From 2013.igem.org

(Difference between revisions)

Revision as of 12:16, 4 October 2013

Del H. This nasty 18 kb fragment.

Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna aliquyam erat, sed diam voluptua. At vero eos et accusam et justo duo dolores et ea rebum. Stet clita kasd gubergren, no sea takimata sanctus est Lorem ipsum dolor sit amet.

Week 1

In order to transfer the gold precipitating NRPS from D. acidovorans to E.coli, the necessary modules will be amplified from the D. acidovorans genome and assembled as plasmids. Due to its large size of 18 kb, the module DelH will be expressed on a separate plasmid. A strategy was developed, primers designed accordingly and necessary BioBricks retrieved from the distribution. The D. acidovorans was obtained from the DSMZ and cultured in Acidovorax complex medium.

Week 2

Using the designed primers DelH_f1_PacI_fw and DelH_f1_SalI_rev, the first PCRs to amplify DelH F1 as well as DelH_f2_SalI_fw and DelH_f2_KpnI_rev to amplify DelH F2 were performed and conditions optimized. Additionally, necessary backbone fragments pSB6A1 and lacZ were generated by restriction digest. New BioBricks to obtain the AraC promotor (I13453 and K206000) were chosen.

Week 3

Since the reverse backbone primer DN08:AraCbb_PacI_rev did not work, a new one (DN06:AraCbb_PacI_rev2) was ordered, together with the colony PCR screening primers DN07:Screen_DelH_rev and DN13:Screen_DelH_fw to check for correct ligation of the DelH fragment F1.

Week 4

The elongation of the pSB6A1-AraC-lacZ backbone turned out to be difficult. So in week 4, we performed different restriction digests both with our final backbone pSB6A1-AraC-lacZ and with the former construct pSB1C3-AraC-lacZ to verify the identity of the backbone. Besides, the amplification of the DelH fragment F1 was planned: it will be amplified in 2 subfragments - fragment F1a and fragment F1b (both 5 kb in size).

Week 5

This week, we started over with the assembly of the backbone pSB6A1-AraC-lacZ: digesting AraC, lacZ and PSB6A1 based on the previously amplified fragments. The amplification of DelH was continued and we succesfully amplified all three fragments and gel-extracted them.

Week 6

Since all DelH-fragments required for the final construct as well as the backbone were assembled in week 5, we tried to assemble the final plasmid pHM01. Therefore, every fragment was digested with two distinct enzymes, and then ligated. The ligated plasmid pHM01 was purified and electroporated in two separate DH10ß aliquots. The screening via colony-PCR was negative, so none of the transformed E.coli received the correct plasmid.

Week 7

In week 7, we reamplified the DelH fragments used for the transformation in week 6. We found that amplification of fragments F1a and F1b was not reproducible. Therefor, we designed new primers for DelH, which will allow to amplify the beginning of DelH in a more efficient and specific manner. The overview summarizes the primers we ordered and their performance in amplificating DelH F1a. Primer DN11 yielded best results and will be used in the next experiments.

Week 8

After improving the amplification of the first subfragment of DelH (fragment 1a with the primer DN11), we used a higher concentration in the ligation assembling the pHM01 plasmid. The transformation of E.coli DH10ß cells was performed with electroporation. Four colonies were positive in the screening-PCR, but did not express lacZ (no blue color). To qualitatively determine DelH expression, we plan to conduct SDS-PAGEs of cell lysate derived from DelH transformed cells. Also, we will induce the transformed bacteria with higher concentrations of arabinose and X-Gal.

Week 9

SDS-PAGE of cell lysate derived from DelH-transformed with subsequent coomassie staining did not yield a band at the expected protein size of ~600 kDa. The result was confirmed on DNA level, as the restriction digest of the DNA prepped from colonies of the transformed cells did not show the expected pattern. To perform a new assembly of plasmid pHM01, the fragments of DelH and the backbone had to be reamplified. The amplifications of the DelH fragments were successful (confirmed by gelelectrophoreses), but the backbone caused difficulties and we were not able to amplify it.

Week 10

After unsuccessful assembly attempts of pHM01, we tried to verify the previously amplified fragments. Two difficulties were encountered: On the one hand, the concentrations of the fragments were too low and could not be detected by gelelectrophoresis; on the other hand, a re-amplification of the fragments with the appropriate primers was not successful. For the DelH 1b fragment, the PCR products of the amplification from genomic DNA were slightly larger than the reamplifications.

Week 11

Based on this week's experiments and in silico analysis of the fragments DelH F1a, F1b and F2, we discarded the restriction digest and ligation strategy for the assembly of the DelH plasmid. Instead, we chose Gibson assembly as an alternative method, developed a strategy and designed primers accordingly.

Week 12

We started amplifying the Gibson fragments using different PCR approaches. Since we were not able to amplify G1 by PCR, we decided to divide G1 into the subfragments G1a and G1b, for which we had already designed and ordered primers. The amplification of fragment G2 worked well and yielded sufficient DNA amounts for subsequent steps. Alternatively, we also produced the entire DelH G0 as one fragment, as well as further subfragments DelH G1/2a, G1b/2 and G2b. Amplification of G1b/2a did not work out. Due to the failure of the restriction digest strategy, we further analyzed the backbone pSB6A1-AraC-lacZ, which we decided to discard. Instead, we choose to use pSB6A1 and BBa_J04450, which is already available in the parts registry.

Week 13

In order to realize the new strategy using the already existing backbone from the parts registry pSB6A1-lacZ-mRFP, we designed two new primers for the backbone amplification and created a map of pHM03. The plasmid for the backbone was obtained from the registry, transformed into E.coli and miniprepped. The Gibson fragment of the backbone was successfully amplified, together with Gibson fragments DelH G0, G1 and G2b.

Week 14

In week 14, we screened numerous colonies from last week's Gibson assembly (28-07) for plasmids containing DelH G0, G1/2a and 2b by screening-PCR. None of the analyzed colonies carried the correct plasmid. We performed another Gibson assembly (01-08) and screened numerous clones. We found few possibly correct ones that will be further analyzed next week. Additionally, the new D. acidovorans strain SPH1, whose sequence is available in GenBank, was ordered. We will amplify all fragments from the genome of D. acidovorans SPH1 as soon as it arrives.

Week 15

We screened colonies from last weeks Gibson assemblies (01-08) for plasmids containing DelH G0 as well as G1/2a and 2b. None of the screening-PCRs yielded the expected DNA bands. Therefore, we amplified the Gibson fragments again and performed further Gibson assemblies. Yet again, we could not detect positive colonies by colony-PCR.

Week 16

We further characterized the DelH plasmid created by Gibson assembly. None of the screened colonies yielded definit positive results. Selection of red colonies was not clear, and PCR screened colonies were all negative. In order to avoid high background during screening of the colonies, we decided to run two different strategies. First, we will amplify the backbone without mRFP, avoiding backbone reassembly due to ribosome binding site homology (pHM04). In the second strategy (pHM05), we will additionally introduce a tetracycline resistance to select for the insert via antibiotic resistance. In addition to the primers for the new strategies, we designed a new screening primer at the end of DelH.

Week 17

A possible explanation for the failed Gibson assemblies could be a religation of the backbone fragment pSB6A1 allowing E.coli to survive. In this case, transformed bacteria will still express mRFP. This week, our aim is to design a new construct without mRFP (pHM04), by which we will be able to exclude red colonies from the screening. For this strategy, we are going to use a new reverse primer for the backbone still including the terminator of mRFP, but omitting mRFP itself. The primers for the backbone amplification are HM11 & HM17.

Week 18

Since the assembly strategy for pHM04 did not yield positive clones (see experiments week 17), we will follow the idea to introduce a tetracycline resistance to the ampicillin backbone as an additional selection marker for successful assembly. With this approach, positive clones can be easily determined by their white phenotype (exclusion of mRFP) and their ability to grow on plates containing tetracycline. Furthermore, we decided to amplify DelH in various fragments to increase Gibson assembly efficiency. Therefore, we also ordered new screening primers. The primers were designed as shown in the following table.

Week 19

After successful electroporation, we screened numerous clones by colony-PCR and test restriction digest (PvuI-HF). Midiprepped DNA dervied from clones positive for both methods were sent for sequencing. By sequencing of the transition sequence from the end of the pSB6A1 backbone without mRFP (pHM04) to the beginning of DelH, the assembly success of the Gibson assembly can be determined (Primer: reverse DN07 primer or VF2).Sequencing results showed truncating mutation at the beginning of DelH (in the primer region) for all clones.

Week 20

As in week 19, the screening-PCRs showed colonies positive for the DelH contatining plasmid, whereas the restriction digest reveiled many of the screening results to be false positive. The remaining miniprepped colonies were sent in for sequencing. Sequencing results showed again truncating mutation at the beginning of DelH (in the primer region) for all clones.

Week 21

None of the analyzed clones showed a correct sequence, which lead as to the assumptions following assumptions. First, we suspect DelH to be toxic for E.coli, thus only clones carrying the mutant DelH-plasmid survive. Second, we consider the low quality of the gibson primers as a possible explanation for the high number of mutations in the assemblies. To circumwent the latter problem, we will order HPLC purified primers. Additionally, we tried to eliminate the mutations in DelH clones I 6b and 15 by mutagenesis. Herefore, primers were ordered.

Week 22

So far, we failed to obtain a single correct DelH clone. We suspect the DelH module to be toxic for E. coli when transformed without the other parts of the Del cluster, thus DelH-transformed cells would select for mutated plasmids. In order to reduce the selection pressure, we used E. coli BL21 DE3, known for increased expression of the lac repressor. This strategy also did not result in any correct clone. One reason might be, that the E. coli BL21 DE3 strain we obtained was actually a BL21 DE3 pLys strain, which itself is already Chloramphenicol resistant, thus not useful for screening and amplification of the DelH construct coded for on a chloramphenicol vector. We obtained the correct E. coli BL21 DE3 strain as well as NEB E. coli turbo cells, which significantly overexpress the lac repressor. We found the lacZ-controlled expression of the latter to be very leaky when compared to E. coli BL21 DE3. Since the Gibson assembly of DelH using the HPLC purified primers also exclusively resulted in mutated clones, we developed two new cloning strategies to avoid expression of DelH. The first strategy uses a weak promoter and ribosomal binding site, the second introduces DelH in a ccdB helper construct. Lastly, we continued working on the mutagenesis approach to eliminate the mutation in clone C5. It was sent for sequencing...

Week 23

Cras justo odio, dapibus ac facilisis in, egestas eget quam. Donec id elit non mi porta gravida at eget metus. Nullam id dolor id nibh ultricies vehicula ut id elit.

Browse gallery

Methods:

Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna aliquyam erat, sed diam voluptua. At vero eos et accusam et justo duo dolores et ea rebum. Stet clita kasd gubergren, no sea takimata sanctus est Lorem ipsum dolor sit amet. Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna aliquyam erat, sed diam voluptua. At vero eos et accusam et justo duo dolores et ea rebum. Stet clita kasd gubergren, no sea takimata sanctus est Lorem ipsum dolor sit amet.Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna aliquyam erat, sed diam voluptua. .

Overview
Lab book

Schematic representation of DelH cluster and structure of delftibactin.

Restriction Digest and Ligation Strategy

PCR amplification of the 18 Kb DelH fragment as sub fragments F1 (10 Kb) and F2 (8 Kb)
Assembly of backbone pSB6A1-Arac-lacZ by PCR amplification of fragments from BioBricks
Ligation of the construct DelH F1 + DelH F2 + backbone pSB6A1-Arac-lacZ
Transformation of E. coli TOP10 with DelH plasmid
Characterization of positive (blue) colonies by colony PCR

Vector Maps, Primers and BioBricks

Vector map of the pHM01:DelH plasmid.

Backbone	Part	Distribution	Plate	Well	Usage	Resistance
pSB4K5	J04450	Spring 2012	1	5G	Backbone for DelA-G,OP,L	Kanamycin
pSB1AK3	I732019	Spring 2012	4	12G	lacZ reporter gene	Kanamycin, Ampicillin
pSB2K3	I0500	Spring 2012	1	14N	AraC promoter	Kanamycin
pSB6A1	J04450	Spring 2012	1	1K	Backbone for DelH	Ampicillin
pSB1C3	J04450	Spring 2012	1	3A	Backbone for Indigoidine	Chloramphenicol

Identifier	Order date	Note	Sequence
DN01:DelH_f1_PacI_fw	03-05-2013	Amplification of DelH F1, with RBS and adding PacI restriction site	TTTT TTAATTAA TCACACAGGAAAGTACTAG ATGGACCGTGGCCGCCTGC GCCAAATCG
DN02:DelH_f1_SalI_rev	03-05-2013	Amplification of DelH F1 until SalI	TTTT GTCGACCAACACCTGTGCCTGC
DN03:DelH_f2_SalI_fw	03-05-2013	Amplification of DelH F2 starting SalI	TTTT GTCGACTGGATGGAGCCTGGTGAAAG
DN04:DelH_f2_KpnI_rev	03-05-2013	Amplification of DelH F2, adding KpnII restriction site	TTTT GGTACC TCAGTCCAGCGCGTACTCCAG
DN05:AraCbb_KpnI_fw	03-05-2013	Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding KpnI site	TTTT GGTACC AAAGAGGAGAAATACTAGATGACCATG
DN08:AraCbb_PacI_rev	03-05-2013	Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding PacI site	TTTT TTAATTAA GCTAGCCCAAAAAAACGGGTATG

29-04 - 05-05-13

Generation of Plasmid Backbones

Transformation of Biobricks

Part of the registry	Plate of 2012	Well	Resistance
pSB4K5 (insert=J04450)	1	5G	Kanamycin
pSB6A1 (insert=J04450)	1	1K	Ampicillin
lacZ (I732019) in pSB1AK3	4	12G	Kanamycin, Ampicillin
AraC (I0500) in pSB2K3	1	14N	Kanamycin
pSB1C3 (insert=J04450)	1	3A	Chloramphenicol

Added 10 µl H₂O to each well
Incubated for 10 min at RT
Thawed 5x chemical competent E.coli Top10
3 µl of plasmid DNA were added
Incubated for 10 min on ice
Heat shock for 40 s at 42.2°C
Incubated for 10 min on ice
Added 500 µl LB Medium
Incubated at 37°C for 40 min
Centrifuged 120 at 5,000 rpm, supernatant discarded
Pellet resuspended in remaining medium
Plated on plates with the corresponding antibiotics (as shown in the table above, section: resistances)
Incubated for 2 days at RT
One colony was picked from each plate and incubated over night at 37°C in LB medium with the antibiotic listed above

Result

All 5 parts from the Registry Distribution 2012 were successfully transformed in E.coli Top10 except for the one containing the AraC promotor.

Amplification of DelH Fragments

Design of Primers

Identifier	Order date	Note	Sequence
DN01:DelH_f1_PacI_fw	03-05-2013	Amplification of DelH F1, with RBS and adding PacI restriction site	TTTT TTAATTAA TCACACAGGAAAGTACTAG ATGGACCGTGGCCGCCTGC GCCAAATCG
DN02:DelH_f1_SalI_rev	03-05-2013	Amplification of DelH F1 until SalI restriction site	TTTT GTCGACCAACACCTGTGCCTGC
DN03:DelH_f2_SalI_fw	03-05-2013	Amplification of DelH F2 starting at SalI restriction site	TTTT GTCGACTGGATGGAGCCTGGTGAAAG
DN04:DelH_f2_KpnI_rev	03-05-2013	Amplification of DelH F2, adding KpnII restriction site	TTTT GGTACC TCAGTCCAGCGCGTACTCCAG
DN05:AraCbb_KpnI_fw	03-05-2013	Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding KpnI site	TTTT GGTACC AAAGAGGAGAAATACTAGATGACCATG
DN08:AraCbb_PacI_rev	03-05-2013	Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding PacI site	TTTT TTAATTAA GCTAGCCCAAAAAAACGGGTATG

Overview
Lab book

BioBricks

Backbone	Part	Distribution	Plate	Well	Usage	Resistance
pSB1A3	I13453	Spring 2012	1	1F	AraC promoter	Ampicillin
pSB1A3	K206000	Spring 2012	4	8G	AraC promoter	Ampicillin

06-05 - 12-05-13

Amplification of BioBricks

Miniprep of BioBricks

Miniprep was performed using Qiagen kit and eluted in 35 µl ddH₂O.
From 500 µl of liquid culture, a glycerol stock was prepared as described in Preparing glycerol stocks.

Result

DNA concentration was determined using nanovue.

Sample	Concentration [ng/µl]
pSB4K5	21
pSB6A1	47
lacZ	45
pSB1C3	23

Generation of Plasmid Backbones

Restriction Digest of BioBrick pSB6A1

Component	Amount [µl]
PSB6A1 DNA	32.5
BSA (10x)	5
NEB2 buffer (10x)	5
Enzymes (EcoRI-HF and PstI)	1.5 each
ddH₂O	4.5

Result

Fig. 2.1: Restriction results of 06-05. l1:2log, l2: P1 (pSB4K5),l3:2log, l4-5:amplified DelH fragment 1 , l6-7:amplified DelH fragment 2,l8:2log, l9: P3 (pSB1C3)

The fragments of plasmids pSB4K5 and pSB1C3 show the expected pattern.

=> BioBrick backbone was cut and gel isolated.

Generation of LacZ Fragment

Restriction Digest of BioBrick pSB1AK3 Conditions A

Component	Amount [µl]
pSB1AK3 DNA	32.5
BSA (10x)	5
NEB3 buffer (10x)	5
Enzymes (XbaI and PstI)	1.5 each
ddH₂O	4.5

Incubation for 1 h at 37°C

Result

The restriction mix was loaded onto a 1% agarose gel using 6 µl gene ruler marker.

Fig. 2.1: Restriction results of 06-05. l1:2log, l2: P1 (pSB4K5),l3:2log, l4-5:amplified F1 for Backbone (pSB6A1), l6-7:amplified fragment 2 for Backbone (lacZ),l8:2log, l9: P3 (pSB13)

The fragments show the expected pattern.

=> LacZ insert were cut and gel isolated.

Restriction Digest of BioBrick K173004(lacZ) Conditions B

Component	Amount [µl]
pSB1AK3 DNA	8.3
BSA (10x)	5
NEB4 buffer (10x)	5
Enzymes (XbaI & SalI-HF)	1.5 each
ddH₂O	28.7

Purification was performed with Qiagen Nucleotide removal Kit and eluted in 38.5 µl ddH₂O

Result

2.5 µl were measured with the Nanovue. The measurement proved the failure of miniprep.

Restriction Digest of BioBrick K173004(lacZ) Conditions C

Component	Amount [µl]
pSB1AK3 DNA	32.5
BSA (10x)	5
NEB 3 buffer (10x)	5
Enzyme (PstI)	1.5
ddH₂O	-

Result

Fig.2.2 Gel of cut lacZ (loaded 20 µL)
, l1-2: lacz & pSB1AT,l3:2log ladder
=> lacZ was cut out

=>The band was too high on gel and discarded, because we cannot be sure if it really is lacZ or the backbone of the lacZ plasmid.

Generation of AraC Fragment

Amplification of BioBricks containing I13453 and K206000

The transformation was performed as described on 03-05 and incubated ON at 37°.

Amplification of DelH F1

PCR Conditions F1.W2.A

Reagent	DelH F1	DelH F1
Expected length [Kb]	10	10
Template	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans DNA
Primer 100 µM fw	0.5 µl DelH_f1_PacI_fw	0.5 µl DelH_f1_PacI_fw
Primer 100 µM rev	0.5 µl DelH_f1_SalI_rev	0.5 µl DelH_f1_SalI_rev
Phusion Master Mix (2x)	25 µl	25 µl
ddH₂O	23 µl	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
16	98	1
	66(↓0.5°C)	5
	72	3:40 min
14	98	1
	62	5
	72	3:40 min
1	72	5 min
1	4	inf

Result

Expected band: 10 Kb

Fig.2.3 Gel of amplified DelH-fragment 1 & fragment 2 (loaded 20 µL)
l1:2log ladder, l2-3:DelH-F1, l1:2log ladder, l5-6:DelH-F2
no specific band at 10 Kb

Different unspecific bands were observed.

=> Further optimize PCR conditions.

PCR Conditions F1.W2.B

Reagent	DelH-fragment1	DelH-fragment1
Expected length [Kb]	10	10
Template	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans DNA
Primer 100 µM fw	0.5 µl DelH_f1_PacI_fw	0.5 µl DelH_f1_PacI_fw
Primer 100 µM rev	0.5 µl DelH_f1_SalI_rev	0.5 µl DelH_f1_SalI_rev
Phusion Master Mix (2x)	25 µl	25 µl
ddH₂O	23 µl	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
30	72	2:45 min
1	72	5 min
1	4	inf

Result

Fig.2.4 Gel of amplified DelH-fragment 1 (loaded 20 µL)
l1:2log ladder, l2:DelH-F1 amplified from DNA, l3:DelH-F1 amplified from cells
no specific band at 10 Kb

PCRs showed only unspecific bands.

=> Further optimize PCR conditions.

PCR Conditions F1.W2.C

Reagent	DelH F1	DelH F1	DelH F1	DelH F1
Expected length [Kb]	10	10	10	10
Template	1 µl D. acidovorans normal	1 µl D. acidovorans normal	1 µl D. acidovorans 1:25	1 µl D. acidovorans 1:25
DelH_f1_PacI_fw	0.5 µl normal	0.5 µl 1:10	0.5 µl normal	0.5 µl 1:10
DelH_f1_SalI_rev	0.5 µl normal	0.5 µl 1:10	0.5 µl normal	0.5 µl 1:10
Phusion Master Mix (2x)	25 µl	25 µl	25 µl	25 µl
DMSO	-	-	2.5 µl	2.5 µl
ddH₂O	23 µl	23 µl	20.5 µl	20.5 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
16	98	1
	62	5
	72	2:45 min
1	72	5 min
1	4	inf

Result

Fig.2.5 Gel of DelH-fragment 1 (loaded 20 µL)
l1:2log ladder, l2-9: F1 with different conditions => l9 shows the best match

PCR with DMSO and 1:10 diluted primer looked best.

=> Gel extraction performed.

Amplification of DelH F2

PCR Conditions F2.W2.A

Reagent	DelH F2	DelH F2
Expected length [Kb]	8	8
Template	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans DNA
Primer 100 µM fw	0.5 µl DelH_f2_SalI_fw	0.5 µl DelH_f2_SalI_fw
Primer 100 µM rev	0.5 µl DelH_f2_KpnI_rev	0.5 µl DelH_f2_KpnI_rev
Phusion Master Mix (2x)	25 µl	25 µl
ddH₂O	23 µl	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
16	98	1
	66(↓0.5°C)	5
	72	3:40 min
14	98	1 s
	62	5 s
	72	3:40 min
1	72	5 min
1	4	inf

Result

Expected band: 8 Kb

Fig.2.3 Gel of amplified DelH-fragment 1 & fragment 2 (loaded 20 µL)
l1:2log ladder, l2-3:DelH-F1, l4:2log ladder, l5-6:DelH-F2
no specific band at 8 Kb

Different unspecific bands were observed.

=> Further optimize PCR conditions.

