCR and Plasmid restriction analysis shows religated pSB1C3 shipping vector.
+
**Bands are at size of 2000 bp, the length of linear pSB1C3.
**Bands are at size of 2000 bp, the length of linear pSB1C3.
-
[[Image:IGEM_Bielefeld_Religierter_pSB1C3_restriktion.jpg|200px|thumb|left| '''Figure 1: Agarosegel with NEB 1 kb DNA Ladder as marker. Bands are showing restriction analysis from cloning of GldA into pSB1C3 shipping vector with NEB Biobrick assembly Kit. Assembly did not work, only one band at the size of 2000 bp showing religated pSB1C3. ''']]
+
[[Image:IGEM_Bielefeld_Religierter_pSB1C3_restriktion.jpg|200px|thumb|left| <p align="justify">'''Figure 2: Agarose gel with [https://www.neb.com/products/n3232-1-kb-dna-ladder NEB 1 kb DNA Ladder] as marker. Bands are showing [[Team:Bielefeld-Germany/Labjournal/Molecular#Restriction analysis | restriction analysis]] from cloning of ''gldA'' into pSB1C3 shipping vector with [[Team:Bielefeld-Germany/Labjournal/Molecular#NEB BioBrick Assembly Kit | NEB BioBrick assembly Kit]]. Assembly did not work, only one band at the size of 2000 bp showing re-ligated pSB1C3. '''</p>]]
 +
**Primer design for pSB1C3 according an universal usable backbone for [[Team:Bielefeld-Germany/Labjournal/Molecular#Gibson assembly | Gibson Assembly]] with Prefix and Suffix specific overlaps:
 +
***Forward primer pSB1C3 (23 bp): TACTAGTAGCGGCCGCTGCAGTC
 +
***Reverse primer pSB1C3 (23 bp): CTCTAGAAGCGGCCGCGAATTCC
-
<br><br><br><br><br><br>
 
-
<br><br><br><br><br><br>
 
-
**Primerdesign for pSB1C3 according an universal usable backbone for Gibson Assembly with Prefix and Suffix specific overlaps:
 
-
***Forward Primer pSB1C3 (23 bp): TACTAGTAGCGGCCGCTGCAGTC
 
-
***Reverse Primer pSB1C3 (23 bp): CTCTAGAAGCGGCCGCGAATTCC
 
 +
====Porines====
 +
*Cloning of ''oprF'' into pSB1C3 shipping vector with [[Team:Bielefeld-Germany/Labjournal/Molecular#NEB BioBrick Assembly Kit | NEB BioBrick assembly Kit]] did not work as expected.
 +
*Screening of colonies with [[Team:Bielefeld-Germany/Labjournal/Molecular#Colony PCR | colony PCR]] and plasmid [[Team:Bielefeld-Germany/Labjournal/Molecular#Restriction analysis | restriction analysis]] shows re-ligated pSB1C3 shipping vector as described for ''gldA'' cloning.
-
====Cytochromes====
 
-
 
-
 
-
====Biosafety====
 
-
 
-
 
-
====Porines====
 
-
*Cloning of OprF into pSB1C3 shipping vector with NEB Biobrick assembly Kit did not work as expected.
 
-
*Screening of colonies with colony PCR and Plasmid restriction analysis shows religated pSB1C3 shipping vector as described for GldA cloning.
 