PCR Conditions F2.W2.B

Reagent	DelH F2	DelH F2
Expected length [Kb]	8	8
Template	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans DNA
Primer 100 µM fw	0.5 µl DelH_f2_SalI_fw	0.5 µl DelH_f2_SalI_fw
Primer 100 µM rev	0.5 µl DelH_f2_KpnI_rev	0.5 µl DelH_f2_KpnI_rev
Phusion Master Mix (2x)	25 µl	25 µl
ddH₂O	23 µl	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1 s
30	72	2:45 min
1	72	5 min
1	4	inf

Results

Expected band: 8 Kb

Fig.2.6 Gel of amplified DelH-fragment 1 (loaded 20 µL)
l1:DelH-F1 amplified from DNA, l2:DelH-F1 amplified from cells, l3:2log ladder
no specific band at 8 Kb

Gel shows the expected specific band at 8 Kb.

=> DelH F2 was thus successfully amplified from the glycerol stock.

Overview
Lab book

Primers

Identifier	Order date	Note	Sequence
DN06:AraCbb_PacI_rev2	15-05-2013	Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding PacI site	tttt ttaattaa gctagcccaaaaaaacggtatg
DN07:Screen_DelH_rev	15-05-2013	PCR Screening for presence of DelH insert	CTTTCCTCGAACACCGTGCGCAG
DN13:Screen_DelH_fw	15-05-2013	PCR Screening for presence of DelH insert	gtaaacccactggtgataccattc
VF2	from 2010	PCR Screening in standard BioBrick backbone	tgccacctgacgtctaagaa

13-05 - 19-05-13

Amplification of DelH F1

Gel Purification

45 µl of DelH F1 PCR (08-05) product were run on a 0,8% agarose gel (1 h with 135V). Gel extraction was performed using gel extraction kit of Qiagen, and diluted in 25 µl ddH₂O.

Result

Sample	Concentration [ng/µl]
DelH F1	7

=> Because the concentration is so low, a re-PCR of the PCR product (08-05) is going to be done.

re-PCR Conditions F1.W3.A

Reagent	DelH F1
Expected length [Kb]	10
Template	1 µl 1:10 gel purified F1
Primer 10 µM fw	0.5 µl DelH_f1_PacI_fw
Primer 10 µM rev	0.5 µl DelH_f1_SalI_rev
Phusion Master Mix (2x)	25 µl
DMSO	2.5 µl
ddH₂O	20.5 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
	66	5
	72	3:30 min
72	3:30 min
1	4	inf

Result

Expected length: 10 Kb

Fig.3.1 PCR of DelH fragment 1 (loaded 20 µL)
l1:fragment 1 of DelH, l2: 2log ladder

Different unspecific bands were observed.

=> Test digest to confirm identity.

Test Restriction Digest

PCR product of DelH-F1	BSA	NEBuffer 4	Enzymes	ddH₂O	Total amount
18 µl	5 µl	5 µl	2x 1.5 µl SalI-HF & PacI	19 µl	50 µl

Afterwards, purification with the nucleotide removal kit was performed, but due to using wrong column, there was no product left.

=> Repeat amplification of DelH F1.

PCR Conditions F1.W3.B

Reagent	DelH F1	DelH F1	DelH F1
Expected length [Kb]	10	10	10
Template	Picked colony	Picked colony	Picked colony
Primer 10 µM fw	0.5 µl DelH_f1_PacI_fw	0.5 µl DelH_f1_PacI_fw	0.5 µl DelH_f1_PacI_fw
Primer 10 µM rev	0.5 µl DelH_f1_SalI_rev	0.5 µl DelH_f1_SalI_rev	0.5 µl DelH_f1_SalI_rev
Phusion Master Mix (2x)	25 µl	25 µl	25 µl
DMSO	1.5 µl	2.5 µl	5 µl
ddH₂O	21.5 µl	20.5 µl	18 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1 s
	66	5 s
	72	3:30 min
1	72	3:30 min
1	4	inf

Result

Expected length: 10 Kb

Fig.3.2 PCR of DelH fragment 1 (loaded 20 µL)
l1:2log ladder, l2-4: fragment 1 of DelH, l5: fragment 2 of DelH

There is only an unspecific band at the second PCR of F1 with 2.5 µl DMSO.

=> Repeat using DMSO and altered PCR program.

PCR Conditions F1.W3.C

Reagent	DelH F1	DelH F1
Expected length [Kb]	10	10
Template	1 µl glycerol stock	1 µl glycerol stock
Primer 10 µM fw	0.5 µl DelH_f1_PacI_fw	0.5 µl DelH_f1_PacI_fw
Primer 10 µM rev	0.5 µl DelH_f1_SalI_rev	0.5 µl DelH_f1_SalI_rev
Phusion Master Mix (2x)	25 µl	25 µl
DMSO	2.5 µl	2.5 µl
ddH₂O	20.5 µl	20.5 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1 s
	66	5 s
	72	3:30 min
1	72	3:30 min
1	4	inf

Result

Expected length: 10 Kb

Fig.3.3 PCR of DelH fragment 1 (loaded 20 µL)
l1:2log ladder, l2: fragment 1 of DelH, l3: fragment 2 of DelH, l4: fragment 1 of DelH, l5: fragment 2 of DelH

There was no band visible.

=> Repeat using DMSO and altered PCR program.

Amplification of DelH F2

Gel Purification

45 µl of DelH F1 PCR (07-05) product were run on a 0,8% agarose gel (1 h with 135V). Gel extraction was performed using gel extraction kit of Qiagen, and diluted in 25 µl ddH₂O.

Result

Sample	Concentration [ng/µl]
DelH F2	6

=> Because the concentration is so low, a re-PCR of the PCR product (07-05) is going to be done.

Re-PCR Conditions F2.W3.A

Reagent	DelH-fragment2
Expected length [Kb]	8
Template	1 µl 1:10 gel purified F2
Primer 10 µM fw	0.5 µl DelH_f2_SalI_fw
Primer 10 µM rev	0.5 µl DelH_f2_KpnI_rev
Phusion Master Mix (2x)	25 µl
DMSO	2.5 µl
ddH₂O	20.5 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1 s
	66	5 s
	72	3:30 min
72	3:30 min
1	4	inf

Result

Expected length: 8 Kb

Fig.3.4 PCR of DelH fragment 1 (loaded 20 µL)
l1:2log ladder, l2: fragment 2 of DelH

Specific band was observed.

=> Test digest to confirm identity.

Test Restriction Digest

PCR product of DelH-F1	BSA	NEBuffer 4	Enzymes	ddH₂O	Total amount
18 µl	5 µl	5 µl	2x 1.5 µl SalI-HF & KpnI-HF	19 µl	50 µl

Afterwards, a purification with the nucleotide removal kit was performed, but due to using wrong column, there was no product left.

=> Repeat amplification of DelH F2.

PCR Conditions F2.W3.B

Reagent	DelH F2
Expected length [Kb]	8
Template	Picked colony
Primer 10 µM fw	0.5 µl DelH_f2_SalI_fw
Primer 10 µM rev	0.5 µl DelH_f2_KpnI_rev
Phusion Master Mix (2x)	25 µl
DMSO	0 µl
ddH₂O	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
	66	5
	72	2:45 min
1	72	2:45 min
1	4	inf

Result

Expected length: 8 Kb

Fig.3.2 PCR of DelH fragment 1 (loaded 20 µL)
l1:2log ladder, l2: fragment 1 of DelH, l3: fragment 2 of DelH

There is no band visible.

=> Repeat using altered PCR program.

PCR Conditions F2.W3.B

Reagent	DelH F2
Expected length [Kb]	8
Template	1 µl glycerol stock
Primer 10 µM fw	0.5 µl DelH_f2_SalI_fw
Primer 10 µM rev	0.5 µl DelH_f2_KpnI_rev
Phusion Master Mix (2x)	25 µl
DMSO	0 µl
ddH₂O	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
	66	5
	72	2:45 min
1	72	2:45 min
1	4	inf

Result

Expected length: 8 Kb

Fig.3.3 PCR of DelH fragment 1 (loaded 20 µL)
l1:2log ladder, l2: fragment 1 of DelH, l3: fragment 2 of DelH

There was a specific band at 8 Kb

=> Fragment was cut and gel extracted.

Generation of Backbone pSB6A1-AraC-lacZ

Miniprep of Amplified Parts

DH10ß containing I13453 and K20600 (for AraC) and backbone pSB1AK3 (lacZ) were grown ON at 37°C and minipreped.

Result

Sample	Concentration [ng/µl]
lacZ	42.5
AraC (5)	26.5
AraC (6)	34.5

Restriction Digest

AraC was cut with EcoRI-HF and SpeI buffered in NEB4
LacZ was cut with XbaI and PstI buffered in NEB3

Reagent	Amount [µl]
DNA	22.5
Enzymes	1.5 each
Buffer (10x)	5
BSA (10x)	5
ddH₂O	14.5

Incubated for 1h at 37°C
Purified with Qiagen Kit and diluted in 20 µl ddH₂O

Result

Sample	Concentration [ng/µl]
lacZ	33.5
AraC (5)	19.5
AraC (6)	25.5

Ligation of pSB6A1, AraC and lacZ

Reagent	Amount [µl]
pSB6A1	1.5
lacZ	4
AraC	3
Ligase	1.5
Buffer	2
ddH₂O	8.5

Incubated at RT for 45 min
Chemical transformation of competent DH10ß
Streaked on LB Amp plates
Incubation ON at 37°C

Miniprep of pSB6A1-AraC-lacZ

One colony each was picked and grown in 2 ml LB Amp ON
Cultures were minipreped.

Result

Sample	Concentration [ng/µl]
pSB6A1-AraC-lacZ (5)	57
pSB6A1-AraC-lacZ (6)	73

Restriction Digest of Backbone pSB6A1-AraC-lacZ

AraC-lacZ was cut from pSB6A1-AraC-lacZ using PstI & EcoRI-HF

Reagent	Amount [µl]
Miniprep DNA	10
Enzymes	1.5 each
Buffer NEB 2(10x)	5
BSA (10x)	5
ddH₂O	27

Incubated for 1 h at 37°C
Purified with Qiagen kit and diluted in 20 µl ddH₂O

Result

Sample	Concentration [ng/µl]
pSB6A1-AraC-lacZ (5) D+P	18
pSB6A1-AraC-lacZ (6) D+P	26

Ligation of AraC-lacZ with pSB1C3

Reagent	Amount [µl]
DNA of pSB1C3	10
DNA of AraC-lacZ (6)	5
Ligase	1
Buffer	2
ddH₂O	2

Incubated at RT for 50 min
Heat inactivation at 70°C for 5 min
10 µl were used for a chemical transformation in TOP10 and plated on LB Chlor
Incubation ON at 37°C

Conlony-PCR Conditions BB.W3.A

Reagent	psB1C3-AraC-lacZ (5)
Expected length [Kb]	?
Template	Picked colony of psB1C3-AraC-lacZ (5)
Primer 10 µM fw	0.5 µl
Primer 10 µM rev	0.5 µl
Phusion Master Mix (2x)	25 µl
DMSO	-
ddH₂O	24 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
	66	5
	72	1:30 min
1	72	1:30 min
1	4	inf

Result

Expected length:

Fig.3.5 PCR of BB psB1C3-AraC-lacZ(loaded 20 µL)
l1:2log ladder, l2: psB1C3-AraC-lacZ
no yield

There was no fragments visible.

=> Is picked coloniy negative or did entire ligation not work out?

Lab book

20-05 - 26-05-13

DelH Fragment F1a

The new primer arrived.

PCR Conditions F1a.W4.A

Reagent	DelH F1a	DelH F1a
Expected length [Kb]	5	5
Template	1 µl D. acidovorans	1 µl D. acidovorans
Primer fw 10 µM	DN01	DN01
Primer rev 10 µM	DN08	DN08
Phusion Master Mix (2x)	25 µl	25 µl
DMSO	2.5 µl	-
ddH₂O	20,5	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
16	98	1 s
	62	5 s
	72	2:00 min
1	72	2:30 min
1	4	inf

Results

Expected band: 5 Kb

Fig.4.1 PCR ofDelH-fragments and pSB1C3(loaded 20 µL)
l1:2log ladder, l2-3: DelH-F1a without DMSO, l4-5: DelH-F1a with DMSO, l6-7: DelH-F1b, l8:2log ladder, l9:pSB1C3 l10: pSB1C3-AraC-lacZ

The gel shows a lot unspecific bands for both DelH F1a samples.

=> Alter PCR conditions.

DelH F1b

The new primer arrived

PCR Conditions F1b.W4.A

Reagent	DelH F1b
Expected length [Kb]	5
Template	1 µl D. acidovorans
Primer fw 10 µM	DN07
Primer rev 10 µM	DN02
Phusion Master Mix (2x)	25 µl
DMSO	-
ddH₂O	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
16	98	1 s
	62	5 s
	72	2:00 min
1	72	2:30 min
1	4	inf

Result

Expected band: 5 Kb

Fig.4.1 PCR ofDelH-fragments and pSB1C3(loaded 20 µL)
l1:2log ladder, l2-3: DelH-F1a without DMSO, l4-5: DelH-F1a with DMSO, l6-7: DelH-F1b, l8:2log ladder, l9:pSB1C3 l10: pSB1C3-AraC-lacZ

The gel shows a lot unspecific bands for DelH F1b, but also the band at 5 Kb.

=> Band was cut and gel isolated.

Generation of Backbone pSB6A1-AraC-lacZ

Miniprep

From three different clones, 2ml of pSB6A1-AraC-lacZ (6) in LB Amp were minipreped and eluted in 30 µl ddH₂O. Additionally, a glycerol stock was prepared.

Result

Sample	Concentration [ng/µl]
8 - pSB6A1-AraC-lacZ (6)	63
9 - pSB6A1-AraC-lacZ (6)	61
10 - pSB6A1-AraC-lacZ (6)	62

PCR Conditions BB.W4.A

Reagent	8 - pSB6A1-AraC-lacZ (6)	9 - pSB6A1-AraC-lacZ (6)
Expected length [Kb]	7.382	7.382
Template	1 µl of 1:10 diluted 8	1 µl of 1:10 diluted 9
Primer 10 µM fw	0.5 µl
Primer 10 µM rev	0.5 µl
Phusion Master Mix (2x)	25 µl	25 µl
DMSO	-	-
ddH₂O	23 µl	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
16	98	1 s
	66↓	5 s
	72	3:00 min
14	98	1 s
	63	5 s
	72	3:00 min
1	72	5:00 min
1	4	inf

Results

Expected band: 7.4 Kb

Fig.4.2 PCR of BB pSB6A1-AraC-lacZ (loaded 50 µL)
l1:2log ladder, l2-3: pSB6A1-AraC-lacZ (8),l4:2log ladder, l5-6: pSB6A1-AraC-lacZ (10)
no band visible

The gel shows no bands.

=> Perform test restriction to test identity of plasmid.

Restriction Digest A

Digest with PstI & XbaI of samples 8, 9 and 10 for checking identity of the construct

Reagent	Amount [µl]
DNA	10
Enzymes	1.5 each
Buffer NEB 3 (10x)	5
BSA (10x)	5
ddH₂O	27

Incubated for 1 h at 37°C

Result

Expected bands: 3360 and 4022 bp

Fig.4.3 PCR of BB pSB6A1-AraC-lacZ (loaded 50 µL)
l1:2log ladder, l2: pSB6A1-AraC-lacZ (8), l3: pSB6A1-AraC-lacZ (9), l4: pSB6A1-AraC-lacZ (10),l5:2log ladder, l6: pSB6A1-AraC-lacZ (8) digested with XbaI & PstI, l7: pSB6A1-AraC-lacZ (9) digested with XbaI & PstI, l8: pSB6A1-AraC-lacZ (10)digested with XbaI & PstI, l9:2log ladder, l10: pSB6A1-AraC-lacZ (8) 1:10 diluted, l11: pSB6A1-AraC-lacZ (10) 1:10 diluted, l12: pSB1C3

The gel shows a band at 5 Kb.

=> Colonies 8, 9 and 10 are not the desired construct.

Restriction Digest B

Digest with KpnI of samples 8, 9, 10 for checking length of the construct and KpnI and BamHI to check for identity.

Reagent	Amount [µl]
pSB6A1-AraC-lacZ (8, 9, 10)	5
Enzymes	1.5 KpnI
Buffer NEB 3 (10x)	5
BSA (10x)	5
ddH₂O	33,5
Expected bands	7.381 bp

Reagent	Amount [µl]
pSB6A1-AraC-lacZ (8, 9, 10)	5
Enzymes	1.5 KpnI & 1,5 BamHI
Buffer NEB 3(10x)	5
BSA (10x)	5
ddH₂O	32
Expected bands	4.607 bp & 2.781 bp

Result

Expected bands: 7.381 bp and 4.607 bp & 2.781 bp

Fig.4.4 BB pSB6A1-AraC-lacZ test digested (loaded 50 µL)
l1:2log ladder, l2: pSB13-AraC-lacZ (8), l3: pSB6A1, l4-6: pSB6A1-AraC-lacZ digested with BpsI, l7:2log ladder, l8: pSB13-AraC-lacZ (8), l9: pSB6A1, l10-12: pSB6A1-AraC-lacZ digested with BpsI & BamHI

=> Colonies 8, 9 and 10 are not desired construct. Pick new colony from pSB1C3-AraC(6)-lacZ and test digest.

Miniprep

A new colony was picked from pSB1C3-AraC(6)-lacZ plate and a mini prep was performed.

Result

pSB6A1-AraC(6)-lacZ construct : 94 [ng/µl]

Test Restriction Digest

The new miniprep as well as one of the wrong pSB6A1-AraC(6)-lacZ ones were restriction digested with EcoRI-HF and PstI.

Component	Amount [µl]
DNA	5
BSA (10x)	5
NEB2 buffer (10x)	5
Enzymes (EcoRI-HF and PstI)	1.5 each
ddH₂O	32

Incubated 1 h at 37°C

Result

Expected bands: ? Kb

Fig.4.5 Test digest of pSB1C3-AraC-lacZ with EcoRI & PstI (loaded 20 µL)
l1:2log ladder, l2: pSB1C3-AraC-lacZ

The gel showed again these three bands (2.070 and 3.360 and ~4 Kb)

=> Colonies 8, 9 and 10 are not the desired construct.

Generation of Backbone pSB1C3-AraC-lacZ

Test Restriction Digest

In order find out why pSB6A1-AraC-lacZ shows wrong restriction pattern, parental pSB1C3-AraC-lacZ was restriction digested using KpnI as well as KpnI & BamHI.

Reagent	Amount [µl]
pSB1C3-AraC-lacZ	5
Enzymes	1.5 KpnI
Buffer NEB 3(10x)	5
BSA (10x)	5
ddH₂O	33.5
Expected band	5,436 bp (linerized)

Reagent	Amount [µl]
pSB1C3-AraC-lacZ	5
Enzymes	1.5 KpnI & 1.5 BamHI
Buffer NEB 3(10x)	5
BSA (10x)	5
ddH₂O	32
Expected bands	4.906 bp & 530 bp

Result

Expected bands: 5.436 bp and 4.906 bp & 530 bp

Fig.4.4 BB pSB6A1-AraC-lacZ test digested (loaded 50 µL)
l1:2log ladder, l2: pSB13-AraC-lacZ (8), l3: pSB6A1, l4-6: pSB6A1-AraC-lacZ digested with BpsI, l7:2log ladder, l8: pSB13-AraC-lacZ (8), l9: pSB6A1, l10-12: pSB6A1-AraC-lacZ digested with BpsI & BamHI

=> pSB1C3-AraC(6)-lacZ is not desired construct. Pick new colony and test digest.

Miniprep

A new colony was picked from pSB1C3-AraC(6)-lacZ plate and a mini prep was performed.

Result

pSB1C3-AraC(6)-lacZ construct : 203 [ng/µl]

Test Restriction Digest

The new miniprep as well as one of the wrong pSB6A1-AraC(6)-lacZ ones were restriction digested with EcoRI-HF and PstI.

Component	Amount [µl]
DNA	3
BSA (10x)	5
NEB2 buffer (10x)	5
Enzymes (EcoRI-HF and PstI)	1.5 each
ddH₂O	34

Incubated 1 h at 37°C

Result

Expected band: ? Kb

Fig.4.6 BB digested with EcoRI & PstI (loaded 20 µL)
l1:2log ladder, l2: digested pSB1C3-AraC-lacZ, l3: digested pSB6A1-AraC-lacZ

Gel showed again the three bands (2070 and 3360 and ~4 Kb).

=> pSB1C3-AraC(6)-lacZ is not desired construct. Start assembly all over again.

Test Restriction Digest pSB6A1-J04450

pSB6A1-J04450 was test digested to check for identity.

Reagent	Amount [µl]
pSB6A1-J04450	10
Enzymes	1.5 KpnI
Buffer NEB 3 (10x)	5
BSA (10x)	5
ddH₂O	28.5
Expected band	5,091 bp - Linearized

Reagent	Amount [µl]
pSB6A1-J04450	10
Enzymes	1.5 KpnI & 1.5 BamHI
Buffer NEB 3 (10x)	5
BSA (10x)	5
ddH₂O	27
Expected bands	4,906 bp & 530 bp

Result

Fig.4.4 BB pSB6A1-AraC-lacZ test digested (loaded 50 µL)
l1:2log ladder, l2: pSB13-AraC-lacZ (8), l3: pSB6A1, l4-6: pSB6A1-AraC-lacZ digested with BpsI, l7:2log ladder, l8: pSB13-AraC-lacZ (8), l9: pSB6A1, l10-12: pSB6A1-AraC-lacZ digested with BpsI & BamHI

Sample	Expected bands with KpnI	Bands on gel with KpnI	Expected bands with KpnI & BamHI	Bands on gel with KpnI & BamHI
pSB1C3-AraC-lacZ	5.436 Kb (linerized)	10 Kb	4.906 Kb & 530 Kb	no band
pSB6A1-J04450	5.091 Kb (linearized)	no band	5.091 Kb (linearized)	no band
pSB6A1-AraC-lacZ (8, 9, 10)	7.388 Kb (linearized)	6 Kb & 10 Kb	4.607 Kb & 2.781 Kb	6Kb & 10 Kb

This means:

The chloramphenicol backbone has the right length.
The digested chloramphenicol backbone is also ok.
The digested fragment pSB6A1-AraC-lacZ (with PstI & EcoRI-HF) showed the 2 expected bands at 2,070 bp and 3,360 bp, but another band around ~4 Kb.

=> Something is not ok with this ligated construct and we have to start all over again.

Lab book

27-05 - 02-06-13

Generation of pSB6A1

Miniprep

Grow pSB6A1 from glycerol stock in 2 ml LB Amp ON at 37°C.
Miniprep using miniprep kit from Qiagen and dilute in 30 µl ddH₂O.

Result

Concentration 69.5 ng/µl

Digest

The pSB6A1 was generated from the parts registry and cut with EcoRI & PstI

Template DNA	BSA	NEBuffer2	Enzymes	ddH₂O	Total amount
15 µl (69.5 ng/µl)	5 µl	5 µl	2x 1.5 µl EcoRI-HF & PstI	22 µl	50 µl

The digest was incubated 45 min at 37°C.

Result

Expected band: 3985 bp (pSB6A1) and at 1106 bp (insert=J04450)

Fig.5.1 Generation of pSB6A1 for Backbone generation (loaded 50 µL of PCR)
l1:2-log ladder, l2-3:digested pSB6A1
expected band at 4 Kb was cut out

=> Expected bands are present. Backbone pSB6A1 was cut out and gel purified (c=4 ng/µl).

Generation of AraC Fragment

Gel Extraction

Gel extraction was performed with the gel extraction kit from Qiagen of gel slice (cut 24-05) and was eluted in 30 µl.

Result

The measured concentrations are shown in the table below and was stored at -20°C.

Sample	Concentration [ng/µl]
AraC	22.5

Generation of lacZ Fragment

Gel Extraction

Gel extraction was performed with the gel extraction kit from Qiagen of gel slice (cut 24-05) and was eluted in 30 µl.

Result

The measured concentrations are shown in the table below and was stored at -20°C.

Sample	Concentration [ng/µl]
lacZ	42.5

Generation of Backbone pSB6A1-AraC-lacZ

Ligation of pSB6A1 with AraC-lacZ

A ligation was performed of fragments for 1 h at RT.

Sample	Concentration [ng/µl]	Amount for ligation [µl]
pSB6A1	4	12.5
AraC-lacZ	22.5	3.5
T4-ligase	-	1
Buffer	-	2
ddH₂O	-	1
Final volume	-	20

The ligase was inactivated by heat shock for 5 min at 70°C.

Transformation

Afterwards, a transformation was performed with 15 µl of the ligation reaction in competent TOP10.
Cells were streaked on LB Amp plates and incubated ON at 37°C.

Induction

The following day, 5 white colonies were picked (because the red ones still have the mRFP insert J04450) and were incubated in 2 ml LB Amp with 20 µl Arabinose (10%) and 100 µl X-Gal (20 ng/µl).

Result

2 of the colonies turned blue

=> Perform miniprep.

Miniprep

Miniprep was performed according to Qiagen's instructions.

Result

Sample	Concentration [ng/µl]
pSB6A1-AraC-lacZ	99

DelH F1a

PCR Conditions F1a.W5.A

Reagent	DelH F1a	DelH F1a
Expected length [Kb]	5	5
Template	1 µl D. acidovorans	1 µl D. acidovorans
Primer fw 10 µM	DN01	DN01
Primer rev 10 µM	DN08	DN08
Phusion Master Mix (2x)	25 µl	25 µl
DMSO	2.5 µl	-
ddH₂O	20,5	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
16	98	1
	62	5
	72	2:00 min
1	72	2:30 min
1	4	inf

Result

Expected band: 5 Kb

Fig.5.2 PCR of DelH fragment F1a, F1b & F2(loaded 50 µL of PCR)
l1:2-log ladder, l3-4:F1a,l5-6:F1b,l7-8:F2

The gel shows a lot unspecific bands for both DelH F1a samples.

=> Fragment was cut and gel purified.

DelH F1b

PCR Conditions F1b.W5.A

Reagent	DelH F1b
Expected length [Kb]	5
Template	1 µl D. acidovorans
Primer fw 10 µM	DN07
Primer rev 10 µM	DN02
Phusion Master Mix (2x)	25 µl
DMSO	-
ddH₂O	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
16	98	1
	68	5
	72	2:00 min
1	72	2:30 min
1	4	inf

Result

Expected band: 5 Kb

Fig.5.2 PCR of DelH fragment F1a, F1b & F2(loaded 50 µL of PCR)
l1:2-log ladder, l3-4:F1a,l5-6:F1b,l7-8:F2

Gel shows one band at the expected length of 5 Kb, but also other side bands below and a huge, bright band at 2 Kb.

=> Band was cut and gel isolated.

DelH F2

PCR Conditions F2.W5.A

Reagent	DelH F2
Expected length [Kb]	8
Template	1 µl glycerol stock
Primer 10 µM fw	0.5 µl DelH_f2_SalI_fw
Primer 10 µM rev	0.5 µl DelH_f2_KpnI_rev
Phusion Master Mix (2x)	25 µl
DMSO	0 µl
ddH₂O	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
	66	5
	72	2:45 min
1	72	2:45 min
1	4	inf

Result

Expected length: 8 Kb

Fig.5.2 PCR of DelH fragment F1a, F1b & F2(loaded 50 µL of PCR)
l1:2-log ladder, l3-4:F1a,l5-6:F1b,l7-8:F2

There was a specific band at 8 Kb.

=> Fragment was cut and gel extracted.

Lab book

03-06 - 09-06-13

Generation of DelH plasmid pHM01

Elongation-PCR Conditions BB.W6.A

The restriction sites were added to pSB6A1-AraC-lacZ via PCR.

Reagent	pSB6A1-AraC-lacZ
Expected length [Kb]	7.4
Template	1 µl of 1:10 pSB6A1-AraC-lacZ miniprep
Primer fw 10 µM	DN05
Primer rev 10 µM	DN06
Phusion Master Mix (2x)	25 µl
DMSO	-
ddH₂O	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
14	98	1
	66↓	5
	72	2:00 min
16	98	1
	66	5 s
	72	2:00 min
1	72	2:30 min
1	4	inf

Result

Expected band: 7.4 Kb

Fig.6.1 PCR of pSB6A1-AraC-lacZ & digest of pSB6A1-AraC-lacZ (loaded 5 & 20 µL of PCR)
l1: 2log ladder, l2-3: PCR of BB, l4-5: digested BB of EcoRI & PstI
PCR and digest sho the expected band at 7.4 Kb but also unspecific side bands

Gel shows expected band.

=> Band was cut and gel extracted.

Test Restriction Digest

Isolated fragment was test digested to confirm identity.

Sample	Concentration [ng/µl]	Volume for digest [µl]	Enzyme [µl]	Buffer [µl]	ddH₂O [µl]	Final volume [µl]
pSB6A1-AraC-lacZ	99	5	1.5 EcoRI-HF & 1.5 PstI	5 NEB2 & 5 BSA	32	50

The test digest was incubated 1 h at 37°C.

Result

Expected band: ~4 Kb & 3.4 Kb

Fig.6.1 Digest of pSB6A1-AraC-lacZ (loaded 5 & 20 µL of PCR)
l1: 2log ladder, l2-3: PCR of BB, l4-5: digested BB of EcoRI & PstI
PCR and digest sho the expected band at 7.4 Kb but also unspecific side bands

Gel shows expected band.

=> Backbone is fine.

Restriction Digest of pSB6A1-AraC-lacZ for Ligation

Sample	Concentration [ng/µl]	Volume for digest [µl]	Enzyme [µl]	Buffer [µl]	ddH₂O [µl]	Final volume [µl]
pSB6A1-AraC-lacZ	99	12.5	1.5 KpnI-HF & 1.5 PacI	5 NEB4 & 5 BSA	24.5	50

Restriction Digest was purified with Qiagen nucleotide removal kit.

Result

c=24 ng/µl

Restriction Digest of DelH F1a for Ligation

Sample	Concentration [ng/µl]	Volume for digest [µl]	Enzyme [µl]	Buffer [µl]	ddH₂O [µl]	Final volume [µl]
DelH F1a	?	25	1.5 EcoRI-HF & 1.5 PacI	5 NEB4 & 5 BSA	12	50

Restriction Digest was purified with Qiagen nucleotide removal kit.

Result

c=9 ng/µl

Restriction Digest of DelH F1b for Ligation

Sample	Volume for digest [µl]	Enzyme [µl]	Buffer [µl]	ddH₂O [µl]	Final volume [µl]
DelH F1b	25	1.5 EcoRI-HF & 1.5 SalI-HF	5 NEB4 & 5 BSA	12	50

Restriction Digest was purified with Qiagen nucleotide removal kit.

Result

c=19 ng/µl

Restriction Digest of DelH F2 for Ligation

Sample	Volume for digest [µl]	Enzyme [µl]	Buffer [µl]	ddH₂O [µl]	Final volume [µl]
DelH F2	25	1.5 KpnI-HF & 1.5 SalI-HF	5 NEB4 & 5 BSA	12	50

Restriction Digest was purified with Qiagen nucleotide removal kit.

Result

c=9 ng/µl

Ligation of pHM01:DelH-pSB6A1-AraC-lacZ

Ligations was performed of all 4 fragments (digested and purified) for 1 h at RT in 2 different mixes.

Sample	Concentration [ng/µl]	Volume for Ligation [µl]
pSB6A1-AraC-lacZ	24	2
DelH F1a	9	6
DelH F1b	19	3
DelH F2	9	6
T4 ligase	-	1
Buffer	-	2
ddH₂O	-	-
Final volume	-	20

The ligase was inactivated by heat shock for 5 min at 70°C.
The reaction mix was purified with Qiagen nucleotide removal.

Result

Sample	Concentration [ng/µl]
1	20
2	30

Electroporation

Two electroporations were performed.

20 ng
30 ng

After an incubation time of 1 h in SOC-medium, cells were centrifuged and 10 µl plated on one LB Amp plate (with Arabinos and X-Gal) and 100 µl on another plate prepared with the same conditions.
Plates were incubated ON at 37°C.

Result

White colonies grew on the plates.

Colony PCR

6 colonies of plate E1 (colonies 1-6) and 6 colonies of plate E2 (7-12) as well as ligation mixes 1 & 2 were checked by PCR.

Reagent	DelH colonies
Expected length [bp]	663
Primer fw 10 µM	2 µl VF2
Primer rev 10 µM	2 µl DN07
Taq Polymerase (2x)	10 µl
ddH₂O	6 µl

Cycles	Temperature [°C]	Time
1	95	120
12	95	60
	66 (touchdown -0.5°C)	30
	72	45
18	95	60
	62 (touchdown -0.5°C)	30
	72	45
1	12	inf

Result

Expected length: 663 bp.

Fig.6.2 Colony PCR of DelH-construct (loaded 5 µL)
l1:2log ladder, l2-10:Colony PCR of colonies 1-9, l10:2 log ladder, l11-15:Colony PCR of colonies 1-9
l2-3: shows expected band at 663 bp

None of the colonies shows a band. Ligation mixes 1 and 2 show the expected band at ~600 bp.

=> The ligation worked, but none of the correct plasmids were present in the analyzed colinies.

Overview
Lab book

Primers

Identifier	Order date	Note	Sequence
DN09:DelH_f1_fw_long	2013-06-11	Amplification of DelH F1a from the genome: doesn't work	ATGGACCGTGGCCGCCTGCGCCAAATCG
DN10:DelH_f1_fw_short	2013-06-11	Amplification of DelH F1a from the genome: doesn't work	ATGGACCGTGGCCGCCTGC
DN11:DelH_f1_fw_short2	2013-06-11	Amplification of DelH F1a from the genome: works!!!!	GCCGCCTGCGCCAAATCG
DN12:DelH_f1_PacI_fw_short	2013-06-11	Amplification of DelH F1a from the genome: doesn't work	ttttttaattaatcacacaggaaagtactagATGGACCGTGGCCGCCTGC

10-06 - 16-06-13

Characterization of DelH plasmid of 02-06

Template	15 x 1 µl of ligated plasmid
Expected length [bp]	663
Named	1-15
Primer fw 100 µM	15 x 0.2 µl VF2
Primer rev 100 µM	15 x 0.2 µl DN07
Dream-Taq Polymerase (2x)	15 x 10 µl
ddH₂O	15 x 8.6 µl

Cycles	Temperature [°C]	Time [s]
1	94	180
12	94	20
	66 (touchdown -0.5°C)	20
	72	45
18	94	20
	62	20
	72	45
1	72	5 min
1	4	inf

Re-PCR of DelH fragment F1a & F1b

Result

Expected band: 5 Kb.

Fig.7.1 Gel of Re-PCR of DelH-F1a and DelH-F1b (loaded 20 µL)
l1 2 log ladder, l2F1a, l3 F1b
no specific band at expected 5 Kb

There are no specific bands at 5 Kb.

=> We therefore failed to reamplify DelH F1a and F1b from the PCR product.

=> Additionally, in the elctroporated colonies, there is no fragment F1a and F1b.

=> We need to design new forward primers for DelH F1a & F1b.

Amplification of DelH F1a

New Primers

Identifier	Order date	Note	Sequence
DN09:DelH_f1_fw_long	2013-06-11	Amplification of DelH F1a from the genome: doesn't work	ATGGACCGTGGCCGCCTGCGCCAAATCG
DN10:DelH_f1_fw_short	2013-06-11	Amplification of DelH F1a from the genome: doesn't work	ATGGACCGTGGCCGCCTGC
DN11:DelH_f1_fw_short2	2013-06-11	Amplification of DelH F1a from the genome: works!!!!	GCCGCCTGCGCCAAATCG
DN12:DelH_f1_PacI_fw_short	2013-06-11	Amplification of DelH F1a from the genome: doesn't work	ttttttaattaatcacacaggaaagtactagATGGACCGTGGCCGCCTGC

PCR Conditions F1a.W7.A

Reagent	DelH_f1_fw_long	DelH_f1_fw_short	DelH_f1_fw_short2	DelH_f1_PacI_fw_short
Expected length [bp]	5 Kb	5 Kb	5 Kb	5 Kb
Template	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans glycerol stock
Primer 10 µM fw	2.5 µl DelH_f1_fw_long	2.5 µl DelH_f1_fw_short	2.5 µl DelH_f1_fw_short2	2.5 µl DelH_f1_PacI_fw_short
Primer 10 µM rev	1 µl DelH_EcoRI_rev	1 µl DelH_EcoRI_rev	1 µl DelH_EcoRI_rev	1 µl DelH_EcoRI_rev
Phusion Master Mix (2x)	25 µl	25 µl	25 µl	25 µl
ddH₂O	19 µl	19 µl	19 µl	19 µl

Because the annealing temperature of DelH_f1_fw_long is 77,4°C and of the primer DelH_EcoRI_rev is 69,6°C, a 2-step PCR was performed.

Cycles	Temperature DelH_f1_fw_long [°C]	Time [s]	Cycles	Temperature else [°C]	Time [s]
1	98	30	1	98	30
30	98	5	30	98	5
	-	-		66	5
	72	2:15 min		72	2:15 min
1	72	7 min	1	72	7:00 min
1	4	inf	1	4	inf

Using hot start at 98°C

Result

Expected band: 5 Kb

Fig.7.2 Gel of amplified DelH-1a fragment with different fw primern (loaded 20 µL)
l1 2 log ladder, l2F1a, l3 F1a
l2 DelH-1a fragment shows a specific band ~ 5 Kb

There is a specific band at 5 Kb for DN11. The other primers show only unspecific products.

=>The DN11 primer will be used. Using PCR conditions F1a.W7.A and short2 primer, the PCR was repeated to produce more product.

Lab book

17-06 - 23-06-13

Amplification of DelH F1a

Elongation-PCR Conditions F1a.W8.A

Reagent	Amount [µl]
Expected length [bp]	5
Template	1 µl PCR-product (16-06)
Primer 10 µM fw	2.5 µl DelH_f1_PacI_fw
Primer 10 µM rev	2,5 µl DelH_EcoRI_rev
Phusion Master Mix (2x)	25 µl
ddH₂O	19 µl

Cycles	Temperature [°C]	Time [s]
1	98	30
30	98	5
30	72	2:15 min
1	72	7 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 5 Kb

Fig.8.1 gel of amplified fragments (loaded 20 µL)
l1: 2 log ladder, l2: DelH-F1a
l2: DelH-F1a shows specific band = cut out

Gels shows expected band.

=> Band was cut and gel extracted.

Restriction Digest

DelH F1a was restricted with EcoRI & PacI.
Afterwards it was purified with nucleotide removal kit and DNA concentration was measured.

Result

Expected band: 5 Kb

Fig.8.2 Gel of digested F1a with (loaded 20 µL)
l1: 2 log ladder, l2-3: DelH-F1a digested

Gel shows expected band at ~5 Kb.

=> Restriction digest mix was purified by precipitation.

Purification of Restriction Digest

Add 1 ml isopropanol
Centrifuge 20 min full speed
Discard supernatant
Add 750 µl 70% ethanol
Centrifuge 5 min full speed
Discard supernatant
Dry for 10 min
Resuspend in 20 µl H₂O

Result

DNA-concentration was measured at the Nanodrop c=21 ng/µl.

Re-PCR Conditions F1a.W8.A

In order to increase the product yield, F1a was amplified from the PCR fragment produced in week 7 using PCR conditions F1a.W7.A and short2 primer.

Reagent	Amount [µl]
Expected length [bp]	5 Kb
Template	1 µl 1:10 dilution of purified DelH F1a (2.1 ng/µl)
Primer 10 µM fw	2.5 µl DelH_f1_short2_fw
Primer 10 µM rev	2.5 µl DelH_EcoRI_rev
Phusion Master Mix (2x)	25 µl
ddH₂O	19 µl

Cycles	Temperature A [°C]	Time [s]	Cycles	Temperature B [°C]	Time [s]
1	98	30	1	98	30
30	98	5	30	98	5
	-	-		66	5
	72	2:15 min		72	2:15 min
1	72	7 min	1	72	7 min
1	4	inf	1	4	inf

Using hot start at 98°C

Result

Expected band: 5 Kb

Gel shows expected band at ~5 Kb.

=> Fragment was cut and gel isolated.

Generation of DelH plasmid 19-06

Ligation

Using 200 ng DNA

Fragment	Size [Kb]	Concentration [ng/µl]	Volume [µl] for ligation
F1a	5	261 (1:10 diluted => 26.1)	1.4
F1b	5	19	1.6
F2	8	9	4.5
Backbone	7.4	24	2

Reagent	Volume [µl] for ligation
Ligase	1
Buffer	2
Total DNA	10.3
ddH₂O	7.3

Using 600 ng DNA

Fragment	Size [Kb]	Concentration [ng/µl]	Volume [µl] for ligation
F1a	5	261 (1:10 diluted => 26.1)	8
F1b	5	19	7
F2	8	9	2
Backbone	7.4		5

Reagent	Volume [µl] for ligation
Ligase	2
Buffer	4
Total DNA	22
ddH₂O	22

Purification of Ligation

Add 1 ml isopropanol
Centrifuge 20 min full speed
Discard supernatant
Add 750 µl 70% ethanol
Centrifuge 5 min full speed
Discard supernatant
Dry for 10 min
Resuspend in 20 µl H₂O

Electroporation

As described in methods Electroporation of E. coli DH10β

One Eppi with DNA of ligation with 20 µl
Second Eppi with DNA of ligation with 50 µl (more DNA)
Streaked on LB Amp plates. Of each electroporated aliquot, one plate with 10 µl and another with 100 µl of the cells was spread.
Incubation ON at 37°C.

Characterization of DelH plasmid 19-06

Test Digest using SalI and PacI

Reagent	Amount [µl]
DNA	1
SalI	1
PacI	1
NEB4-buffer	2
BSA	2
ddH₂O	13

Result

Expected band: 10 Kb, 8 Kb, 7 Kb
There is nothing to see on gel, most probably due to too little amounts of DNA.

Colony-PCR

Only few colonies (~10) grew on both 100 µl plates.
Of 8 colonies from each 100 µl plate, a colony-PCR was performed.
Inocculation of PCR colonies into 1 ml LB Amp-Ara-XGal ON at 37°C.

Reagent	DelH colonies
Expected length [bp]	663
Primer fw 10 µM	2 µl VF2
Primer rev 10 µM	2 µl DN07
Dream-Taq Polymerase (2x)	10 µl
ddH₂O	6 µl

Cycles	Temperature [°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
18	95	60
	65 (touchdown -0.5°C)	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.8.3 gel of colony PCR (loaded 5 µL)
l1: 2 log ladder, l2-6: colonies 1-5 screened with PCR conditions mentioned above
l2 shows expected band

Only colony 4 (second lane) shows expected band at ~600 bp. Yet, no blue color could be detected in ON culture, even in pellet (frozen for SDS Page).

=> This means, that our ligated plasmid was successfully transformed, but lacZ is not expressed.

Will run SDS-PAGE of transformed cultures and parental stock. Also inocculate cultures using higher concentrations of arabinose and X-Gal.

Stronger Induction of lacZ Expression

Inocculated single colonies from day before into 5 ml LB Amp-Ara-XGal using 2x amounts of arabinose and X-Gal stock solutions (maybe concentrations of stocks are too low or promoters need stronger induction).
Incubation ON at 37°C.

Result

No lacZ expression was observed.

Lab book

24-06 - 30-06-13

Characterization of DelH plasmid 19-06

SDS Page

Using NuPAGE Novex 10% Bis-Tris precast gel from Invitrogen with MOPS running buffer

3NuPAGE Novex 3-8% Tris-Acetate precast gel would have been more suitable considering expected 600 kDa DelH, but needed Tris-Acetate SDS buffer was not available.

Resuspended pellets in 100 µl SDS buffer (from Linda)
Boiled for 10 min @98°C
Ran for 90 min, 180 V
Stained for 40 min in Coomassie Buffer (50 ml acetic acid 100% + 225 ml ddH₂O, 1.5 g Coomassie in 225 ml methanol, mix both)
Washed in ddH₂O multiple times

Result

Fig.9.1 SDS PAGE
L1: Ladder L2: 6 µl of Konrad’s E. coli L3: 6 µl DelH colony 4 L4: 6 µl DelH colony 6 L5: 9 µl of Konrad’s E. coli L6: 9 µl DelH colony 4 L7: 9 µl DelH colony 6 L8: 15 µl of Konrad’s E. coli L9: 15 µl DelH colony 4 L10: 15 µl DelH colony 6 L11: empty L12: Ladder

None clear band at ~600 kDa visible. Maybe in highest amounts, but not reliable.

=> Probably no DelH expression in analyzed colonies.

Mini Prep

Picked colonies from LB Amp plates into 5 ml LB Amp (colonies 4, 6 and 9)
Incubation ON at 37°C
5 ml ON cultures were mini prepared and resuspended in 50 µl

Test Restriction Digest

5 µl of the mini prep were test digested

Reagent	Volume [µl]
Miniprep DNA	5
CutSmart buffer	2
EcoRI-HF, PacI, KpnI-HF	0.5 each
ddH₂O	10.75

Incubation at 37°C for 1 h

Result

Expected band pattern: 5 kp, 7.3 kp, 13 kp

Fig.9.2 Gel of amplified fragments (loaded 20 µL)
l1: 2 log ladder, l2:test digested DelH fragment
l2: no visible band

No clear bands visible.

=> DNA yield from mini prep was probably too low.

DNA Concentration

Colony	DNA concentration [ng/µl]
1	124.5
4	3.9
6	1.6
9	10.2

DNA measurement confirmed suspicion from test digest.

=>Thus, mini prep and test digest have to be repeated

Repetion of Mini Prep

Picked colonies from LB Amp plates into 5 ml LB Amp (colonies 4, 6 and 9) or from remaining ON culture (colony 1)
Incubation ON at 37°C
Colony 1 did not grow (also not on LB Amp plate), obviously lost plasmid
Mini preped remaining 3, eluted in 35 µl ddH₂O

DNA Concentration

Colony	DNA concentration [ng/µl]
4	38.5
6	42.0
9	49.0

Test Restriction Digest

Digested entire mini prep (using remaining from first mini for colony 1) for 2 h at37°C

Reagent	Volume [µl]
Mini prep	42
CutSmart	5
EcoRI-HF, PacI, KpnI-HF	1 each

Result

Expected bands: BB (7.3 Kb), DelH F2 (8 Kb), F1a + F1b (10 Kb)

Fig.9.3 miniprep resitriction digested (loaded 20 µL)
l1: 2 log ladder, l2: DelH-F1a
l2: DelH-F1a shows specific band = cut out

Unexpected bands at 3 Kb, but not desired ones.

=> Colonies do not contain desired plasmid and entire ligation has to be repeated.