 +
====Nanowires====
 +
*Successful genomic DNA isolation of ''Geobacter sulfurreducens'' strain.
 +
*Successful PCR with forward and reverse primer GSU 1491-1495 and GSU 1496-1505 on the appropriate gene-cluster of ''Geobacter sulfurreducens''.
 +
<div align="center">
 +
{| class="wikitable" style="text-align: center"
 +
|+Table3: Standard Phusion PCR Master Mix for amplification of ''Geobacter sulfurreducens'' gene cluster GSU 1491-1495 and GSU 1496-1505.
 +
|Component || Volume
 +
|-
 +
|H2O || to 50 µL
 +
|-
 +
|Template (100 ng) || 20 µL
 +
|-
 +
|Betain 5 M || 12.5 µL
 +
|-
 +
|5 x Phusion GC Buffer || 10 µL
 +
|-
 +
|DMSO || 2.5 µL
 +
|-
 +
|Primer-Mix 10 mM || 2.5 µL
 +
|-
 +
|10mM dNTP´s || 2 µL
 +
|-
 +
|Phusion DNA Polymerase || 0.5 µL
 +
|}
 +
</div>
 +
<br>
 +
<div align="center">
 +
{| class="wikitable" style="text-align: center"
 +
|+Table 4: Standard two-step Phusion PCR program for amplification of ''Geobacter sulfurreducens'' gene cluster GSU 1491-1495 and GSU 1496-1505.
 +
|'''Step''' || '''Temperature''' || '''Time''' || '''Cycles'''
 +
|-
 +
|Denaturation || 98 °C || 30 sec ||
 +
|-
 +
|Denaturation || 98 °C || 30 sec || 10
 +
|-
 +
|Annealing || 55 °C || 60 sec || 10
 +
|-
 +
|Elongation || 72°C || 270 sec || 10
 +
|-
 +
|Denaturation || 98 °C || 30 sec || 25
 +
|-
 +
|Annealing || 60 °C || 60 sec || 25
 +
|-
 +
|Elongation || 72 °C || 270 sec || 25
 +
|-
 +
|Elongation || 72 °C || 300 sec ||
 +
|}
 +
</div>
 +
*Clearly visible band at size of 7200 bp, the length of gene cluster GSU 1491-1495.
 +
*Clearly visible band at size of 9000 bp, the length of gene cluster GSU 1496-1505.
 +
*Several bands at smaller sizes suggest alternative primer binding sites in the genome of ''Geobacter sulfurreducens''.
 +
*GSU 1491-1495 and GSU 1496-1505 PCR products were isolated and purified by gel extraction.
 +
<br>
 +
[[File:iGEM_Bielefeld_2013_26.06.13_Wires.jpg|left|300px|thumb|'''Figure 3:''' Agarose gel from PCR on the gene-clusters GSU 1491-1495 and GSU 1496-1505 of ''Geobacter sulfurreducens'' strain. Ladder: GeneRuler™ 1 kb DNA Ladder from Thermo Scientific.]]
 +
<br>
 +
*Inoculation of new cultivation tubes, containing [https://2013.igem.org/Team:Bielefeld-Germany/Labjournal/Molecular#Geobacter_Medium ''Geobacter''-medium] with ''Geobacter sulfurreducens'' culture for higher concentrated PCR-template production by whole genome isolation. Cultivation at 35°C on a rotary shaker with 110 rpm.
 +
<br><br><br><br>
 +
<br><br><br><br>
 +
</div>
 +
<div id="asdf" class="withMenu">
 +
<html>
 +
<div id="nav2" style="width:210px; padding-bottom:5px;  padding-left:15px;">
 +
<div class="navbutton" id="home" style="float:left; padding-left:10px; margin-left:10px; padding-top:0px;">
 +
<a href="https://2013.igem.org/Team:Bielefeld-Germany" title="Jump to Frontpage">
 +
<img src="https://static.igem.org/mediawiki/2013/f/f6/Bielefeld-Germany2013-ButtonHome.png" height="15px">
 +
</a>
</div>
</div>
 +
<div class="navbutton" id="top" style="float:left; padding-left:10px; margin-left:10px; padding-top:0px;">
 +
<a href="#" title="Jump to top">
 +
<img src="https://static.igem.org/mediawiki/2013/a/ab/Bielefeld-Germany2013-Up_orange_new.png" height="15px">
 +
</a>
 +
</div>
 +
<div class="navbutton" id="left" style="float:left; padding-left:10px; margin-left:10px; padding-bottom:0px;">
 +
<a href="https://2013.igem.org/Team:Bielefeld-Germany/Labjournal/May" title="Jump to previous month">
 +
<img src="https://static.igem.org/mediawiki/2013/2/2e/Bielefeld-Germany2013-left_orange.png" height="12px">
 +
</a>
 +
</div>
 +
<div class="navbutton" id="right" style="float:left; padding-left:10px; margin-left:10px; padding-bottom:0px;">
 +
<a href="https://2013.igem.org/Team:Bielefeld-Germany/Labjournal/July" title="Jump to next month">
 +
<img src="https://static.igem.org/mediawiki/2013/1/1b/Bielefeld-Germany2013-right_orange.png" height="12px">
 +
</a>
 +
</div>
 +
</div>
 +
</html>
-
<div id="rightcol" style="width:170px; height:450px; margin-left:800px; float:right; position:fixed; margin-top:-80px; overflow-y:scroll;    box-shadow:0px 0px 2px 0px grey;" padding:0px 20px;>
+
<div id="rightcol" style="width:210px; height:100%; overflow-y:auto;    box-shadow:0px 0px 2px 0px grey;" padding:0px 20px;>
__TOC__
__TOC__
-
<div id="spacer" style="height:300px"></div>
 