Amplification of DelH F1b

PCR Conditions F1b.W9.A

Reagent	DelH F1b
Template	1 µl D. acidovorans stock 29-04-13
Primer fw 10 µM	0.5 µl DelH_EcoRI_fw 100 µM
Primer rev 10 µM	0.5 µl DelH_f1_SalI_rev 100 µM
Phusion Ready Mix	25 µl
ddH₂O	23 µl

Cycles	Temperature [°C]	Time
1	98	30 s
35	98	15 s
	68	5 s
	72	3:30 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 5 Kb, Loaded 1 µl of PCR

Fig.9.4 gel of amplified DelH 1b - fragment (loaded 20 µL)
l1: 2 log ladder, l2: DelH-F1b
l2: DelH-F1b shows no band

No correct band visible.

=> Why could we not reproduce the previous amplification?

PCR Conditions F1b.W9.B

Reagent	DelH F1b
Template	1 µl D. acidovorans stock 29-04-13
Primer fw 10 µM	0.5 µl DelH_EcoRI_fw 10 µM
Primer rev 10 µM	0.5 µl DelH_f1_SalI_rev 10 µM
Phusion Ready Mix	25 µl
ddH₂O	23 µl

Cycles	Temperature [°C]	Time
1	98	30 s
30	98	15 s
	68	15 s
	72	3:30 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 5 Kb, Loaded 1 µl of PCR

Fig.9.5 gel of amplified DelH-1b-fragment (loaded 20 µL)
l1: 2 log ladder, l2: DelH-F1b
l2: DelH-F1b shows unexpected band at 2.3 Kb

Again, expected band not there.

=> Adapt PCR conditions and ask for polymerase used last time, which is the one from the lab upstairs.

PCR Conditions F1b.W9.C

Reagent	DelH F1b
Template	1 µl DelH F1b Fragment
Primer fw 10 µM	0.5 µl DelH_EcoRI_fw 10 µM
Primer rev 10 µM	0.5 µl DelH_f1_SalI_rev 10 µM
Phusion Flash Ready Mix	10 µl
ddH₂O	7 µl

Cycles	Temperature [°C]	Time
1	98	10 s
30	98	1 s
	68	5 s
	72	120
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 5 Kb, Loaded 1 µl of PCR

Fig.9.9 gel of amplified fragments (loaded 20 µL)
l1-3:F1b, l4: 2log ladder, l5-7: BB
BB was not amplified

Fig.9.8 gel of amplified fragments (loaded 20 µL)
l1-3:F1b, l4: 2log ladder, l5-7: BB
BB was not amplified

Fig.9.7 Gel of amplified DelH-fragments(F1a & F2) and Backbone (pSB6A1-AraC-lacZ) (loaded 20 µL)
l1:2log ladder, l2: F1a, l3:F2, l4: BB
l2: F1a shows specific band at 5 Kb = was cut out

Fig.9.6 Gel of amplified DelH-fragments(F1a & F2) and Backbone (pSB6A1-AraC-lacZ) (loaded 20 µL)
l1:2log ladder, l2: F1a, l3:F2, l4: BB
l2: F1a shows specific band at 5 Kb

Highly specific band at 5 Kb, as well as additional smaller ones.

=> Band was cut. Run gel with remaining sample for gel extraction.

PCR Conditions F1b.W9.D

Reagent	DelH F1b
Template	1 µl D. acidovorans stock 29-04-13 1:10
Primer fw 10 µM	0.5 µl DelH_EcoRI_fw 10 µM
Primer rev 10 µM	0.5 µl DelH_f1_SalI_rev 10 µM
Q5 Ready Mix	10 µl
ddH₂O	7 µl

Cycles	Temperature [°C]	Time
1	98	10 s
30	98	1 s
	68	5 s
	72	2:30 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: DelH F1b 5 Kb

Fig.9.10 gel of amplified fragments using Q5 (loaded 1 µL)
l1:2log ladder, l5: fragment 1b, l6: fragment 2, l7: BB
no product

Neither of the PCRs yield any product.

=> Therefore, Q5 is no option for us!

Amplification of DelH F2

PCR Conditions F2.W9.A

Reagent	DelH 2
Template	1 µl D. acidovorans stock 29-04-13
Primer fw 10 µM	0.5 µl DelH_f2_SalI_fw 100 µM
Primer rev 10 µM	0.5 µl DelH_f2_KpnI_rev 100 µM
Phusion Ready Mix	25 µl
ddH₂O	23 µl

Cycles	Temperature [°C]	Time
1	98	30 s
35	98	15 s
	66	5 s
	72	3:30 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 8 Kb

Fig.9.11 gel of amplified fragments (loaded 1 µL)
l1: 2log ladder, l2:F1b, l3: F2, l4: BB
shows band at 3 Kb

Unexpected bands at 3 Kb in lanes of DelH 2

=> Why could we not reproduce the previous amplification?

PCR Conditions F2.W9.B

Reagent	DelH 2
Template	1 µl D. acidovorans stock 29-04-13
Primer fw 10 µM	0.5 µl DelH_f2_SalI_fw 10 µM
Primer rev 10 µM	0.5 µl DelH_f2_KpnI_rev 10 µM
Phusion Ready Mix	25 µl
ddH₂O	23 µl

Cycles	Temperature [°C]	Time
1	98	30 s
12	98	15 s
	66 decrease by 0.5	15 s
	72	3:30 min
18	98	15 s
	66	15 s
	72	3:30 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 8 Kb

Fig.9.12 gel of amplified fragments (loaded 1 µL)
l1:2log, l2: F1b, l3: F2, l4: BB
F2 shows no specific band

Unexpected bands at 1.5 Kb, 2.2 Kb, 4 Kb and 6 Kb. Desired 8 Kb band is present but hardly visible.

=> Adapt PCR conditions and ask for polymerase used last time, which is the one from the lab upstairs.

PCR Conditions F2.W9.C

Reagent	DelH 2
Template	1 µl D. acidovorans stock 29-04-13 1:10
Primer fw 10 µM	0.5 µl DelH_f2_SalI_fw 10 µM
Primer rev 10 µM	0.5 µl DelH_f2_KpnI_rev 10 µM
Phusion Flash Ready Mix	10 µl
ddH₂O	7 µl

Cycles	Temperature [°C]	Time
1	98	10 s
12	98	1 s
	66 decrease by 0.5	5 s
	72	2:30 min
18	98	1 s
	66	5 s
	72	2:30 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 8 Kb

Fig.9.9 Gel of amplified DelH-fragments(F1a & F2) and Backbone (pSB6A1-AraC-lacZ) (loaded 19 µL)
l1:2log ladder, l2: F1a, l3:F2
l3: F2 shows specific band at 8 Kb and other ones

Fig.9.8 Gel of amplified DelH-fragments(F1a & F2) and Backbone (pSB6A1-AraC-lacZ) (loaded 19 µL)
l1:2log ladder, l2: F1a, l3:F2
l3: F2 shows specific band at 8 Kb and other ones

Fig.9.7 Gel of amplified DelH-fragments(F1a & F2) and Backbone (pSB6A1-AraC-lacZ) (loaded 1 µL)
l1:2log ladder, l2: F1a, l3:F2, l4: BB
l2: F1a shows specific band at 8 Kb = was cut out

Fig.9.6 Gel of amplified DelH-fragments(F1a & F2) and Backbone (pSB6A1-AraC-lacZ) (loaded 1 µL)
l1:2log ladder, l2: F1a, l3:F2, l4: BB
l3: F2 shows specific band at 8 Kb and other ones

F2 shows specific band at 8 Kb and additional ones.

=> Band was cut. Run gel with remaining sample for gel extraction.

PCR Conditions F2.W9.D

Reagent	DelH 2
Template	1 µl D. acidovorans stock 29-04-13 1:10
Primer fw 10 µM	0.5 µl DelH_f2_SalI_fw 10 µM
Primer rev 10 µM	0.5 µl DelH_f2_KpnI_rev 10 µM
Q5 Ready Mix	10 µl
ddH₂O	7 µl

Cycles	Temperature [°C]	Time
1	98	10 s
12	98	1 s
	66 decrease by 0.5	5 s
	72	2:30 min
18	98	1 s
	66	5 s
	72	2:30 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 8 Kb, Loaded 1 µl of PCR

Fig.9.10 gel of amplified fragments using Q5 (loaded 1 µL)
l1:2log ladder, l5: fragment 1b, l6: fragment 2, l7: BB
no product

Neither of the PCRs yield any product.

=> Therefore, Q5 is no option for us!

Amplification of Backbone pSB6A1-AraC-lacZ

PCR Conditions BB.W9.A

Reagent	Backbone
Template	1 µl Backbone (pSB6A1-AraC-lacZ c = 24 ng/µl)
Primer fw 10 µM	0.5 µl AraCbb_KpnI_fw 100 µM
Primer rev 10 µM	0.5 µl AraCbbPacI_rev2 100 µM
Phusion Ready Mix	25 µl
ddH₂O	23 µl

Cycles	Temperature [°C]	Time
1	98	30 s
35	98	15 s
	66	5 s
	72	3:30 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 7.3 Kb, Loaded 1 µl of PCR

Fig.9.11 Gel of amplified fragments of DelH and BB(loaded 1 µL)
l1:2log ladder, l5: F1b, l6: F2, l7: BB
no product

No band visible, amplification failed.

=> Why could we not reproduce the previous amplification?

PCR Conditions BB.W9.B

Reagent	BB
Template	1 µl Backbone (pSB6A1-AraC-lacZ c = 24 ng/µl)
Primer fw 10 µM	0.5 µl AraCbb_KpnI_fw 10 µM
Primer rev 10 µM	0.5 µl AraCbbPacI_rev2 10 µM
Phusion Ready Mix	25 µl
ddH₂O	23 µl

Cycles	Temperature [°C]	Time
1	98	30 s
12	98	15 s
	66 decrease by 0.5	15 s
	72	3:30 min
18	98	15 s
	66	15 s
	72	3:30 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 7.3 Kb, Loaded 1 µl of PCR

Fig. 9.12 Gel of amplified DelH-fragments and BB l1:2log, l2: F1b,l3:F2, l4:BB

Unexpected band at 2.2 Kb

=> Adapt PCR conditions and ask for polymerase used last time, which is the one from the lab upstairs.

PCR Conditions BB.W9.C

Reagent	DelH 2
Template	1 µl pSB6A1-AraC-LacZ digested and purified 1:10
Primer fw 10 µM	0.5 µl AraCbb_KpnI_fw 10 µM
Primer rev 10 µM	0.5 µl AraCbbPacI_rev2 10 µM
Phusion Flash Ready Mix	10 µl
ddH₂O	7 µl

Cycles	Temperature [°C]	Time
1	98	10 s
12	98	1 s
	66 decrease by 0.5	5 s
	72	2:30 min
18	98	1 s
	66	5 s
	72	2:30 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 7.3 Kb, Loaded 1 µl of PCR

Fig.9.6 Gel of amplified DelH-fragments(F1a & F2) and Backbone (pSB6A1-AraC-lacZ) (loaded 20 µL)
l1:2log ladder, l2: F1a, l3:F2, l4: BB
l4: BB shows no expected band

Gel does not show expected fragment.

=> Make sure right template was used. Is the restricted and purified fragment suitable?

PCR Conditions BB.W9.D

Reagent	DelH 2
Template	1 µl pSB6A1-AraC-LacZ digested and purified 1:10
Primer fw 10 µM	0.5 µl AraCbb_KpnI_fw 10 µM
Primer rev 10 µM	0.5 µl AraCbbPacI_rev2 10 µM
Q5 Ready Mix	10 µl
ddH₂O	7 µl

Cycles	Temperature [°C]	Time
1	98	10 s
12	98	1 s
	66 decrease by 0.5	5 s
	72	2:30 min
18	98	1 s
	66	5 s
	72	2:30 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 7.3 Kb, Loaded 1 µl of PCR

Fig.9.10 gel of amplified fragments using Q5 (loaded 1 µL)
l1:2log ladder, l5: fragment 1b, l6: fragment 2, l7: BB
no product

Neither of the PCRs yield any product.

=> Therefore, Q5 is no option for us!

Lab book

01-07 - 07-07-13

Amplification of DelH F1b

PCR Conditions F1b.W10.A

Reagent	DelH F1b
Template	1 µl DelH 1Fb Fragment
Primer fw 10 µM	2.5 µl DelH_EcoRI_fw 10 µM
Primer rev 10 µM	2.5 µl DelH_f1_SalI_rev 10 µM
Phusion Ready Mix	25 µl
ddH₂O	19 µl

Cycles	Temperature [°C]	Time [s]
1	98	30
30	98	15
	68	15
	72	5 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 5 Kb

Fig.10.1 gel of amplified fragments (loaded 1 µL of PCR)
l1: 2log ladder, l2: F1b,l3: F2, l4: BB
no bands

No correct bands visible.

=> Phusion is no option for us, not even for re-PCRs.

PCR Conditions F1b.W10.B

Reagent	DelH F1b
Template	1 µl D. acidovorans glycerol stock
Primer fw 10 µM	2.5 µl DelH_EcoRI_fw 10 µM
Primer rev 10 µM	2.5 µl DelH_f1_SalI_rev 10 µM
Phusion Ready Mix	25 µl
ddH₂O	19 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	68	5
	72	180
1	72	5 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 5 Kb

Fig.10.2 gel of amplified DelH fragments (loaded 50 µL of PCR)
l1-2: F1b, l3: 2log,l4-5:fragment 2 of DelH, l6-7: pSB6A1
l1: F1b shows no band

=> F1b was not amplified.

Amplification of DelH F2

PCR Conditions F2.W10.A

Reagent	DelH F2
Template	1 µl DelH 2 PCR product
Primer fw 10 µM	2.5 µl DelH_f2_SalI_fw 10 µM
Primer rev 10 µM	2.5 µl DelH_f2_KpnI_rev 10 µM
Phusion Ready Mix	25 µl
ddH₂O	19 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
12	98	15
	66 decrease by 0.5	15
	72	8 min
12	98	15
	66	15 s
	72	8 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 8 Kb, Loaded 1 µl of PCR

Fig.10.1 gel of amplified fragments (loaded 50 µL of PCR)
l1: F1b, l2: 2, l3: pSB6A1
l2: F2 shows no band

Gel does not show correct band.

=> Phusion is no option for us, not even for re-PCRs.

PCR Conditions F2.W10.B

Reagent	DelH F2
Template	1 µl D. acidovorans glycerol stock
Primer fw 10 µM	2.5 µl DelH_f2_SalI_fw 10 µM
Primer rev 10 µM	2.5 µl DelH_f2_KpnI_rev 10 µM
Phusion Ready Mix	25 µl
ddH₂O	19 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	66 decrease by 0.5	5
	72	2:30 min
12	98	1
	66	5
	72	2:30 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 8 Kb, Loaded 50 µl of PCR

Fig.10.2 gel of amplified fragments (loaded 50 µL of PCR)
l1-2: F1b, l3: 2log, l4-5: 2,l6-7 pSB6A1-AraC-lacZ
l1: F1b shows no band

=> F2 was not amplified.

Amplification of Backbone

PCR Conditions BB.W10.A

Reagent	Backbone
Template	1 µl psB6A1+AraC+Lacz 1:10
Primer fw 10 µM	2.5 µl AraCbb_KpnI_fw
Primer rev 10 µM	2.5 µl AraCbbPacI_rev2
Phusion Ready Mix	25 µl
ddH₂O	19 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
12	98	1
	66 decrease by 0.5	15
	72	8 min
12	98	15
	66	15
	72	8 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 7.3 Kb, Loaded 1 µl of PCR

Fig.10.1 gel of amplified fragments (loaded 1 µL of PCR)
l1: 2log ladder, l2: F1b,l3: F2, l4: BB
no bands

No product.

=> Phusion is no option for us, not even for re-PCRs.

PCR Conditions BB.W10.B

Reagent	Backbone
Template	1 µl psB6A1+AraC+Lacz 1:10
Primer fw 10 µM	2.5 µl AraCbb_KpnI_fw
Primer rev 10 µM	2.5 µl AraCbbPacI_rev2
Phusion Ready Mix	25 µl
ddH₂O	19 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	66 decrease by 0.5	5
	72	2:30 min
12	98	1
	66	5
	72	2:30 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 7.3 Kb

Fig.10.2 gel of amplified fragments (loaded 50 µL of PCR)
l1-2: F1b, l3: 2log,l4-5:fragment 2 of DelH, l6-7: pSB6A1
l1: F1b shows no band

=> BB was not amplified completely. It seems that there is no insert present or the conditions were not optimal. Repeat the PCR with other conditions.

PCR Conditions BB.W10.C

Reagent	Backbone
Template	1 µl psB6A1+AraC+Lacz 1:10
Primer fw 10 µM	2.5 µl AraCbb_KpnI_fw
Primer rev 10 µM	2.5 µl AraCbbPacI_rev2
Phusion Ready Mix	25 µl
ddH₂O	19 µl

Cycles-PCR	Temperature [°C]	Time [s]
1	98	10
30	98	1
	66	5
	72	2:15 min
1	72	180
1	4	inf

Result

Expected bands: 7.3 Kb, Loaded 50 µl of PCR

Fig.10.4 gel of amplified fragments (loaded 50 µL of PCR)
l1: F1b, l2: 2, l3: pSB6A1
specific bands at 7,3 Kb was cut out

Fig.10.3 gel of amplified fragments (loaded 50 µL of PCR)
l1: F1b, l2: 2, l3: pSB6A1
band at specific 7,3 Kb, but also unspecific ones

Expected band is there, but also unspecific ones.

=> Correct band was cut and gel extracted.

Generation of DelH Plasmid

Current Status

Fragment	Concentration [ng/µl]	Digested and Purified
F1a	267	check
F1b	9.8	-
F2	11 (gel extracted) and 369 (PCR purified)	-
pSB6A1-AraC-lacZ	53.5 and 38.5	-

Restriction Digest of Fragments

Fragment	Amount for Digest [ng]	Enzymes [µl]	Buffer [µl]
F1b	441	EcoRI-HF: 1 SalI-HF: 1	Cut smart 5.5
F2	495	KpnI: 1 SalI-HF: 1	Buffer 2.1: 5.5
pSB6A1-AraC-lacZ	1,599	KpnI: 1 PacI: 1	Buffer 1.1: 3.5

1 h at 37°C

Isopropanol Purification

Fragment	Concentration after Digest & Purification [ng/µl]	Sequences
F1a	267	File:Heidelberg PCR(DelH) restricted(KpnI+PacI) sequence.fasta.txt
F1b	3.5	(Entire) Sequence of DelH
F2	1.8
pSB6A1-AraC-lacZ	7.3	File:Heidelberg PCR(pSB6A1-AraC-lacZ) digest.fasta.txt File:Heidelberg PCR(pSB6A1-AraC-lacZ) sequence.fa.txt

Confirmation of DNA Concentration

Fragment	Concentration [ng/µl]	Date	µl on gel	Expected band size
F1a	261	19-06-13	1 µl	5 Kb
F1a	261	19-06-13	2 µl	5 Kb
F2	369	01-07-13	1 µl	8 Kb

Fig.10.5 concentration validation (loaded 1 µL of F1a & F2 PCR)
l1: F1a, l2: F2, l3: 2log
there are tiny bands showing the expected fragment for F2, F1a shows no band

Fragment F1a is not present, all others are fine.

=> Therefore, the next steps are:

1. Measurement of concentration = 40 ng/µl

2. PCR of the fragment F1a. As template, we use the purified PCR with the concentration of 40 ng/µl.

Restriction Digest of F2 and Backbone

Fragment	Volume for digest [ng]	Enzymes [µl]	Buffer [µl]
2	40*369 = 14.76 µg	KpnI: 1 SalI-HF: 1	Buffer 2.1: 4.8
pSB6A1-AraC-lacZ	40*38.5 = 1.54 µg	KpnI: 1 PacI: 1	Buffer 1.1: 1.8

1h at 37°C

Purification of Restriction Digest

Using nucleotide removal kit (Qiagen), eluted with 30 µl ddH₂O.

Fragment	Concentration [ng/µl]	µl available
DelH F2	30	25 µl
pSB6A1-AraC-lacZ	-11	25 µl

Amplification of DelH F1a

PCR Conditions F1a.W10.A

Reagent	DelH F1a
Template	0.5 µl of DelH F1a digested Fragment 1:5 (= 8 ng)
Primer fw 10 µM	2.5 µl DelH_f1_PacI_fw
Primer rev 10 µM	2.5 µl DelH_EcoRI_rev
Phusion Flash Ready Mix	25 µl
ddH₂O	19.5 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
	66	5
	72	120
1	72	10 min
1	4	inf

Result

Expected band: 5 Kb

Fig.10.6 gel of amplified fragments (loaded 20 µL)
l1: F1a ,l2: 2log ladder,l3:F1b
no band visible

Gel does not show any bands.

=> We conclude, that the fragments we expected to be F1a cannot be amplified by PCR. Thus, they were not amplified in the PCR used as template.

PCR Conditions F1a.W10.B

Reagent	DelH F1a
Template	1 µl ‘‘D. acidovorans’’ glycerol stock
Primer fw 10 µM	2.5 µl DelH_f1_short2_fw
Primer rev 10 µM	2.5 µl DelH_EcoRI_rev
Phusion Flash Ready Mix	25 µl
ddH₂O	19 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
	66	5
	72	2:00 min
1	72	7 min
1	4	inf

Result

See Confirmation of DNA Concentration

Amplification of DelH F1b

PCR Conditions F1b.W10.C

Reagent	DelH F1b
Template	1 µl DelH F1b digested Fragment
Primer fw 10 µM	2.5 µl DelH_EcoRI_fw
Primer rev 10 µM	2.5 µl DelH_f1_SalI_rev
Phusion Flash Ready Mix	25 µl
ddH₂O	19 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
	68	5
	72	120
1	72	10 min
1	4	inf

Result

Expected band: 5 Kb

Fig.10.6 gel of amplified fragments (loaded 20 µL)
l1: F1a ,l2: 2log ladder,l3:F1b
no band visible

There is no band visible.

=> We conclude, that the fragments we expected to be F1b cannot be amplified by PCR. Thus, they were not amplified in the PCR used as template.

Generation of DelH Plasmid

Confirmation of DNA Concentration

Fragment	Concentration (by Nanodrop)	µl on gel	µl loading dye	Digested and purified (V + A)	Date (of PCR or Purification)	Check on gel
F1a (PCR)	-	1	9* 1x	-	03-07-2013 (PCR)	+
F1a	40	2	9* 1x	V + A	19-06-2013	-
F1b	19	3	1* 6x	V + A	19-06-2013	-
F1b	3.5	10	2* 6x	V + A	02-07-2013 (V+A)	-
F2	0.5	10	2* 6x	V + A		-
F2	30.5	2	10* 1x	V + A (Nucleotide Removal)	03-07-2013	+
F2	(1:5 dilution of) 36.9	2	10* 1x	-	02-07-2013	+ (BackUP)
pSB6A1-AraC-lacZ	2.2	10	2* 6x	V + A	02-07-2013	+
pSB6A1-AraC-lacZ	(1:5 dilution of) 38.5	2	10* 1x	-	02-07-2013	+ (BackUP)
pSB6A1-AraC-lacZ	-11	5	1* 6x	V + A (Nucleotide Removal)	03-07-2013	+

Fig.10.7 gel of fragments (amplified by PCR) (loaded 20 µL)
l1: F1a, l2: F1a, l3: F1b (digested (D) & purified (P)), l4: F1b (D+P), l5: F2(D+P), l6: F2(D+P), l7: F2, l8: BB(D+P), l9: BB, l10: BB(D+P), l11: 2log
lane 2, 3, 4, 5 had no band

DelH F1a (40 ng/µl) was the fragment we used for the first ligation. It is not visible, thus, there was not enough little DNA. Since the screening primer binds to this part of DelH, we could not identify any positive clone.

=> The negative samples (with too little DNA concentration) are discarded.

Amplification of DelH F1a

PCR Conditions F1a.W10.C

Reagent	DelH F1a
Template	1 µl DelH F1a Fragment 03-07-2013
Primer fw 10 µM	2.5 µl DelH_Pac_fw
Primer rev 10 µM	2.5 µl DelH_EcoRI_rev
Phusion Flash Ready Mix	25 µl
ddH₂O	19 µl

Cycles-PCR	Temperature [°C]	Time [s]
1	98	10
30	98	1
	66	5
	72	120
1	72	7 min
1	4	inf

Result

Fragment was gel extracted.

Amplification of DelH F1b

PCR Conditions F1b.W10.D

Reagent	DelH F1b	DelH F1b
Template	1 µl D. acidovorans	1 µl DelH F1b Fragment (19 ng/µl)
Primer fw 10 µM	2.5 µl DelH_EcoRI_fw	2.5 µl DelH_EcoRI_fw
Primer rev 10 µM	2.5 µl DelH_f1_SalI_rev	2.5 µl DelH_f1_SalI_rev
Phusion Ready Mix	25 µl	25 µl
ddH₂O	19 µl	19 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	68	5
	72	2:15 min
1	72	7 min
1	4	inf

Result

Expected band: 5 Kb

Fig.10.9 gel of amplified fragments (loaded 20 µL)
lane 1 2log ladder, lane 2 fragment 1, lane 3 fragment 2
excised band of lane 3; lane 2 had no band

No bands visible.

=> Fragment F1b could not be amplified from neither genomic DNA nor PCR fragment. Amplification will be repeated using DMSO in the mix.

PCR Conditions F1b.W10.E

Reagent	DelH F1b	DelH F1b	DelH F1b	DelH F1b
Template	1 µl D. acidovorans glycerol stock	1 µl Fragment (19 ng/µl)	1 µl D. acidovorans glycerol stock	1 µl PCR Fragment (19 ng/µl)
Primer fw 10 µM	1 µl DelH_EcoRI_fw	1 µl DelH_EcoRI_fw	1 µl DelH_EcoRI_fw	1 µl DelH_EcoRI_fw
Primer rev 10 µM	1 µl DelH_f1_SalI_rev	1 µl DelH_f1_SalI_rev	1 µl DelH_f1_SalI_rev	1 µl DelH_f1_SalI_rev
Phusion Flash Ready Mix	10 µl	10 µl	10 µl	10 µl
ddH₂O	7 µl	7 µl	6 µl	6 µl
DMSO	-	-	1 µl	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	68 (touchdown -0.5°C)	5
	72	2:15 min
18	98	1
	68	5
	72	2:15 min
1	72	7 min
1	4	inf

Using hot start 98°C

Result

Expected band: 5 Kb

Fig.10.10 gel of amplified fragments (loaded 20 µL)
lane 1 2log ladder, lane 2 fragment 1, lane 3 fragment 2
excised band of lane 3; lane 2 had no band

Only PCR of fragment 19 ng/µl + DMSO was successful. Maybe there is another pale band at the second PCR of DelH F1b.

=> Repeat both PCRs.

Result

PCR using conditions F1b.W10.E was repeated.
Expected band: 5 Kb,Entire PCR mix was loaded.

Fig.10.12 gel of amplified fragments (loaded 20 µL)
l1/2: entire F1b, l3/4: older PCR of F1b, l5: 2log ladder, l6/7 BB
excised band of lane 6/7

Fig.10.11 gel of amplified fragments (loaded 20 µL)
l1/2: entire F1b, l3/4: older PCR of F1b, l5: 2log ladder, l6/7 BB
excised band of lane 6/7

PCR did not result in any fragments. Interestingly, both older PRCs resulted in a fragment at ~5 Kb and other lines, but the fragment from the genomic DNA is slightly larger.

=> Both fragments were cut and gel isolated, check correct length of F1b!

=> Perform PCR from the PCR fragment obtained from the genomic DNA.

Amplification of DelH F2

PCR Conditions F2.W10.C

2x 50 µl

Reagent	DelH F2
Template	1 µl Fragment "BackUP"
Primer fw 10 µM	2.5 µl DelH_f2_SalI_fw
Primer rev 10 µM	2.5 µl DelH_f2_KpnI_rev
Phusion Flash Ready Mix	25 µl
ddH₂O	19 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	66 decrease by 0.5	5
	72	2:30 min
18	98	1
	66	5
	72	2:30 min
1	72	7 min
1	4	inf

Result

Expected band: 8 Kb

Fig.10.9 gel of amplified fragments (loaded 20 µL)
lane 1 2log ladder, lane 2 fragment 1, lane 3 fragment 2
excised band of lane 3; lane 2 had no band

Fragment 2 was successfully amplified.

=> It was cut and gel purified.

Preparation of new Template DNA

D. acidovorans glycerol stock was streaked onto LB plates and incubated ON at 37°C.
D. acidovorans did not grow, since LB media is not appropriate for them. Prepare new ACM media and plates and streak D. acidovorans.

Amplification of Backbone

PCR Conditions BB.W10.D

2x 50 µl

Reagent	Backbone
Template	1 µl Fragment "BackUP"
Primer fw 10 µM	2.5 µl AraCbb_KpnI_fw
Primer rev 10 µM	2.5 µl AraCbbPacI_rev2
Phusion Flash Ready Mix	25 µl
ddH₂O	19 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	66 decrease by 0.5	5
	72	2:30 min
18	98	1
	66	5
	72	2:30 min
1	72	7 min
1	4	inf

Result

Expected band: 7.3 Kb

Fig.10.13 gel of amplified fragments (loaded 20 µL)
lane 1 2log ladder, lane 2 fragment 1, lane 3 fragment 2
excised band of lane 3; lane 2 had no band

No band visible.

=> Repeat using DMSO.

PCR Conditions BB.W10.E

Reagent	Backbone	Backbone	Backbone
Template	1 µl of BackUP	1 µl V+A 2,2 ng/µl template	1 µl V+A 2,2 ng/µl template
Primer fw 10 µM	1 µl AraCbb_KpnI_fw	1 µl AraCbb_KpnI_fw	1 µl AraCbb_KpnI_fw
Primer rev 10 µM	1 µl AraCbbPacI_rev2	1 µl AraCbbPacI_rev2	1 µl AraCbbPacI_rev2
Phusion Flash Ready Mix	10 µl	10 µl	10 µl
ddH₂O	7 µl	7 µl	6 µl
DMSO	-	-	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	66 decrease by 0.5	5
	72	2:30 min
18	98	1
	66	5
	72	2:30 min
1	72	7 min
1	4	inf

Using hot start (in new cycler)

Result

Expected band: 7.3 Kb

Fig.10.10 gel of amplified fragments (loaded 20 µL)
l1-3:F1b, l4: 2log ladder, l5-7: BB
BB was not amplified

Gel does not show the expected fragment.

=> Next PCR for the Backbone should be done with longer elongation time and variations: think about using the a new colony of plate.

PCR Conditions BB.W10.F

Reagent	Backbone	Backbone	Backbone	Backbone
Template	1 µl Fragment 24 ng/µl	1 µl of Fragment pSB6A1 gel-purified 3-6 89 ng/µl	1 µl of digested Fragment 3-7 -11 ng/µl	1 µl of purified Fragment Isoprop 2.2 ng/µl
Primer fw 10 µM	1 µl DelH_f2_SalI_fw	1 µl AraCbb_KpnI_fw	1 µl DelH_f2_SalI_fw	1 µl AraCbb_KpnI_fw 1
Primer rev 10 µM	1 µl DelH_f2_KpnI_rev	1 µl AraCbbPacI_rev2	1 µl DelH_f2_KpnI_rev	1 µl AraCbbPacI_rev2
Phusion Flash Ready Mix	10 µl	10 µl	10 µl	10 µl
ddH₂O	7 µl	7 µl	7 µl	7 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	66 decrease by 0.5	5
	72	180
18	98	1
	66	5
	72	180
1	72	7 min
1	4	inf

Result

Expected band: 7.3 Kb,Entire PCR mix loaded (pSB6A1-AraC-lacZ)

Fig.10.12 gel of amplified fragments (loaded 20 µL)
l1/2: entire F1b, l3/4: older PCR of F1b, l5: 2log ladder, l6/7 BB
excised band of lane 6/7

Fig.10.11 gel of amplified fragments (loaded 20 µL)
l1/2: entire F1b, l3/4: older PCR of F1b, l5: 2log ladder, l6/7 BB
excised band of lane 6/7

Only PCRs from Fragment 24 ng/µl and Fragment 3-6 produced a nice fragment.

=> Bands were cut and gel isolated.

=> PCR amplification from restriction digested fragment did not work! This is unexpected, because actually, it should. Maybe exclude the previous restriction digested fragments "V+A" from ligation.

Preparation of new Template DNA

psB6A1-LacZ-AraC: 2 ml LB Amp were inocculated from the plate and incubated ON at 28°C (all other shakers occupied).
Mini prep was performed.
1 µl mini prep DNA was electroporated into E.coli DH10ß according to Electroporation of E. coli DH10β

Overview
Lab book

Gibson Strategy

PCR amplification of entire 18 Kb DelH fragment G0, as well as sub fragments G1a and G1b
PCR amplification of backbone pSB6A1-lacI-mRFP, simultaneously inserting Gibson
Gibson assembly of construct DelH + backbone to DelH plasmid
Electroporation of E. coli TOP10 with DelH plasmid
Characterization of positive (red) colonies by colony PCR

Vector Map and Primers

Vector map of the pHM02:DelH-pSB6A1-AraC-lacZ Gibson-plasmid.

Identifier	Order Date	Note	Sequence
HM02_DelH_Gib1.1_rev	09-07-2013	Gibson-Primer DelH	TGCTGCGCCTGCATACGGCCAAACA
HM03_DelH_Gib1.2_fw	09-07-2013	Gibson-Primer DelH	AGCGGCAGGGACGACGTGGT
HM04_DelH_Gib1.2_rev	09-07-2013	Gibson-Primer DelH	CATAGAGGTTGTAGAGA
HM05_DelH_Gib2.1_fw	09-07-2013	Gibson-Primer DelH	AGAACGCCGTCTTCAGGCTCCTG
HM06_DelH_Gib2.1_rev	09-07-2013	Gibson-Primer DelH	CAATGCTTTG CCGCTCGAA
HM07_DelH_Gib2.2_fw	09-07-2013	Gibson-Primer DelH	TCGCCACGGCAGCTGTTCGA
HM08_DelH_Gib2_end_rev	09-07-2013	Gibson-Primer DelH	TCAGTCCAGCGCGTACTCCAG
HM09_AraC_RBS_DelH_rev	09-07-2013	Gibson-Primer rev, introduces a new RBS and has the AraC promotor and the beginning of DelH	TTGCAAAGCGCTCGGCGATTTGGCGCAGGCGGCCACGGTCCAT ttaactTTCTCCTCTTTAATactttgagctagcccaaAaaaacggtatggagaa acagtagagagtt
HM10_RBS_lacZ	09-07-2013	Gibson-Primer fw for the pSB6A1 Backbone with the end of DelH, RBS(1) and the beginning of lacZ	TGGAGTACGCGCTGGACTGA TCTAGAG AAAGAGGAGAAA TACTAG ATGACCATGATTA

08-07 - 14-07-13

Amplification of DelH F1b

PCR Conditions F1b.W11.A

Reagent	DelH F1b - from purified F1b 05-07 (genome amplified)	DelH F1b - from purified F1b 05-07 (genome amplified)
Template	1 µl of PCR 1b (19 ng/µl)	1 µl D. acidovorans
Primer fw 10 µM	1 µl DelH_EcoRI_fw	1 µl DelH_EcoRI_fw
Primer rev 10 µM	1 µl DelH_f1_SalI_rev 10	1 µl DelH_f1_SalI_rev
Phusion Flash Ready Mix	10 µl	10 µl
ddH₂O	7 µl	6 µl
DMSO	-	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	68	5
	72	2:15 min
1	72	7 min
1	4	inf

Result

Expected band: 5 Kb

Fig.11.1 gel of amplified fragment F1B(loaded 20 µL)
l1:F1b without DMSO, l2: 2log ladder, l3: F1b with DMSO

There is a specific band, but not at 5 Kb.

=> We cannot amplify F1b from a PCR fragment. Use fresh bacteria instead.

Preparation of fresh ACM media

Mix ingrediants according to Acidovorax complex medium
Autoclave
pH adjust to 7,3
Mix 500 ml media and 6 g agar
Autoclave again
Pour plates

Preparation of fresh D. acidovorans

Inocculate 5 ml ACM media with D. acidovorans
Incubate ON
Prepare glycerol stock
Streak some of culture on plates

PCR Conditions F1b.W11.B

Reagent	DelH F1b	DelH F1b
Template	Fresh colony of plate by DN from 10-07	Fresh colony of plate by DN from 10-07
Primer fw 10 µM	1 µl delH_EcoRI_fw	1 µl delH_EcoRI_fw
Primer rev 10 µM	1 µl delH_f1_SalI_rev	1 µl delH_f1_SalI_rev
Phusion Flash Ready Mix	10 µl	10 µl
ddH₂O	7 µl	6 µl
DMSO	-	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	68 (touchdown -0.5°C)	5
	72	2:30 min
18	98	1
	68	5
	72	2:30 min
1	72	10 min
1	4	inf

Result

Expected band: 5.4 Kb

Fig.11.2 gel of amplified fragment 1B(loaded 20 µL)
l1:F1b without DMSO, l2: 2log ladder, l3: F 1b with DMSO
l3 shows a slight band at 5 Kb

There is a weak band at the probe 1b WITH DMSO above 5 Kb.

=> Start a new PCR with 50 µl with the same conditions.

PCR Conditions F1b.W11.C

Reagent	DelH 1b
Template	Fresh colony of plate by DN from 10-07
Primer fw 10 µM	2.5 µl delH_EcoRI_fw
Primer rev 10 µM	2.5 µl delH_f1_SalI_rev
Phusion Flash Ready Mix	25 µl
ddH₂O	17.5 µl
DMSO	2.5 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	68 (touchdown -0.5°C)	5
	72	2:30 min
18	98	1
	68	5
	72	2:30 min
1	72	10 min
1	4	inf

Result

Expected band: 5 Kb.

Fig.11.4gel of amplified fragment 1B(loaded 50 µL)
l1:2log ladder, l2-4: F 1b with DMSO
l2-4 band at 5 Kb was cut out

Fig.11.3 gel of amplified fragment 1B (loaded 50 µL)
l1:2log ladder, l2-4: F 1b with DMSO
l2-4 show expected band at 5 Kb and another lower band

The expected band at 5 Bk is weak, but visible. Note that there is sample left in the pocket.

=> The fragment was cut and gel extracted.

Generation of DelH plasmid

Restriction Digest

Of fragments F1a, F1b, F2 and backbone.

Fragment	DNA [µl]	ddH₂O [µl]	Enzymes [µl]	BSA [µl]	Buffer 4 [µl]
F1a (1)	30	7	1.5 Pac & EcoRI-HF each	5	5
F1a (2)	30	7	1.5 Pac & EcoRI-HF each	5	5
F1b (11.7 - 20 µl)	20	17	1.5 SalI-HF & EcoRI-HF each	5	5
F1b (11.7 - 50 µl)	20	17	1.5 SalI-HF & EcoRI-HF each	5	5
F2	20	17	1.5 SalI-HF & KpnI-HF each	5	5
BB (6-7 of IK - 14 ng/µl)	20	17	1.5PacI & KpnI-HF each	5	5
BB (6-7)	20	17	1.5 PacI & KpnI-HF each	5	5

Result

Loaded 5 µl of restriction digested fragments on gel. The result stands in the table below:

Fragment	Band	Conclusion	Next step
F1a purified on 12-07	strong bands at 1, 2 and 3 Kb weak band at wanted 5 KB	PCR purification of F1a step was not the right purifying step	load complete probe on gel and gel extract
F1b purified on 12-07	weak band at 5 Kb	maybe only low concentration	run PCR again
F2	no band	maybe too low concentration	run PCR again
BB	weak band at 7.4 Kb	maybe only low concentration	run PCR again

Gel Extraction of DelH F1a

Expected band: 5 KB, loaded entire F1a purified on 12-07 on gel

Fig.11.5gel of PCR of DelH-fragments (loaded 20 µL)
l1:F1a,l2:2log, l3: F1b, l4:F2, l5: BB

No band visible.

=> Gel extract earlier PCR from 06-07.

Expected band: 5 Kb

Fig.11.6gel of minipreped and PCR-amplified DelH fragments (loaded 20 µL)
l1:F1a,l2:2log, l3: Miniprep of BB (pSB6A1), l4:PCR of BB (pSB6A1)

PCR shows expected band.

=> F1a was cut and gel extracted.

Amplification of DelH F1b

PCR Conditions F1b.W11.D

Reagent	DelH F1b
Template	1 µl F1b digested 12-07
Primer fw 10 µM	1 µl delH_EcoRI_fw
Primer rev 10 µM	1 µl delH_f1_SalI_rev
Phusion Flash Ready Mix	10 µl
ddH₂O	6µl
DMSO	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	68 (touchdown -0,5°C)	5
	72	2:30 min
18	98	1
	68	5
	72	2:30 min
1	72	10 min
1	4	inf

Result

Expected band: 5.4 Kb

Fig.11.7gel of PCR of DelH-fragments (loaded 20 µL)
l1:F1a,l2:2log, l3: F1b, l4:F2, l5: BB

PCR did not yield the specific band.

=> Use altered PCR conditions.

Amplification of DelH F2

PCR Conditions F2.W11.A

Reagent	DelH F2
Template	1 µl F2 digested 12-07
Primer fw 10 µM	1 µl delH_f2_SalI_fw
Primer rev 10 µM	1 µl delH_f2_KpnI_rev
Phusion Flash Ready Mix	10 µl
ddH₂O	7 µl

Cycles	Temperature [°C]	Time
1	98	5 s
30	98	1 s
	66	5 s
	72	3:00 min
1	72	10 min
1	4	inf

Result

Expected band: 8 Kb

Fig.11.7Gel of PCR of DelH fragments (loaded 20 µL)
l1:F1a,l2:2log, l3: F1b, l4:F2, l5: BB

PCR does not show the specific band.

=> Further optimization.

Amplification of Backbone

PCR Conditions BB.W11.A

Reagent	Backbone
Template	1 µl backbone digested 12-07
Primer fw 10 µM	1 µl AraCbb_KpnI_fw
Primer rev 10 µM	1 µl AraCbb_PacI_rev2 10
Phusion Flash Ready Mix	10 µl
ddH₂O	7 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	66	5
	72	3:00 min
1	72	10 min
1	4	inf

Result

Expected band: 8 Kb

Fig.11.7Gel of PCR of DelH fragments (loaded 20 µL)
l1:F1a,l2:2log, l3: F1b, l4:F2, l5: BB

PCR does not show the specific band.

=> Repeat using fresh backbone DNA from miniprep.

Miniprep

Inocculation of 10 ml LB Amp with DH10ß (pSB6A1-AraC-lacZ)
Perform mini prep

PCR Conditions BB.W11.B

Reagent	Backbone
Template	1 µl Miniprep A of 10-07
Primer fw 10 µM	1 µl AraCbb_KpnI_fw
Primer rev 10 µM	1 µl AraCbb_PacI_rev2
Phusion Flash Ready Mix	10 µl
ddH₂O	7 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	66 (touchdown -0.5°C)	5
	72	3:00 min
18	98	1
	66	5
	72	3:00 min
1	72	10 min
1	4	inf

Results

Expected band: 7.4 Kb, loaded miniprep and PCR product.

Fig.11.8gel of PCR of DelH-fragments (loaded 20 µL)
l1:F1a,l2:2log, l3: Miniprep A of BB, l4:PCR of BB

Miniprep shows weak band at ~7.4 Kb. PCR does not show expected band.

=> Prepare new mediprep of backbone (pSB6A1-AraC-lacZ)

Gibson Assembly Strategy

Vector map of the pHM02:DelH-pSB6A1-AraC-lacZ Gibson-plasmid.

Identifier	Order date	Note	Sequence
DN01:DelH_f1_PacI_fw	03-05-2013	Amplification of DelH F1, with RBS and adding PacI restriction site	TTTT TTAATTAA TCACACAGGAAAGTACTAG ATGGACCGTGGCCGCCTGC GCCAAATCG
DN02:DelH_f1_SalI_rev	03-05-2013	Amplification of DelH F1 until SalI restriction site	TTTT GTCGACCAACACCTGTGCCTGC
DN03:DelH_f2_SalI_fw	03-05-2013	Amplification of DelH F2 starting at SalI restriction site	TTTT GTCGACTGGATGGAGCCTGGTGAAAG
DN04:DelH_f2_KpnI_rev	03-05-2013	Amplification of DelH F2, adding KpnII restriction site	TTTT GGTACC TCAGTCCAGCGCGTACTCCAG
DN05:AraCbb_KpnI_fw	03-05-2013	Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding KpnI site	TTTT GGTACC AAAAGAGGAGAAATACTAGATGACCATG
DN08:AraCbb_PacI_rev	03-05-2013	Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding PacI site	TTTT TTAATTAA GCTAGCCCAAAAAAACGGGTATG

Lab book

15-07 - 21-07-13

Preparation of Primers

All primers were 1:10 diluted
Overview on annealing temperatures

Primer	short2	HM02	HM03	HM04	HM05	HM06	HM07	HM08	HM09	HM10
Annealing temperature [°C]	63	72.6	69.1	55.2	68.2	66.4	69.6	65.2	51.6 / 73.6	60.9 / 71.3

Preparation of fresh D. acidovorans

Liquid culture: 2x 5 ml ACM medium was inocculated with picked colonies of D. acidovorans from plate (made by DN)
Glycerol stock: was prepared from liquid culture

Amplification of DelH G1

PCR Conditions G1.W12.A

Reagent	DelH G1	DelH G1
Template	Fresh colony of plate (by DN)	Fresh colony of plate (by DN)
Primer fw 10 µM	short2	short2
Primer rev 10 µM	HM04	HM04
Phusion Flash Ready Mix	10 µl	10 µl
ddH₂O	7 µl	6 µl
DMSO	-	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	63 (touchdown -0.5°C)	5
	72	3:30 min
18	98	1
	63	5
	72	3:30 min
1	72	10 min
1	4	inf

Result

Expected band: 8.961 Kb

Fig.12.1gel of PCR of DelH-fragments (loaded 20 µL)
l1:F1 without DMSO,l2:F1 with DMSO, l3:2log ladder, l4: F2 without DMSO, l5: F2 with DMSO

No bands visible.

=> Fragment 1 was not amplified. Next step is amplifying fragment 1 in two parts G1a & G1b.