</div>
</div>
 +
</div>
</div>
</div>

Latest revision as of 23:57, 28 October 2013



June


Milestones

  • Starting lab work on the sub-project Porins.
  • Successful PCR on oprF gene from Pseudomonas fluorescens. The oprF with pre- and suffix overlaps could be amplified from genome.
  • Planning of our Human Practice projects started and the first participations are fixed.
  • MFC: Designing of 3D models of MFC´s and visited a hacker space in order to print it in a 3D printer.




Week 5

Organization

  • iGEM-Team Bielefeld will support the ‘CeBiTec Student Academy’ from August 26th to 30th with an own experiment.


MFC

  • Constructed a resistor box with different potentiometers and LEDs in order to be able to test our fuel cells

Porines

  • Primer design for isolation of oprF from Pseudomonas fluorescens strain, with overlaps for BioBrick Prefix and Suffix:
  • Forward primer oprF (49 bp): GAATTCGCGGCCGCTTCTAGATGAAACTGAAAAACACCTTGGGCTTTGC
  • Reverse primer oprF (51 bp): CTGCAGCGGCCGCTACTAGTATTACTTAGCTTGGGCTTCAACCTGCGCTTC


Nanowires

  • Primer design for isolation of gene-cluster GSU 1491-1495, GSU 1496-1505 and GSU Promoter-1496-1505 from Geobacter sulfurreducens, containing overlaps for BioBrick Prefix and Suffix:
    • Forward GSU 1491-1495 (45 bp):
      GAATTCGCGGCCGCTTCTAGATGCAGGCTAGCAGACTGGGAGAAC
    • Reverse GSU 1491-1495 (38 bp):
      CTGCAGCGGCCGCTACTAGTATCACTCCTCATCCATGC
    • Forward GSU 1496-1505 (42 bp):
      GAATTCGCGGCCGCTTCTAGAGTTGGCCAATTACCCCCATAC
    • Reverse GSU 1496-1505 (51 bp):
      CTGCAGCGGCCGCTACTAGTATCATAAACGAACCTCGTCCCAAGGCATCAG
    • Forward GSU Promoter-1496-1505 (52 bp):
      GAATTCGCGGCCGCTTCTAGAGGATAGGATCCGTCACCGAGTGCGAACTGCC



Week 6

Organization

  • Thanks to NEB for the [http://www.neb-online.de/index.php/en/neb-announcements/231-igem-2013 free iGEM kit] with many useful laboratory things for all german iGEM teams.
  • We are working on our first press release.
  • Having a short radio contribution in the Bielefeld university campus radio ([http://www.radiohertz.de/beta-site radio 87.9 hertz]).


MFC

  • Connected film canister cells in series and parallel to increase voltage/current
  • Tested different redox mediators in our fuel cell

Mediators

  • Glycerol dehydrogenase
    • Isolation of shipping vector pSB1C3 out of 2013 Distribution Kit Plate 5 Well 3A with insert Part RFP (<bbpart>J04450</bbpart>) for better transformation characterization ([http://parts.igem.org/Help:2013_DNA_Distribution Distribution Kit BioBrick isolation]).
    • Transformation of <partinfo>BBa_J04450</partinfo> into Escherichia coli KRX strain.
    • Plasmid isolation of <partinfo>BBa_J04450</partinfo>.



Week 7

MFC

  • Constructed a stack of five film canister cells which was able to make a LED glow faintly

Cytochromes

  • Cultivation of Shewanella oneidensis MR-1 in liquid LB medium at 30 °C
  • Isolation of genomic DNA from S. oneidensis and dilution to the subsequently used PCR template:
    • 4-2006-453: 5.5ng/µl


  • Amplification of the mtrCAB cluster with Phusion polymerase
    • Annealing: Gradient [55.8 - 56.7 - 57.8 - 59.1 - 60.4 - 61.7 - 62.9 - 63.9]
    • Elongation: 1:15 min
    • Notes: Clear Bands at the expected 5.2 kb, the annealing temperature seems not to have an effect.


  • PCR-CleanUp
    • Lane2: 4-2106-451: 7.4 ng/µl
    • Lane5: 4-2106-451: 8.5 ng/µl


Porines

  • Starting first cultivation of Pseudomonas fluorescens strain for complete genome isolation.
  • Successful genome isolation of Pseudomonas fluorescens.
  • Successful PCR with forward and reverse primer oprF on the oprF gene of Pseudomonas fluorescens strain.


Table 1: Standard Phusion PCR Master Mix.

Table 2: Two step standard Phusion PCR program for gldA amplification.


  • oprF PCR product was isolated by agarose gel electrophoresis and purified.
  • Bands are at expected size of 1300 bp.


Figure 1: Agarose gel from PCR on the oprF gene of Pseudomonas fluorescens strain with forward and reverse primer oprF. As a Ladder we used [http://www.thermoscientificbio.com/nucleic-acid-electrophoresis/generuler-1-kb-dna-ladder-ready-to-use-250-to-10000-bp GeneRuler™ 1 kb DNA Ladder from Thermo Scientific].



Nanowires

  • Anaerobic cultivation of Geobacter sulfurreducens strain DSM-12127 in nitrogen-gassed Geobacter-medium, which was suggested by the strain-supplier: German Collection of Microorganisms and Cell Cultures DSMZ, using 30 mL cultivation-tubes and silicone stoppers with upending rim.



Week 8

Organization

  • Let’s go to Lyon, flights are booked for the European jamboree in Lyon from October 11 to 13, 2013.
  • We will participate at [http://www.bio.nrw.de/studentconvention BioNRW pHD Student Convention] in Düsseldorf at July 13th.


MFC

  • Started planning a new, air tight fue cell model with improved geometry.

Mediators

  • Glycerol dehydrogenase


Figure 2: Agarose gel with NEB 1 kb DNA Ladder as marker. Bands are showing restriction analysis from cloning of gldA into pSB1C3 shipping vector with NEB BioBrick assembly Kit. Assembly did not work, only one band at the size of 2000 bp showing re-ligated pSB1C3.


    • Primer design for pSB1C3 according an universal usable backbone for Gibson Assembly with Prefix and Suffix specific overlaps:
      • Forward primer pSB1C3 (23 bp): TACTAGTAGCGGCCGCTGCAGTC
      • Reverse primer pSB1C3 (23 bp): CTCTAGAAGCGGCCGCGAATTCC


Porines


Nanowires

  • Successful genomic DNA isolation of Geobacter sulfurreducens strain.
  • Successful PCR with forward and reverse primer GSU 1491-1495 and GSU 1496-1505 on the appropriate gene-cluster of Geobacter sulfurreducens.
Table3: Standard Phusion PCR Master Mix for amplification of Geobacter sulfurreducens gene cluster GSU 1491-1495 and GSU 1496-1505.
Component Volume
H2O to 50 µL
Template (100 ng) 20 µL
Betain 5 M 12.5 µL
5 x Phusion GC Buffer 10 µL
DMSO 2.5 µL
Primer-Mix 10 mM 2.5 µL
10mM dNTP´s 2 µL
Phusion DNA Polymerase 0.5 µL


Table 4: Standard two-step Phusion PCR program for amplification of Geobacter sulfurreducens gene cluster GSU 1491-1495 and GSU 1496-1505.
Step Temperature Time Cycles
Denaturation 98 °C 30 sec
Denaturation 98 °C 30 sec 10
Annealing 55 °C 60 sec 10
Elongation 72°C 270 sec 10
Denaturation 98 °C 30 sec 25
Annealing 60 °C 60 sec 25
Elongation 72 °C 270 sec 25
Elongation 72 °C 300 sec
  • Clearly visible band at size of 7200 bp, the length of gene cluster GSU 1491-1495.
  • Clearly visible band at size of 9000 bp, the length of gene cluster GSU 1496-1505.
  • Several bands at smaller sizes suggest alternative primer binding sites in the genome of Geobacter sulfurreducens.
  • GSU 1491-1495 and GSU 1496-1505 PCR products were isolated and purified by gel extraction.


Figure 3: Agarose gel from PCR on the gene-clusters GSU 1491-1495 and GSU 1496-1505 of Geobacter sulfurreducens strain. Ladder: GeneRuler™ 1 kb DNA Ladder from Thermo Scientific.


  • Inoculation of new cultivation tubes, containing Geobacter-medium with Geobacter sulfurreducens culture for higher concentrated PCR-template production by whole genome isolation. Cultivation at 35°C on a rotary shaker with 110 rpm.









Retrieved from "http://2013.igem.org/Team:Bielefeld-Germany/Labjournal/June"