Amplification of DelH G1a

PCR Conditions G1a.W12.A

Reagent	DelH G1a	DelH G1a
Template	Fresh colony of plate (by DN)	Fresh colony of plate (by DN)
Primer fw 10 µM	short2	short2
Primer rev 10 µM	HM02	HM02
Phusion Flash Ready Mix	10 µl	10 µl
ddH₂O	7 µl	6 µl
DMSO	-	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	63 (touchdown -0.5°C)	5
	72	3:30 min
18	98	1
	64	5
	72	3:30 min
1	72	10 min
1	4	inf

Result

Expected Band: 4.309 Kb

Fig.12.3gel of PCR of DelH-fragments (loaded 20 µL)
l1:F1a without DMSO,l2:F1a with DMSO, l3:F16 without DMSO at an anealing temperature 64°C,l5:F16 with DMSO at an anealing temperature 64°C,l6:1b-57 (without DMSO), l7: 1b-57 (with DMSO),l9 2 loga ladder,l10 Mediprep A of BB,l11 Mediprep B of BBF1a with DMSO

Fig.12.2gel of PCR of DelH-fragments (loaded 20 µL)
l1:F1a without DMSO,l2:F1a with DMSO, l3:F16 without DMSO at an anealing temperature 64°C,l5:F16 with DMSO at an anealing temperature 64°C,l6:1b-57 (without DMSO), l7: 1b-57 (with DMSO),l9 2 loga ladder,l10 Mediprep A of BB,l11 Mediprep B of BBF1a with DMSO

PCR using DMSO looks well.

=> Fragment was cut and gel extracted.

Amplification of DelH G1b

PCR Conditions G1b.W12.A and B

Reagent	DelH G1b	DelH G1b
Template	Fresh colony of plate (by DN)	Fresh colony of plate (by DN)
Primer fw 10 µM	HM03	HM03
Primer rev 10 µM	HM04	HM04
Phusion Flash Ready Mix	10 µl	10 µl
ddH₂O	7 µl	6 µl
DMSO	-	1 µl

Cycles	Temperature A [°C]	Time [s]	Cycles	Temperature B [°C]	Time [s]
1	98	5	1	98	5
30	98	1	30	98	1
	64	5		57	5
	72	2:15 min		72	2:15 min
1	72	7 min	1	72	7 min
1	4	inf	1	4	inf

Result

Expected Band: 4.711 Kb

Fig.12.3gel of PCR of DelH-fragments (loaded 20 µL)
l1:F1a without DMSO,l2:F1a with DMSO, l3:F16 without DMSO at an anealing temperature 64°C,l5:F16 with DMSO at an anealing temperature 64°C,l6:1b-57 (without DMSO), l7: 1b-57 (with DMSO),l9 2 loga ladder,l10 Mediprep A of BB,l11 Mediprep B of BBF1a with DMSO

Fig.12.2gel of PCR of DelH-fragments (loaded 20 µL)
l1:F1a without DMSO,l2:F1a with DMSO, l3:F16 without DMSO at an anealing temperature 64°C,l5:F16 with DMSO at an anealing temperature 64°C,l6:1b-57 (without DMSO), l7: 1b-57 (with DMSO),l9 2 loga ladder,l10 Mediprep A of BB,l11 Mediprep B of BBF1a with DMSO

PCR using DMSO at an annealing temperature od 57°C looks fine.

=> Fragment was cut and gel extracted.

Amplification of DelH G2

PCR Conditions G2.W12.A

Reagent	DelH G2	DelH G2
Template	Fresh colony of plate (by DN)	Fresh colony of plate (by DN)
Primer fw 10 µM	2 µl HM05	2 µl HM05
Primer rev 10 µM	2 µl HM08	2 µl HM08
Phusion Flash Ready Mix	10 µl	10 µl
ddH₂O	8 µl	7 µl
DMSO	-	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	68 (touchdown -0.5°C)	5
	72	3:30 min
18	98	1
	67	5
	72	3:30 min
1	72	10 min
1	4	inf

Result

Expected band: 9.611 Kb

Fig.12.1gel of PCR of DelH-fragments (loaded 20 µL)
l1:F1 without DMSO,l2:F1 with DMSO, l3:2 log ladder,l4:F2 (without DMSO), l5: F2 (with DMSO)

Expected band is visible.

=> Fragment G2 was amplified with DMSO. Band was cut and gel extracted.

PCR Conditions G2.W12.B

Reagent	DelH G2
Template	Fresh colony of plate (by DN)
Primer fw 10 µM	2.5 µl HM05
Primer rev 10 µM	2.5 µl HM08
Phusion Flash Ready Mix	25 µl
ddH₂O	17.5 µl
DMSO	2.5 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	68 (touchdown -0.5°C)	5
	72	3:30 min
18	98	1
	67	5
	72	3:30 min
1	72	10 min
1	4	inf

Result

Expected band: 9.611 Kb

Fig.12.4gel of PCR of DelH-fragments (loaded 20 µL)
l1:PCR of Indigoidine,l2:2 log ladder, l3-4:G1b
l3-4 showed expected band at 9.6 Kb = was cut out

Gel shows nice band at expected length.

=> G2 was also amplified in 50 µl and was cut and gel extracted.

Amplification of DelH G0

PCR Conditions G0.W12.A

Reagent	DelH G0
Template	1 µl of glycerol stock
Expected length [Kb]	18.521
Primer fw 10 µM	2.5 µl short2
Primer rev 10 µM	2.5 µl HM08
Phusion Flash Ready Mix	10 µl
ddH₂O	5 µl
DMSO	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	3:30 min
1	72	10 min
1	4	inf

Result

Expected band: 18.521 Kb

Fig.12.6gel of PCR of DelH-fragments (loaded 20 µL)
l1-4:DelH G0-G3 (18 Kb),l5:2 log ladder

Fig.12.5gel of PCR of DelH-fragments (loaded 20 µL)
l1-4:DelH G0-G3 (18 Kb),l5:2 log ladder

Gel shows expected band at ~18 Kb.

=> Fragment G0 was cut and gel isolated. Repeat PCR to increase yield.

Result

Three 20 µl reactions were performed to increase yield of fragment G0.
Expected band: 18.521 Kb

Fig.12.8gel of PCR of DelH-fragments (loaded 20 µL)
l1-4:DelH G0-G3 (18 Kb),l5:2 log ladder

Fig.12.7gel of PCR of DelH-fragments (loaded 20 µL)
l1-4:DelH G0-G3 (18 Kb),l5:2 log ladder

Gel shows expected band at ~18 Kb.

=> Fragment G0 was cut and gel isolated.

Amplification of DelH G1/2a

PCR Conditions G1/2a.W12.A

Reagent	DelH G1/2a
Template	1 µl of glycerol stock
Expected length [Kb]	13.083
Primer fw 10 µM	2.5 µl short2
Primer rev 10 µM	2.5 µl HM06
Phusion Flash Ready Mix	10 µl
ddH₂O	5 µl
DMSO	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	4:45 min
1	72	10 min
1	4	inf

Result

Expected band: 13.083 Kb

Fig.12.6gel of PCR of DelH-fragments (loaded 20 µL)
l1-4:DelH G0-G3 (18 Kb),l5:2 log ladder

Fig.12.5gel of PCR of DelH-fragments (loaded 20 µL)
l1-4:DelH G0-G3 (18 Kb),l5:2 log ladder

Gel shows expected band at ~13 Kb.

=> Fragment G1/2a was cut and gel isolated.

Amplification of DelH G1b/2

PCR Conditions G1b/2.W12.A

Reagent	DelH G1b/2
Template	1 µl of glycerol stock
Expected length [Kb]	14.271
Primer fw 10 µM	2.5 µl HM03
Primer rev 10 µM	2.5 µl HM08
Phusion Flash Ready Mix	10 µl
ddH₂O	5 µl
DMSO	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	3:30 min
1	72	10 min
1	4	inf

Result

Expected band: 14.271 Kb

Fig.12.6gel of PCR of DelH-fragments (loaded 20 µL)
l1-4:DelH G0-G3 (18 Kb),l5:2 log ladder

Fig.12.5gel of PCR of DelH-fragments (loaded 20 µL)
l1-4:DelH G0-G3 (18 Kb),l5:2 log ladder

Gel shows expected band at ~14 Kb.

=> Fragment G1b/2 was cut and gel isolated.

Amplification of DelH G1b/2a

PCR Conditions G1b/2a.W12.A

Reagent	DelH G1b/2a
Template	1 µl of glycerol stock
Expected length [Kb]	14.271
Primer fw 10 µM	2.5 µl HM03
Primer rev 10 µM	2.5 µl HM06
Phusion Flash Ready Mix	10 µl
ddH₂O	5 µl
DMSO	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	3:30 min
1	72	10 min
1	4	inf

Result

Expected band: 14.271 Kb

Fig.12.6gel of PCR of DelH-fragments (loaded 20 µL)
l1-4:DelH G0-G3 (18 Kb),l5:2 log ladder

Fig.12.5gel of PCR of DelH-fragments (loaded 20 µL)
l1-4:DelH G0-G3 (18 Kb),l5:2 log ladder

Gel shows multiple bands, it is not clear, which one is correct.

=> Optimize temperatures.

Amplification of DelH G2b

PCR Conditions G2b.W12.A

Reagent	DelH G2b
Template	1 µl of glycerol stock
Expected length [Kb]	5
Primer fw 10 µM	2.5 µl HM07
Primer rev 10 µM	2.5 µl HM08
Phusion Flash Ready Mix	10 µl
ddH₂O	5 µl
DMSO	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	68	5
	72	2:00 min
1	72	5 min
1	4	inf

Result

Expected band: 5 Kb

Fig.12.8gel of PCR of DelH-fragments and restriction digest (loaded 20 µL)
l1-3:DelH G0(18 Kb),l5:1 Kb+ ladder, l5:Midiprep A digested with PstI & BamHI,l6:Midiprep A digested with SalI & BamHI, l7:Midiprep B digested with PstI & BamHI,l8:Midiprep B digested with SalI & BamHI, l9: 2 log ladder, l10: fragment of DelH - G3b

Fig.12.7gel of PCR of DelH-fragments and restriction digest (loaded 20 µL)
l1-3:DelH G0(18 Kb),l5:1 Kb+ ladder, l5:Midiprep A digested with PstI & BamHI,l6:Midiprep A digested with SalI & BamHI, l7:Midiprep B digested with PstI & BamHI,l8:Midiprep B digested with SalI & BamHI, l9: 2 log ladder, l10: fragment of DelH - G3b

Amplification of Backbone pSB6A1-AraC-lacZ

Test Restriction Digest of Midiprep

Midiprep	A	A	B	B
Enzymes	BamHI & Pst	BamHI & SalI	BamHI & PstI	BamHI & SalI
Wanted fragments [Kb]	3.317 & 4.071	3.794 & 3.594	3.317 & 4.071	3.794 & 3.594
Fragments present	1 band at ~6-7 Kb	3 bands: one bright one at ~4-5 Kb and two smaller ones at ~6 Kb and ~10 Kb	1 band at ~6-7 Kb	3 bands: one bright one at ~4-5 Kb and two smaller ones at ~6 Kb and ~10 Kb

Fig.12.8gel of PCR of DelH-fragments and restriction digest (loaded 20 µL)
l1-3:DelH G0(18 Kb),l5:1 Kb+ ladder, l5:Midiprep A digested with PstI & BamHI,l6:Midiprep A digested with SalI & BamHI, l7:Midiprep B digested with PstI & BamHI,l8:Midiprep B digested with SalI & BamHI, l9: 2 log ladder, l10: fragment of DelH - G3b

Fig.12.7gel of PCR of DelH-fragments and restriction digest (loaded 20 µL)
l1-3:DelH G0(18 Kb),l5:1 Kb+ ladder, l5:Midiprep A digested with PstI & BamHI,l6:Midiprep A digested with SalI & BamHI, l7:Midiprep B digested with PstI & BamHI,l8:Midiprep B digested with SalI & BamHI, l9: 2 log ladder, l10: fragment of DelH - G3b

=> Don't trust the BB, because between 3 and 4 Kb there is no band. Backbone will be send for sequencing

=> Repeat entire cloning again?

Amplification of Backbone pSB6A1-lacZ-mRFP

As discussed, we are going to use another backbone. It is already in the parts registry: pSB6A1 + BBa_J04450 from Spring distribution 2012 (plate 1, well K1).

Transformation in E. coli TOP10

Chemical transformation of 3 µl of the plasmid
Incubation on ice, 15 min
Heat shock 42°C, 40 s
Incubation on ice again
Resuspended in 500 µl LB Amp for 30 min
Centrifuged (120, 5,000 rpm), removal of supernatant
Plated on LB Amp plate
Incubation ON at 37°C

Overview
Lab book

Vector Map and Primers

Vector map of the File:Heidelberg PSB6A1+DelH.gb.

Identifier	Order date	Note	Sequence
HM_11:lacI_RBS(1)_DelH_rev	22-07-2013	Amplification of Backbone pSb6A1-lacZ-mRFP	TCGGCGATTTGGCGCAGGCGGCCACGGTCCAT ctagtatttctcctctttctctagtatgtgtg
HM_12:DelH_RBS(1.2)_mRFP_fw	22-07-2013	Amplification of Backbone pSb6A1-lacZ-mRFP	ATTGGCGCTGGAGTACGCGCTGGACTGA tcaaagtATTAAAGAGGAGAAagttaaat ggcttcctccgaagacgttatcaAagag

22-07 - 28-07-13

Amplification of Backbone pSB6A1-lacZ-mRFP

Miniprep

4 colonies were picked and inoculated in 4x 3 ml LB Amp
Incubated ON at 37°C
4x 3 ml were distibuted in 5x 2 ml eppis and centrifuged
Supernatant was discarded, cell pellet was used for miniprep
Two minipreps were pooled into 1 column and 180ipreps on another one (every eluation was performed with 50 µl)

Result

5 µl were loaded on a gel

=> Gel was not succesful

=> Miniprep didn't work and has to be repeated

Glycerol Stock

Glycerol stocks were prepared from liquid culture not used for miniprep.

Repetiotion of Miniprep

4x 2 ml of Top10 pSB6A1-lacZ-mRFP were minipreped with the Qiagen kit.

Result

Sample	Performed	Concentration (Nanovue)	P2 Buffer
pSB6A1-lacI-mRFP (1)	upstairs	88 ng/µl	from upstairs
pSB6A1-lacI-mRFP (2)	iGEM lab	62 ng/µl	new
pSB6A1-lacI-mRFP (3)	iGEM lab	104 ng/µl	new
pSB6A1-lacI-mRFP (4)	iGEM lab	60 ng/µl	old

Of each miniprep, 3 µl were loaded

Fig.13.1 Analytical gel for checking concentration of purified BB (PSB6A1-lacI-mRFP) (loaded 3 µL of PCR)
l1 2log ladder l2: pSB6A1-lacI-mRFP
bands at 5 Kb = is ok, because BB is not linear

At 3Kb and at 8 Kb, there are bands visible.

=> Minipreps are fine.

PCR Conditions BB.W13.A

Reagent	Backbone	Backbone
Template	Miniprep A	Miniprep A
Primer fw 10 µM	HM11	HM11
Primer rev 10 µM	HM12	HM12
Phusion Flash Ready Mix	10 µl	10 µl
ddH₂O	7 µl	7 µl
DMSO	-	-

Cycles	Temperature [°C]	Time [s]
1	98	10
12	98	1
	68 (touchdown - 0,5)	5
	72	1:15 min
18	98	1
	67	5
	72	1:15 min
1	72	5 min
1	4	inf

Result

Expected band: 5 Kb

Fig.13.3 gel of BB(PSB6A1-lacI-mRFP) (loaded 3 µL of PCR)
l1: BB amplified with HM11 & HM12, l2: BB amplified with HM11 & HM12,l3: 2log ladder
specific bands at 5 Kb on both lanes = was cut out

Fig.13.2 gel of BB(PSB6A1-lacI-mRFP) (loaded 3 µL of PCR)
l1: BB amplified with HM11 & HM12, l2: BB amplified with HM11 & HM12,l3: 2log ladder
specific bands at 5 Kb on both lanes = BB is ok

Specific expected band at 5 Kb

=> Fragment was cut and gel isolated. A: 22 ng/µl, B: 25 ng/µl

Generation of DelH Plasmid 26-07

Analysis of G0, G1 & G2b on Gel

Fig.13.4 analyse-gel for checking concentration of DelH fragments (loaded 3 µL of PCR)
l1 1Kb+ ladder l2: G0 complete DelH-fragment (DN11 & HM08), l3 G1/2a DelH-fragment (DN11 & HM06), l4: G2b DelH-fragment (DHM07 & HM08)
all bands are as expected = result shown in table below

Fragment	Size	Amount used [µl]	Amount used [ng] (by view)	Left for Gibson [µl] = [ng]	Concentration [ng/µl]
G0	18 Kb	8	5	52 = 35.5	0.68
G1	14 Kb	8	10	12 = 15	1.25
G2b	5 Kb	8	10	12 = 15	1.25

Overview on Fragments

Fragment	Concentration [ng/µl]
G0	0.68
G1	1.25
G2b	1.25
BB A	22
BB B	25

Gibson Assembly

Assembly #	Fragments	Amount used [µl]
1	G0 BB A	9.5 0.5
2	G0 BB A	8 2
3	1 G2b BB A	7 2.5 0.5

Incubated 1 hour at 50°C
Stored ON at -20°C

Purification of Gibson Mix

Purification performed with the long range gel extraction kit (because of 23 Kb size) of the entire sample (20 µl).
Performed the purification by calculating with 100 mg DNA (gel- step1)
Washing step with QX1 was not performed, because it is only to remove the residual agarose and we don't want to loose any DNA.

Electroporation

Electroporation into freshly prepared electrocompetent cell following the protocol
Streaked on LB Amp plates and incubated ON at 37°C

Result

There were no colonies on any of the plates. Ginson assembly and electroporation have to be repeated.

Generation of DelH Plasmid 28-07

NEB Protocol for Gibson Assembly

Optimized cloning efficiency is 50–100 ng of vectors with 2–3 fold of excess inserts. Use 5 times more of inserts if size is less than 200 bps. Optimized cloning efficiency is 50-100 ng of vectors with 2-3 fold of excess inserts. Use 5 times more of inserts if size is less than 200 bps.
Electrocompetent Cells Transformation Protocol:

Thaw electrocompetent cells on ice.
Transfer 50 μl of electrocompetent cells to a pre-chilled electroporation cuvette with 1 mM gap.
Dilute assembled products 3-fold with H2O prior electroporation. This can be achieved by mixing 5 μl of assembled products with 10 μl of H2O. Add 1 μ l of the diluted assembly product to electrocompetent cells.Mix gently by pipetting up and down or flicking the tube 4–5 times. Do not vortex. Place the mixture on ice for 30 minutes. Do not mix.
Mix gently by pipetting up.
Once DNA is added to the cells, electroporation can be carried out immediately. It is not necessary to incubate DNA with cells.Add 950 μl of room temperature SOC media* to tubes.
Add 950 μl of room temperature SOC media to the cuvette immediately after electroporation.
Place the tube at 37°C for 60 minutes. Shake vigorously (250 rpm) or rotate.
Warm selection plates to 37°C.
Spread 100 μl of the cells onto the plates.
Incubate overnight at 37°C.

Gibson Assembly

Fragments	Concentraion [ng/µl]	Amount [µl]
G0	0.68	9
BB (8.8)	22	1
Gibson Master Mix	2x	10

Incubated 1 h at 37 °C in thermocycler
5 µl of mix added to 10 µl ddH₂O and stored at -20°C
10 µl stored for isoprop purification

Result

Remaining 5 µl were checked on a gel:
Expected band: 23 Kb

Fig.13.5 Analytical gel of backbone (pSB6A1-lacI-mRFP) and complete DelH fragment = G0 (loaded 5 µL of PCR)
l1:2log ladder, l2:BB,l3: G0
BB and DelH show the expected band at 18 Kb and 4.4 Kb

No product visible of correct size. There is a light band at ~1.5 Kb.

=> Most probably too little DNA loaded.

Electroporation

Electroporation into freshly prepared electrocompetent cell following the protocol
Streaked on LB Amp plates and incubated ON at 37°C

Result

There were few colonies on the plates. Red colonies were picked and screenied by colony-PCR, but none of them was positive. The Gibson assembly has to be repeated.

Preparation of Electrocompetent E.coli DH10ß

According to the protocol

Amplification of Backbone pSB6A1-lacZ-mRFP

Test Restriction Digest

Fragment	DNA [µl]	H₂O [µl]	Enzymes [µl]	Buffer 3.1 [µl]
BB A (22 ng/µl)	8 = 200 ng	9	NotI: 1	2

Incubated 1.5 h at 37 °C

Result

Expected bands: 4 Kb & 1 Kb

Fig.13.6test digest of Backbone (pSB6A1-lacZ-mRFP) (loaded 20 µL of PCR)
l1:2log ladder, l2:BB digested with NotI
digested BB show expected band at 4 Kb and 1 Kb => The backbone is ok.

Gel shows shows expeted bands at 4 Kb and 1 Kb.

=> Backbone is fine.

Lab book

29-07 - 04-08-13

Generation of DelH Plasmid 28-07

Purification of Gibson Mix

10 µl of the Gibson mix were isopropanol purified as described in the protocol.
5 µl of the Gibson reaction were mixed with 10 µl ddH₂O.

Electroporation

Electroporation into freshly prepared electrocompetent cell following the protocol.

E1	E2	E3
5 µl of Gibson + 10 µl H₂O	10 µl of isoprop purified Gibson assembly	no DNA

Grow 0.5 h with 400 µl SOC at 37°C
Add 9 ml LB Amp and incubate 3 h at 37°C
Incubate ON at 37°C on LB Amp plate as well as LB (no Amp) for control purposes

Result

There were few colonies on the plates. Red colonies were picked and screenied by colony-PCR, but none of them was positive. The Gibson assembly has to be repeated.

Generation of DelH Plasmid 01-08

Gibson Assembly

Fragment	Concentraion	Amount used [µl] (2 vials)	Amount used [µl]
G0	0,68 ng/µl	9	6
BB (8.8)	22 ng/µl	1	4
Gibson Master Mix	2x	10	10

Incubated 1 h at 50 °C in thermocycler

Electroporation

Electroporation #	Mix #	Amount of Mix [µl]	ddH₂O [µl]	Isopropanol	Amount electroporated [µl]
1	1	10	20	-	1
2	1	10	20	-	14
3	1	30	-	yes	20
4	2	5	10	-	1
5	2	5	10	-	29
6	2	15	-	yes	20
7	-	-	10	-	10

Plated on one LB agar plate each
Stored ON at 37°C

Colony-PCR Conditions CP.W14.A

Reagent	Electroporation 1	Electroporation 2	Electroporation 3	Electroporation 4	Electroporation 5	Electroporation 6
Expected length [bp]	663	663	663	663	663	663
Named	1	2	3	4	5	6
Template	5 colonies of E1	5 colonies of E2	5 colonies of E3	5 colonies of E4	5 colonies of E5	5 colonies of E6
Primer fw 10 µM	1 µl VF2	1 µl VF2	1 µl VF2	1 µl VF2	1 µl VF2	1 µl VF2
Primer rev 10 µM	1 µl Screen_delH_rev	1 µl Screen_delH_rev	1 µl Screen_delH_rev	1 µl Screen_delH_rev	1 µl Screen_delH_rev	1 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	8 µl	8 µl	8 µl	8 µl

Cycles	Temperature [°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
18	95	60
	65 (touchdown -0.5°C)	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.14.1 Gel of picked colonies with insert DelH-BB (loaded 20 µL of PCR)
l1: 1, l2: 2,l3: 3, l4: 2log,l5: 4, l6: 5,l7: 6
no bands = no colony positive

Gel does not show any band.

=> None of the analyzed colonies is positive.

Colony-PCR Conditions CP.W14.B

Picked 20 colonies per plate and 5 colonies per PCR tube.

Reagent	Electr. 1	Electr. 1	Electr. 1	Electr. 2	Electr. 2	Electr. 2	Electr. 2
Expected length [bp]	663	663	663	663	663	663	663
Named	1a	1b	1c	2a	2b	2c	2d
Template	5 colonies of E1	5 colonies of E1	5 colonies of E1	5 colonies of E2	5 colonies of E2	5 colonies of E2	5 colonies of E2
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6µl	6 µl	6 µl	6 µl	6 µl

Reagent	Electr. 3	Electr. 3	Electr. 3	Electr. 3	Electr. 4	Electr. 4	Electr. 4	Electr. 4
Expected length [bp]	663	663	663	663	663	663	663	663
Named	3a	3b	3c	3d	4a	4b	4c	4d
Template	5 colonies of E3	5 colonies of E3	5 colonies of E3	5 colonies of E3	5 colonies of E4	5 colonies of E4	5 colonies of E4	5 colonies of E4
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl	6 µl	6µl	6 µl	6 µl

Reagent	Electr. 5	Electr. 5	Electr. 5	Electr. 5	Electr. 6	Electr. 6	Electr. 6	Electr. 6
Expected length [bp]	663	663	663	663	663	663	663	663
Named	5a	5b	5c	5d	6a	6b	6c	6d
Template	5 colonies of E5	5 colonies of E5	5 colonies of E5	5 colonies of E5	5 colonies of E6	5 colonies of E6	5 colonies of E6	5 colonies of E6
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl

Cycles	Temperature DelH-G0 [°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
18	95	60
	65 (touchdown -0.5°C)	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.14.3 Gel of picked colonies with insert DelH-BB (loaded 20 µL of PCR)
l1: 2log, l2-5: 20 picked colonies from plate 4: every PCR tube has 5 colonies, l6-9:20 picked colonies from plate 5every PCR tube has 5 colonies,l10-14:20 picked colonies from plate 6 every PCR tube has 5 colonies
bands on lanes 4a, 4b, 6a, 6b, 6d at the expected 663 bp, so the next step is making PCRs of 1 colony per PCR of these probes

Fig.14.2 Gel of picked colonies with insert DelH-BB (loaded 20 µL of PCR)
l1-3:3 picked colonies from plate 1, every PCR tube has 5 colonies, l4-7:4 picked colonies from plate 2, every PCR tube has 5 colonies,l8: 2log,l9-13:4 picked colonies from plate 3 every PCR tube has 5 colonies
bands on lanes 3b, 3c, 3d, 4a, 4b, 6a, 6b, 6d at the expected 663 bp, so the next step is making PCRs of 1 colony per PCR of these probes

Gel shows bands for b, 3c, 3d, 4a, 4b, 6a, 6b, 6d at the expected 663 bp.

=> Make single colony-PCRs.

Colony-PCR Conditions CP.W14.C

1 µl of colony ON culture picked

Reagent	3c	3c	3c	3c	3c
Expected length [bp]	663	663	663	663	663
Named	3c 1	3c 2	3c 3	3c 4	3c 5
Template (1 µl)	1 colonies of E3c	1 colonies of E3c	1 colonies of E3c	1 colonies of E3c	1 colonies of E3c
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	5 µl	5 µl	5µl	5 µl	5 µl

Reagent	4a	4a	4a	4a	4a
Expected length [bp]	663	663	663	663	663
Named	4a 1	4a 2	4a 3	4a 4	4a 5
Template (1 µl)	1 colonies of E4a	1 colonies of E4a	1 colonies of E4a	1 colonies of E4a	1 colonies of E4a
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	5 µl	5 µl	5 µl	5 µl	5 µl

Reagent	6b	6b	6b	6b	6b
Expected length [bp]	663	663	663	663	663
Named	6b 1	6b 2	6b 3	6b 4	6b 5
Template (1 µl)	1 colonies of E6b	1 colonies of E6b	1 colonies of E6b	1 colonies of E6b	1 colonies of E6b
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	5 µl	5 µl	5µl	5 µl	5 µl

Cycles	Temperature DelH-G0 [°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
18	95	60
	65 (touchdown -0.5°C)	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.14.5 Gel of picked colonies with insert DelH-BB (loaded 20 µL of PCR)
'l1: 2log, l2-6: 5 seperate colonies which were together in 6b PCR earlier,
no bands = no colony positive

Fig.14.4 Gel of picked colonies with insert DelH-BB (loaded 20 µL of PCR)
'l1: 2log, l2-6: 5 seperate colonies which were together in 3a PCR earlier, l7-11: 5 seperate colonies which were together in 4b PCR earlier,
no bands = no colony positive

=> No band is visible. There should be a band at at least one of each sample (for example 6B), because in the previous PCR we observed a band.

Because of the explained reason above we incubated 40 colonies seperately which might be positive ON at 37°C in 200 µl LB Amp. 200 µl of the ON cultire was mixed with 1.8 ml LB Amp for five colonies of each probe: 3b, 3c, 3d, 4a, 4b, 6a, 6b, 6d.

Lab book

05-08 - 13-08-13

Generation of DelH Plasmid 01-08

Colony-PCR Conditions CP.W15.A

From colonies inoculated on 04-08

Reagent	3c	3c	3c	3c	3c
Expected length [kb]	663	663	663	663	663
Named	3c 1	3c 2	3c 3	3c 4	3c 5
Template (1 µl)	1 colonies of E3c	1 colonies of E3c	1 colonies of E3c	1 colonies of E3c	1 colonies of E3c
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	5 µl	5 µl	5µl	5 µl	5 µl

Reagent	4a	4a	4a	4a	4a
Expected length [kb]	663	663	663	663	663
Named	4a 1	4a 2	4a 3	4a 4	4a 5
Template (1 µl)	1 colonies of E4a	1 colonies of E4a	1 colonies of E4a	1 colonies of E4a	1 colonies of E4a
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	5 µl	5 µl	5 µl	5 µl	5 µl

Reagent	6b	6b	6b	6b	6b
Expected length [kb]	663	663	663	663	663
Named	6b 1	6b 2	6b 3	6b 4	6b 5
Template (1 µl)	1 colonies of E6b	1 colonies of E6b	1 colonies of E6b	1 colonies of E6b	1 colonies of E6b
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	5 µl	5 µl	5 µl	5 µl	5 µl

Cycles	Temperature [°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
18	95	60
	65 (touchdown -0.5°C)	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.15.2 Gel of picked colonies with insert DelH-BB (loaded 20 µL of PCR)
l1-5: 5 seperate colonies which were together in 3a PCR earlier, l6: 2log
no bands = no colony positive

Fig.15.1 Gel of picked colonies with insert DelH-BB (loaded 20 µL of PCR)
l1-5: 5 seperate colonies which were together in 3a PCR earlier, l6: 2log, l7-11: 5 seperate colonies which were together in 3a PCR earlier,
no bands = no colony positive

None of the gels shows expected band.

=> None of the colonies is positive.

Miniprep

Of colonies 6b(1)-6b(5), 6a(1), 6a(2), 3c(3), a miniprep was performed.

Sample	Concentration [ng/µl]	µl avaiblable
6b(1)	33.8	18
6b(2)	33.4	18
6b(3)	36.9	18
6b(4)	59.6	18
6b(5)	18	18
6a(1)	60	18
6a(2)	62.3	18
3c(3)	40.9	18

Test Restriction Digest

Sample	Miniprep [µl]	CutSmart Buffer [µl]	NotI-HF [µl]	H₂O [µl]	Total [µl]
6b(1)	15	2	1	3	20
6b(2)	15	2	1	3	20
6b(3)	15	2	1	3	20
6b(4)	10	2	1	8	20
6b(5)	15	2	1	3	20
6a(1)	10	2	1	8	20
6a(2)	10	2	1	8	20
3c(3)	15	2	1	3	20

Result

Expected bands: 11,079 bp, 6,201 bp, 3,998 bp, 2,371 bp

Fig.15.3 test digest of listed colonies (loaded 20 µL of PCR)
l1-5: 5 seperate colonies of 6b, l6: 2log, l7 6a(1), l8 6a(2), l9 3c(3)
results are shown in table below

Expected bands	Present bands
11.079 bp	?
6.201 bp	no
3.998 bp	yes
2.371 bp	no

in silico PCR of BB shows the following result:

2 fragments generated:

1: 3.998 bp - From NotI[9] To NotI[4007]

2: 1.093 bp - From NotI[4007] To NotI[9]

But an additional band between 1-2 Kb is present!

=> Talk to Advisors, because it isn't what we expected. What could it be?

Possible next steps:

a) Wait for the new strain of D. acidovorans SHP1

b) Perform a re-PCR of minipreps (one with BB and one with DelH G0 fragment)

Generation of Backbone pSB6A1-lacI-mRFP

Restriction Digest with DpnI

After consulting the advisors, we decided not to continue the strategy with the old construct and wait with DelH until the new strain of D. acidovorans arrives. Until then, we digest the backbone (which is used also in following experiments) with DpnI to get rid of any remaining template.

Reagent	Amount [µl]
Gel extracted lineralized by PCR (template=10.4 Kb)	17
DpnI	1
CutSmart buffer	2
Total	20

1 h incubation at 37°C
20 min inactivation of enzyme by heat shock at 80°C for 20 min

Purification

As template, the PCR of 10,4 PCR, which was digested with DpnI on 06-08, was used.
Purification was performed with nucleotide removal kit (wrong column was used, but there was some yield at the nanodrop)

=> Again, checking on gel (2 µl + 8 µl 1xloading dye)

Fig.15.4 checking concentration of purified BB (PSB6A1-lacI-mRFP) (loaded 2 µL of PCR)
l1 2log ladder l2: pSB6A1-lacI-mRFP
l2 show expected band at 5 Kb

=> Concentration at nanodrop was 27.2 ng/µl

Amplification of DelH G0

PCR Conditions G0.W15.A

Reagent	Amount [µl]
Expected length [Kb]	18.521
Named	G0
Template	1 µl New strain culture SHP1 (resuspended pellet)
Primer fw 10 µM	1 µl short2
Primer rev 10 µM	1 µl HM08
Phusion Flash Ready Mix	10
ddH₂O	5
DMSO	1

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 18.521 Kb

Fig.15.5 amplified fragment DelH-complete (loaded 20 µL of PCR)
l1: G0, l21Kb+ ladder
no band at 18 Kb only a specific band at 5 Kb, but that is not useful

Gel does not show the expected band.

=> Further improve PCR conditions.

PCR Conditions G0.W15.B

Reagent	Amount [µl]
Expected length [Kb]	18.521
Named	G0
Template	Picked colony
Primer fw 10 µM	1 µl short2
Primer rev 10 µM	1 µl HM08
Phusion Flash Ready Mix	10
ddH₂O	5
DMSO	1

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

=> Becaus it worked well we amplified 3x G0 with the same conditions.

PCR Conditions G0.W15.C

3x 20 µl PCR reactions were prepared

Reagent	Amount [µl]
Expected length [Kb]	18.521
Named	G0
Template	Picked colony
Primer fw 10 µM	1 µl short2
Primer rev 10 µM	1 µl HM08
Phusion Flash Ready Mix	10
ddH₂O	5
DMSO	1

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 18 Kb

Fig.15.7 gel of amplified DelH-fragment (loaded 20 µL of PCR)
l1-3:3x G0 (complete fragment amplified with DN11 & HM08), l4: 1kb+ ladder, l5-6:2x G1/2a (complete fragment amplified with DN11 & HM06)
l1-3: band at 18 Kb was cut out l5-6: band at 13 Kb was cut out

Fig.15.6 gel of amplified DelH-fragment (loaded 20 µL of PCR)
l1-3:3x G0 (complete fragment amplified with DN11 & HM08), l4: 1kb+ ladder, l5-6:2x G1/2a (complete fragment amplified with DN11 & HM06)
l1-3: show the expected band at 18 Kb and l5-6: show the specific band at 13 Kb

Gel shows the expected bands.

=> Fragments were cut and gel extracted.

Amplification of DelH G1/2a

PCR Conditions G1/2a.W15.A

Reagent	Amount [µl]	Amount [µl]
Expected length [Kb]	13.083	13.083
Named	G1/2a	G1/2a
Template	Picked colony	Picked colony
Primer fw 10 µM	1 µl short2	1 µl short2
Primer rev 10 µM	1 µl HM06	1 µl HM06
Phusion Flash Ready Mix	10	10
ddH₂O	5	4
DMSO	1	0

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Fig.15.7 gel of amplified DelH-fragment (loaded 20 µL of PCR)
l1-3:3x G0 (complete fragment amplified with DN11 & HM08), l4: 1kb+ ladder, l5-6:2x G1/2a (complete fragment amplified with DN11 & HM06)
l1-3: band at 18 Kb was cut out l5-6: band at 13 Kb was cut out

Fig.15.6 gel of amplified DelH-fragment (loaded 20 µL of PCR)
l1-3:3x G0 (complete fragment amplified with DN11 & HM08), l4: 1kb+ ladder, l5-6:2x G1/2a (complete fragment amplified with DN11 & HM06)
l1-3: show the expected band at 18 Kb and l5-6: show the specific band at 13 Kb

Gel shows the expected bands.

=> Fragments were cut and gel extracted.

PCR Conditions G1/2a.W15.B

Reagent	Amount [µl]
Expected length [Kb]	13.083
Named	G1/2a
Template	Picked colony
Primer fw 10 µM	1 µl short2
Primer rev 10 µM	1 µl HM06
Phusion Flash Ready Mix	10
ddH₂O	5
DMSO	1

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 13 Kb

Fig.15.9 gel of amplified DelH-fragment (loaded 20 µL of PCR)
l1-3:3x G0 (complete fragment amplified with DN11 & HM08), l4: 1kb+ ladder, l5-6:2x G1/2a (complete fragment amplified with DN11 & HM06)
l1-3: band at 18 Kb was cut out l5-6: band at 13 Kb was cut out

Fig.15.8 gel of amplified DelH-fragment (loaded 20 µL of PCR)
l1-3:3x G0 (complete fragment amplified with DN11 & HM08), l4: 1kb+ ladder, l5-6:2x G1/2a (complete fragment amplified with DN11 & HM06)
l1-3: show the expected band at 18 Kb and l5-6: show the specific band at 13 Kb

Gel shows the expected bands.

=> Fragments were cut and gel extracted.

Amplification of DelH G2b

PCR Conditions G2b.W15.A

Reagent	Amount [µl]	Amount [µl]
Expected length [Kb]	5.472	5.472
Named	G2b	G2b
Template	Picked colony	Picked colony
Primer fw 10 µM	1 µl HM07	1 µl HM07
Primer rev 10 µM	1 µl HM08	1 µl HM08
Phusion Flash Ready Mix	10	10
ddH₂O	5	4
DMSO	1	0

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	68	5
	72	120
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Fig. 15.10: Gel of amplified DelH G2b fragment l1:2log, l2-3:G2b amplified

Summary of Gel Extracted Fragments

Concentrations (by nanodrop) are summarized in the following table and gel picture.

Fragment	Concentration [ng/µl]
G0	3.5
G1/2a	4.9
G2b	18.6

Fig.15.11 Analyse-gel of DelH-fragments (loaded 5 µL of G0 and G1/2a and 1 µl of G2b)
lane 1 1kb+ ladder, lane 2 G0 (complete DelH with DN11 & HM08), lane 3 G1/2a (part of DelH with DN11 & HM06), lane 4 G2b (part of DelH with HM07 & HM08)

Generation of DelH Plasmid 09-08

Gibson Assembly

We decided two assemble 2 different constructs and one control (only the backbone).

Construct	G0 [µl]	G1/2a [µl]	G2b [µl]	BB [µl]	2x Gibson Master Mix [µl]	Final amount [µl]
1	9	0	0	1	10	20
2	0	8	1	1	10	20
Control (C)	0	0	0	1 (+9 ddH₂O )	10	20

Incubated 1 h at 50°C

Electroporation

Of each Gibson assembly, 5 µl are diluted in 10 µl ddH₂O
The rest of the Gibson assembly is stored at -20°C

Conoly-PCR Conditions CP.W15.A

Picked 8 colonies from plates with 10µl and 100 µl construct 1, and plate with 100 µl of construct 2. 1 additional colony was picked from plate with 10 µl of construct 2 (because there were no more cells) and 1 colony of the control(100µl), and one colony of the control (100µl) with new electrocompetent cells.

In the following table construct 1 is named C1, and construct 2 = C2 and Control = Co

Reagent	C1 (10 µl)	C1 (10 µl)	C1 (10 µl)	C1 (10 µl)	C1 (10 µl)	C1 (10 µl)	C1 (10 µl)	C1 (10 µl)
Expected length [bp]	663	663	663	663	663	663	663	663
Named	1	2	3	4	5	6	7	8
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6µl	6 µl	6 µl	6 µl	6 µl	6 µl

Reagent	C1 (100 µl)	C1 (100 µl)	C1 (100 µl)	C1 (100 µl)	C1 (100 µl)	C1 (100 µl)	C1 (100 µl)	C1 (100 µl)
Expected length [bp]	663	663	663	663	663	663	663	663
Named	9	10	11	12	13	14	15	16
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl	6µl	6 µl	6 µl	6 µl

Reagent	C2 (10 µl)	C2 (10 µl)	C2 (10 µl)	C2 (10 µl)	C2 (10 µl)	C2 (10 µl)	C2 (10 µl)	C2 (10 µl))
Expected length [bp]	663	663	663	663	663	663	663	663
Named	17	18	19	20	21	22	23	24
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl

Reagent	C2 (10 µl)	C2 (100 µl)	Co (100 µl)	Co(100 µl)
Expected length [bp]	663	663	no product	no product
Named	24	25	26	27
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl

Cycles	Temperature [°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
18	95	60
	65 (touchdown -0.5°C)	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.15.12 screening PCR with DN07 & VF2 (loaded 1 µL of PCR)
l1:2log ladder,l2-17: colonies C1, l18-24: colonies C2, l25:2log ladder
None of the colonies showed expected band, instead, all have band at ~6 kb

Gel shows no banda at 663 bp. Instead, they show an unexpected band at ~6 Kb.

=> None of the colonies is positive.

Conoly-PCR Conditions CP.W15.B

Picked 20 colonies from plates with 10 µl and 100 µl construct 1 and construct 2 (80 colonies). 4 colonies were picked from the control (10 µl) and control (100 µl).

In the following table construct 1 is named C1, and construct 2 = C2 and Control = Co

Reagent	C1 (10 µl)	C1 (10 µl)	C1 (10 µl)	C1 (10 µl)	C1 (100 µl)	C1 (100 µl)	C1 (100 µl)	C1 (100 µl)
Expected length [bp]	663	663	663	663	663	663	663	663
Named	A	B	C	D	E	F	G	H
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl

Reagent	C2 (10µl)	C2 (10µl)	C2 (10µl)	C2 (10µl)	C2 (100µl)	C2 (100µl)	C2 (100µl)	C2 (100µl)
Expected length [bp]	663	663	663	663	663	663	663	663
Named	I	J	K	L	M	N	O	P
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl

Reagent	Co (10µl)	Co (10µl)	Co (10µl)	Co (10µl)	Co(100µl)	Co(100µl)	Co(100µl)	Co(100µl)
Expected length [bp]	663	663	663	663	663	663	663	663
Named	C1	C2	C3	C4	C5	C6	C7	C8
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl

Cycles	Temperature [°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
18	95	60
	65 (touchdown -0.5°C)	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.15.13 screening PCR with DN07 & VF2 (loaded 1 µL of PCR)
l1-9: colonies A-I, l10:2log ladder, l11-17: colonies J-P, l12:2log ladder, l13-18: PCR performed with 6 colonies of the control plate
Neither the colonies A-P show the expected band nor the control shows any band

=> New Gibson Assembly will be performed

Gel shows no banda at 663 bp.

=> Neither the colonies A-P show the expected band, nor the control shows any band.

Generation of DelH Plasmid 11-08

Gibson Assembly

Because of the past results, we assume that the colonies can grow because the backbone religates. We also found out that the first overhang of the backbone has some homologity with a sequence at the end and we can assume that with Gibson, it primes itself.
So in the following step we will use less backbone. We prepared an 1:10 dilution of the backbone construct.

Reagent	Concentration [ng/µl]	Amount [µl] Mix A	Amount [µl] Mix B	Amount [µl] Mix C
G0	3.5	9	0	0
BB	1.8	1	1	1
Gibson Assembly Master Mix	2x	10	10	0

The time constant for the electroporation was unexpectedly low, hopefully high enough...

Overview
Lab book

Vector Maps and Primers

1st Strategy: DelH & pSB6A1 without mRFP

Vector map of the PHM04-DelH-pSB6A1(without mRFP) Gibson plasmid.

Identifier	Order date	Note	Sequence
HM17:DelH_Terminator_BB_fw	16-08-2013	Amplification of Backbone pSb6A1-lacI-mRFP	ATTGGCGCTGGAGTACGCGCTGGACTGA aggcatcaaataaaacgaaaggctcag

2nd Strategy: DelH & Tetracycline Resistance & pSB6A1 without mRFP

Vector map of the PHM05-DelH-tetR-pSB6A1 Gibson plasmid.

Identifier	Order date	Note	Sequence
HM14:DelH_tetR_fw	2013-08-16	Gibson-Primer DelH-tetR: amplifies the tetracycline resistance from the pSB1T3 Backbone and creates an overlap to the end of DelH	ATTGGCGCTGGAGTACGCGCTGGACTGA atgaagttttaaatcaatctaaag
HM15:tetR_stop_BB_rev	2013-08-16	Gibson-Primer tetR-pSB6A1: amplifies the tetracycline resistance and creates an overlap with the Terminator of the Backbone pSB6A1	Cgactgagcctttcgttttatttgatgcctggc ctcgtgatacgcctatttttatagg
HM16:tetR_pSB6A1_fw	2013-08-16	Gibson-Primer DelH, amplifies the Backbone pSB6A1 creating an overlap with the tetracycline resistance	Aaaaataggcgtatcacgag gccaggcatcaaataaaacgaaaggctcag

Additional Screening Primer

Identifier	Order date	Note	Sequence
HM13:Screen_DelH_end_fw	2013-08-16	New screening primer for the end of DelH together with the VR2 primer from the registry	TTTCTGACGACCCTGCACCTGAAG

12-08 - 18-08-13

Increasing Yield of DelH Fragments

PCR Conditions G0.G1/2a.W16.A

Reagent	G0	G0	G0	G1/2a	G1/2a
Expected length [Kb]	18	18	18	13.083	13.083
Named	G0	G0	G0	1	1
Template	Picked colony	Picked colony	Picked colony	Picked colony	Picked colony
Primer fw 10 µM	1 µl short2	1 µl short2	1 µl short2	1 µl HM07	1 µl HM07
Primer rev 10 µM	1 µl HM08	1 µl HM08	1 µl HM08	1 µl HM06	1 µl HM06
Phusion Flash Ready Mix	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	5 µl	5 µl	5 µl	5 µl	5 µl
DMSO	1 µl	1 µl	1 µl	1 µl	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start used

Result

Expected bands: 18 Kb (G0), 13 Kb (G1/2a)

Fig.16.1 gel of amplified DelH-fragment(loaded 20 µL of PCR)
l1-3: G0 (complete DelH-fragment with DN11 & HM08), l4-5: G1/2b (3/4 of the DelH fragment amplified with DN11 & HM06), l6: 1kb+ ladder
l2 shows the expected band at 18 Kb. l4-5 showed expected band at 13 Kb. All three bands were cut out.

Gel shows expected bands.

=> They were cut and gel isolated.

Generation of Plasmid DelH 11-08

Colony-PCR CP.W16.A

Reagent	Cells + 1 µl Gibson Assembly	Cells + 14 µl Gibson Assembly	Cells + 14 µl Gibson Assembly (ONLY Backbone)	Cells + 14 µl Gibson Assembly (ONLY Backbone)
Expected length [bp]	663	663	-	-
Named	D1	D14	B14(1)	B14(2)
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl

Cycles	Temperature DelH-G0 [°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
18	95	60
	65 (touchdown -0.5°C)	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.16.2 gel of screening PCRs with DN07 & VF2 primer (loaded 20 µL of PCR)
l1: 2log ladder, l2: colony PCR of 1 µl Gibson transformed,l3: colony PCR of 14 µl Gibson transformed,l4-5: 2 colony PCRs of BB - 14 µl Gibson transformed, l6: 2log ladder
none of the colonies is positive, of course the BB shows not the expected band of 663 bp (for screening). The first colony shows a band at ~1.7 kb.

None of the colonies is positive, of course the BB shows not the expected band of 663 bp (for screening). The first colony shows a band at ~1.7 kb.

=> None of the colonies harbours DelH plasmid.

Colony-PCR CP.W16.B

Reagent	Cells + 10 µl Gibson Assembly pink	Cells + 10 µl Gibson Assembly pink	Cells + 10 µl Gibson Assembly white	Cells + 10 µl Gibson Assembly white
Expected length [bp]	663	663	663	663
Named	A	B	C	D
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl

Cycles	Temperature DelH-G0 [°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
18	95	60
	65 (touchdown -0.5 °C)	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.16.3 Gel of colony PCR (loaded 10 µL)
l1: 2log ladder, l2-13 screening colonies A-D

Testing of Screening Primers

To test the reverse screening primer DN07 we amplify with the DreamTaqPolymerase and DN11 primer. As template, we use the complete DelH (18 Kb) and the first 3/4 of DelH (14 Kb).

Reagent	1 µl G0 of 23-07	1 µl G1/2a of 23-07
Expected length [bp]	323	323
Named	0	1
Primer fw 10 µM	2 µl DN11	2 µl DN11
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl
ddH₂O	5 µl	5 µl

Cycles	Temperature DelH-G0 [°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	30
18	95	60
	65 (touchdown -0.5°C)	30
	72	30
1	12	inf

Result

Expected length= 323 bp for positive clones

Fig.16.4 Gel of amplified fragments (loaded 20 µL)
lane 1 2log ladder, lane 2 screening G0, lane 3 screening G1/2a

Gel shows expected bands.

=> Both PCRs were positive. Proof of functionality of DN07 screening primer and that both fragments are the expected DelH fragments.

Amplification of DelH G0

Gradient PCR Conditions G0.W16.B

To improve the PCR of the fragment with the length of 18 Kb, we run a gradient PCR between 68°C and 65°C.

Reagent	G0	G0	G0	G0
Expected length [Kb]	18	18	18	18
Named	G0 1	G0 2	G0 3	G0 4
Template	Picked colony	Picked colony	Picked colony	Picked colony
Primer fw 10 µM	2 µl short2	2 µl short2	2 µl short2	2 µl short2
Primer rev 10 µM	2 µl HM08	2 µl HM08	2 µl HM08	2 µl HM08
Phusion Flash Ready Mix	10 µl	10 µl	10 µl	10 µl
ddH₂O	5 µl	5 µl	5 µl	5 µl
DMSO	1 µl	1 µl	1 µl	1 µl

Cycles	Temperature DelH-G0 [°C]	Time [s]
1	98	5
30	98	1
	68 - 65	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 18 Kb

Fig.16.5 amplified fragment of DelH (loaded 20 µL of PCR)
l1:1kb+ ladder, l2-5: G0 = complete DelH, l6-9: G1/2a, l10:1kb+ ladder
l2-5: show not the expected band at 18Kb. l6-9 show the expected band at 13.5 Kb and was cut out. But it shows also other unspecific bands.

Gel does not show expected band.

=> Further optimize PCR conditions.

PCR Conditions G0.W16.C

Because the amplification of DelH GO didn't work yesterday, we try it again with one picked colony and 1 µl of a glycerol stock at a constant annealing temperature of 65°C. 65°C was the temperature on which it worked the last time.

Reagent	G0	G0
Expected length [Kb]	18	18
Named	G0 1	G0 2
Template	Picked colony SPH1	1 µl of glycerol stock SPH1
Primer fw 10 µM	2 µl short2	2 µl short2
Primer rev 10 µM	2 µl HM08	2 µl HM08
Phusion Flash Ready Mix	10 µl	10 µl
ddH₂O	5 µl	4 µl
DMSO	1 µl	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 18 Kb

Fig.16.6 gel of amplified DelH G0 fragment (loaded 20 µL of PCR)
l1: G0 amplified from picked colony, l2: G0 amplified from glycerol stock, l3: 1 kb+ ladder
l3 shows expected band at 18 kb and was cut

Gel shows expected band.

=> It was cut and gel extracted. Also, we will run again 3 samples with the same conditions.

PCR Conditions G0.W16.D

Reagent	G0	G0	G0
Expected length [Kb]	18	18	18
Named	G0 1	G0 2	G0 2
Template	1 µl of glycerol stock SPH1	1 µl of glycerol stock SPH1	1 µl of glycerol stock SPH1
Primer fw 10 µM	2 µl short2	2 µl short2	2 µl short2
Primer rev 10 µM	2 µl HM08	2 µl HM08	2 µl HM08
Phusion Flash Ready Mix	10 µl	10 µl	10 µl
ddH₂O	4 µl	4 µl	4 µl
DMSO	1 µl	1 µl	1 µl

Cycles	Temperature DelH-G0 [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 18 Kb

Fig.16.7 gel of amplified DelH G0 in same conditions (loaded 20 µL of PCR)
l1: 1kb+ ladder, l2: G0 amplified with DN11 & HM08, l3: G0, l4: G0
l2-4show the expected band at 18 Kb and was cut

Gel shows expected fragments.

=> They were cut and gel extracted.

Amplification of DelH G1/2a

Gradient PCR Conditions G1/2a.W16.B

To improve the PCR of the fragment with the length of 18 Kb, we run a gradient PCR between 68°C and 65°C.

Reagent	G1/2a	G1/2a	G1/2a	G1/2a
Expected length [Kb]	13.083	13.083	13.083	13.083
Named	1 1	1 2	1 3	1 4
Template	Picked colony	Picked colony	Picked colony	Picked colony
Primer fw 10 µM	2 µl short2	2 µl short2	2 µl short2	2 µl short2
Primer rev 10 µM	2 µl HM06	2 µl HM06	2 µl HM06	2 µl HM06
Phusion Flash Ready Mix	10 µl	10 µl	10 µl	10 µl
ddH₂O	5 µl	5 µl	5 µl	5 µl
DMSO	1 µl	1 µl	1 µl	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	68 - 65	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 13 Kb

Fig.16.5 amplified fragment of DelH (loaded 20 µL of PCR)
l1:1kb+ ladder, l2-5: G0 = complete DelH, l6-9: G1/2a, l10:1kb+ ladder
l2-5: show not the expected band at 18Kb. l6-9 show the expected band at 13.5 Kb and was cut out. But it shows also other unspecific bands.

Gel shows expected band of G1/2a, but also additional uspecific bands.

=> Fragment was cut and gel extracted.

Generation of Plasmid DelH 17-08

Electroporation

Remaining Gibson mix from 01.08 was electroporated.

Colony-PCR CP.W16.B

5 colony per PCR tube (but in different LB Amp Eppis)

Reagent	Electroporation from 17-08 10 µl	Electroporation from 17-08 100 µl
Expected length [bp]	663	663
Named	1 - 2	3 - 12
Template	2 colonies of 10 µl	10 colonies of 100 µl
Primer fw 10 µM	1 µl VF2	1 µl VF2
Primer rev 10 µM	1 µl Screen_delH_rev	1 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl
ddH₂O	8 µl	8 µl

Cycles	Temperature [°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
18	95	60
	65 (touchdown -0.5°C)	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.16.8 gel of screening minipreped colonies 1&2 from plate with 10 µl and colonies 3-12 from plate with 100 ml Gibson assembled construct with mRFP (loaded 20 µL of PCR)
l1: 2log ladder, l2: 1, l3: 2, l4: 3, l5: 4, l6: 5, l7: 6, l8: 7, l9: 8, l10: 9, l11: 10, l12: 11, l13: 12
l4-13 show expected band = positive?

Majority of colonies show expected band.

=> Grow ON, perform mini prep and test digests as well as PCRs of fragments from isolated DNA.

Lab book

19-08 - 25-08-13

Summary of Amplified DelH Fragments

Fragment	Concentration [ng/µl]
G0	6.4
G1/2a	8.5

Rather low yield. So we switched the strategy and try to increase the template of DelH by amplifying it in smaller and more fragments. Therefore, we used the following primers: FS64-FS71, HM08, DN07

Amplification of DelH G0

Re-PCR Conditions G0.W17.A

Reagent	G0
Expected length [Kb]	18
Named	G0 1
Template	1 µl G0 fragment (c= 6.4 ng/µl)
Primer fw 10 µM	2 µl short2
Primer rev 10 µM	2 µl HM08
Phusion Flash Ready Mix	10 µl
ddH₂O	5 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 18 Kb

Fig.17.1 gel of amplified DelH-G0 fragment from the fragment itself (loaded 20 µL of PCR)
l1: BB amplified with HM16 by 2-step PCR, l2: BB amplified with HM17by 2-step PCR, l3: BB amplified with HM16, l4: BB amplified with HM17, l5: DelH-G0
l5: G0 was not amplified => not our fragment or without DMSO it is not so effective

Gel does not show expected band.

=> G0 was not amplified. Possibly change Mg²⁺ concentration.

PCR Conditions G0.W17.B

Reagent	G0	G0	G0	G0
Expected length [Kb]	18	18	18	18
Named	G0 0.5	G0 1	G0 2	G0 N
Template	1 µl glycerol stock D. acidovorans	1 µl glycerol stock D. acidovorans	1 µl glycerol stock D. acidovorans	1 µl glycerol stock D. acidovorans
Primer fw 10 µM	2 µl short2	2 µl short2	2 µl short2	2 µl short2
Primer rev 10 µM	2 µl HM08	2 µl HM08	2 µl HM08	2 µl HM08
Phusion Flash Ready Mix	10 µl	10 µl	10 µl	10 µl
ddH₂O	4.5 µl	4 µl	3.5 µl	4 µl
DMSO	1	1	1	1
MgSO₄	0.5 µl	1 µl	1.5 µl	-

Cycles	Temperature DelH [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 18 Kb

Fig.17.2 gel of amplified DelH-G0 with different MgSO₄(loaded 20 µL of PCR)
l1: 1Kb+ ladder, l2: G0 0.5 µl MgSO₄, l3: G0 1 µl MgSO₄, l4: G0 1.5µl MgSO₄, l5: G0 N without MgSO₄
l5: G0 was amplified without DMSO => DMSO is important, but MgSO₄ is not improve the PCR reaction

Fragments were amplified, but yield not significantly increased.

=> DMSO is important, but MgSO₄ is not improve the PCR reaction.

Characterization of DelH Plasmid pHM03 17-08

For the miniprep, the cells were centrifuged at 13,000 rpm for 15 min
The cell pellet was resuspended in 200 µl P1 + 400 µl P2 and incubated for 120
Afterwards, 300 µl S3 were added and transferred into a new 2 ml eppi and centrifuged 20 min at 13,000 rpm
1 ml isopropanol was added and the normal isoprop-ethanol-preipitation
It was resuspended in 35 µl ddH₂O

Result

Miniprep of colony	Concentration [ng/µl]
3	1,868.5
4	1,688.1
5	1,069.2
6	1,778.6
7	2,105.7
8	1,219.7
9	1,083.1
10	1,031.7
11	2,175.3
12	1,449.4

PCR Conditions CP.W17.A

M3 = Miniprep of DelH-pSB6A1(colony 3)

Template	1 µl of 1:1000 diluted M3 (pink)	1 µl of 1:1000 diluted M4 (slightly pink)	1 µl of 1:1000 diluted M5 (slightly pink)	1 µl of 1:1000 diluted M6 (pink)	1 µl of 1:1000 diluted M7 (pink)	1 µl of 1:1000 diluted M 8	1 µl of 1:1000 diluted M 9	1 µl of 1:1000 diluted M10	1 µl of 1:1000 diluted M11	1 µl of 1:1000 diluted M12
Expected length [bp]	663	663	663	663	663	663	663	663	663	663
Named	3	4	5	6	7	8	9	10	11	12
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl

Cycles	Temperature[°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
18	95	60
	65	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.17.3 colony PCR of Gibson assembled DelH-BB with mRFP (loaded 20 µL of PCR)
l1:
l3-12:show expected fragment

Colonies 3 to 12 show expected size.

=> Perform miniprep and test digest with colonies 3-12.

Test Restriction Digest

Of colonies 3, 4, 5, 6, 7

Component	Amount [µl]
DNA of M 3 to 12 (1:10)	19
CutSmart Buffer (10x)	.,2
Enzyme (SalI)	1
ddH₂O	-
Expected bands	14,180 & 9,469 bp

Incubated over night at 37°C and shaking

Result

Expected bands: 14.18 and 9.459 Kb

Fig.17.4 gel of test digest of the colonies 3-7 (loaded 20 µL of PCR)
l1:1 Kb+ ladder, l2:Digested miniprep of colony 3, l3:Digested miniprep of colony 4, l4:Digested miniprep of colony 5, l5:Digested miniprep of colony 6, l6:Digested miniprep of colony 7
l2-6:show not the expected fragment, but a band at ~ 4.8 Kb. Also observed pale bands at 20 Kb and ~ 3.8 Kb

None of the colonies shows expected restriction fragments. Additionally, there are pale bands at +20 Kb and ~3.8 Kb, but not the expected bands.

=> Possible explanation: colonies harbor reconjugated backbone AND something else involving DelH.

PCR Conditions CP.W17.B

M3 = Miniprep of DelH-pSB6A1(colony 3)

Template	1 µl of 1:1000 diluted M3 (pink)	1 µl of 1:1000 diluted M4 (slightly pink)	1 µl of 1:1000 diluted M5 (slightly pink)	1 µl of 1:1000 diluted M6 (pink)	1 µl of 1:1000 diluted M7 (pink)	1 µl of 1:1000 diluted M 8	1 µl of 1:1000 diluted M 9	1 µl of 1:1000 diluted M10	1 µl of 1:1000 diluted M11	1 µl of 1:1000 diluted M12
Expected length [bp]	663	663	663	663	663	663	663	663	663	663
Named	3	4	5	6	7	8	9	10	11	12
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl

Cycles	Temperature DelH-G0 [°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
18	95	60
	65	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.17.5 colony PCR of Gibson assembled DelH-BB with mRFP (loaded 20 µL of PCR)
l1:
l3-12:show an unexpected fragment at ~ 3Kb

Gel shows unexpected fragments at ~3 Kb.

=> Clones are negative despite of latest results. Current strategy does not work out. Development new strategy.

New Gibson Strategy

Gibson Strategy without mRFP

Try a new construct without mRFP, so that we can exclude the red clones from the screening. Therefore we are going to use a new reverse primer for the Backbone which includes only the terminator of the mRFP, but not the mRFP. The primers for the Backbone are HM11 & HM17. The construct is named pHM04 and shown in week 16 were the idea was specified. For first approach pHM04, we will amplify the backbone without mRFP, avoiding backbone reassembly due to ribosome binding site homology. In the second strategy pHM05, we will additionally introduce a tetracycline resistance, to ensure integration of the insert.

Vector Maps and Primers

1st strategy: DelH & pSB6A1 without mRFP

Vector map of the PHM04-DelH-pSB6A1(without mRFP) Gibson plasmid.

Identifier	Order date	Note	Sequence
HM17:DelH_Terminator_BB_fw	16-08-2013	Amplification of Backbone pSb6A1-lacI-mRFP	ATTGGCGCTGGAGTACGCGCTGGACTGA aggcatcaaataaaacgaaaggctcag

2nd strategy: DelH & tetracycline resistance & pSB6A1 without mRFP

Vector map of the PHM05-DelH-tetR-pSB6A1 Gibson plasmid.

Identifier	Order date	Note	Sequence
HM14:DelH_tetR_fw	2013-08-16	Gibson-Primer DelH-tetR: amplifies the tetracycline resistance from the pSB1T3 Backbone and creates an overlap to the end of DelH	ATTGGCGCTGGAGTACGCGCTGGACTGA atgaagttttaaatcaatctaaag
HM15:tetR_stop_BB_rev	2013-08-16	Gibson-Primer tetR-pSB6A1: amplifies the tetracycline resistance and creates an overlap with the Terminator of the Backbone pSB6A1	Cgactgagcctttcgttttatttgatgcctggc ctcgtgatacgcctatttttatagg
HM16:tetR_pSB6A1_fw	2013-08-16	Gibson-Primer DelH, amplifies the Backbone pSB6A1 creating an overlap with the tetracycline resistance	Aaaaataggcgtatcacgag gccaggcatcaaataaaacgaaaggctcag

Amplification of Tetracycline Fragment

Preparation of Tetraycline Medium

Weight 100 mg of tetracycline and dissolve it in 10 ml ethanol = stock solution
Add 500 µl of stock solution in 100 ml LB and mix

Transformation of Tetrazyklin Backbone

For the new strategy we need a tetracycline resistance (length ~1.2 Kb) of the pSB1T3 Backbone (2013 Distribution, Plate 5, well 7A, insert: BBa_J04450) [http://parts.igem.org/Part:pSB1T3:Design|pSB1T3]
The primers are already designed and shown in the table above
With these primers, we amplify the tetracycline resistance and include an overlap to DelH end and the backbone pSB6A1 excluding the mRFP
For the transformation I incubated 10 min at room temperature the well 7A of plate 5 with 10 µl ddH₂O

PCR Conditions TR.W17.A

Reagent	pSB1T3	pSB1T3
Template	picked colony 1	picked colony 2
Primer fw 10 µM	1 µl HM14	1 µl HM14
Primer rev 10 µM	1 µl HM15	1 µl HM15
Phusion Ready Mix	10 µl	10 µl
ddH₂O	8 µl	8 µl

Cycles	Temperature DelH [°C]	Time [s]
1	98	5
12	98	1
	68 (touchdown -0,5°C)	5
	72	30
18	98	1
	67	5
	72	30
1	72	5 min
1	4	inf

Result

Expected band: 1.468 Kb

Fig.17.6 gel of amplified tetracycline resistance (loaded 20 µL of PCR)
l1: 2 log, l2: tetracycline resistance amplified from colony, l3: tetracycline resistance amplified from colony 2
l2-3: show no band = maybe annealing temperature to high

Gel does not schow any band.

=> Try amplification with lower annealing temperature.

PCR Conditions TR.W17.B

Reagent	pSB1T3
Template	picked colony
Primer fw 10 µM	1 µl HM14
Primer rev 10 µM	1 µl HM15
Phusion Ready Mix	10 µl
ddH₂O	8 µl
DMSO	-

Cycles	Temperature DelH BB [°C]	Time [s]
1	98	5
12	98	1
	55 (touchdown -0,5°C)	5
	72	30
18	98	1
	55	5
	72	30
1	72	5 min
1	4	inf

Result

Expected band: 1.468 Kb

Fig.17.7 gel of amplified tetracycline resistance (loaded 20 µL of PCR)
l1: 2 log, l2: tetracycline resistance amplified from new picked colony 1, l3: tetracycline resistance amplified from new picked colony 2,
l2-3: show no band

Gel does not show expected band.

=> Repeat amplification with miniprep, therefore miniprep the 3 colonies containing pSB1T3.

PCR Conditions TR.W17.C

Reagent	pSB1T3	pSB1T3	pSB1T3
Template	Minipreped pSB1T3	Minipreped pSB1T3	Minipreped pSB1T3
Primer fw 10 µM	2 µl HM14	2 µl HM14	2 µl HM14
Primer rev 10 µM	2 µl HM15	2 µl HM15	2 µl HM15
Phusion Ready Mix	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	55 (touchdown -0,5°C)	5
	72	30
18	98	1
	55	5
	72	30
1	72	5 min
1	4	inf

Result

Expected band: 1.468 Kb

Fig.17.8 gel of amplified tetracycline resistance (loaded 20 µL of PCR)
l1: tetracycline resistance amplified from minipreped colony 1, l2: tetracycline resistance amplified from minipreped colony 2, l3: tetracycline resistance amplified from minipreped colony 3,l4: 2 log,
l1-3: show expected band = was cut

Gel does show expected band.

=> Fragment was cut and gel extracted (c= 132.1 ng/µl).

Amplification of Backbone

PCR Conditions BB.W7.A

With new primers (HM16 & HM17)

Reagent	BB with tetracycline & without mRFP	BB without mRFP
Template	1 µl BB 3.08	1 µl BB 3.08
Primer fw 10 µM	2 µl HM11	2 µl HM11
Primer rev 10 µm	2 µl HM16	2 µl HM17
Phusion Flash Ready Mix	10 µl	10 µl
ddH₂O 5µl	5 µl

Cycles	Temperature DelH BB [°C]	Time [s]
1	98	5
12	98	1
	69 (touchdown -0,5°C)	5
	72	75
18	98	1
	68	5
	72	75
1	72	5 min
1	4	inf

Result

Expected band: ~ 4.4 Kb

Fig.17.9 gel of amplified BB (loaded 25 µL of PCR)
l1: BB amplified with HM16, l2: BB amplified with HM17
l1:specific band as expected = was cut out

Gel shows specific band for amplification using HM16.

=> Fragment wa scut and gel extracted. For HM17, run a two-step PCR because of it's high annealing temperature. Also we are going to rise the amplification time to 1:30 min.

PCR Conditions BB.W7.B

Reagent	BB with tetracycline & without mRFP	BB without mRFP	BB with tetracycline & without mRFP	BB without mRFP
Template	1 µl BB 3,08	1 µl BB 3,08	1 µl BB 3,08	1 µl BB 3,08
Primer fw 10 µM	2 µl HM11	2 µl HM11	5 µl HM11	5 µl HM11
Primer rev 10 µM	2 µl HM16	2 µl HM17	5 µl HM16	5 µl HM17
Phusion Flash Ready Mix	10 µl	10 µl	25 µl	25 µl
ddH₂O	5 µl	5 µl	14 µl	14 µl

Cycles	Temperature (20 µl = sample 1 & 2) [°C]	Time	Temperature (50 µl = sample 3 & 4) [°C]	Time [s]
1	98	5	98	5
12	98	1	98	1
	69 (touchdown -0,5°C)	5	-
	72	90	72	90
18	98	1	98	1
	68	5	-
	72	90	72	90
1	72	5 min	72	5 min
1	4	inf	4	inf

Result

Expected band: ~ 4.4 Kb

Fig.17.10 gel of amplified BB with different primers (loaded 20 µL of PCR)
l1: BB amplified with HM16 by 2-step PCR, l2: BB amplified with HM17by 2-step PCR, l3: BB amplified with HM16, l4: BB amplified with HM17, l5: DelH-G0
all 4 samples (l1-4) showed a specific band at 4.4 Kb = was cut

All samples show expected length.

=> Fragments were cut and gel extracted.

Sample	Concentration [ng/µl]
BB-16	76.7
BB-17	51.3

Restriction Digest with DpnI

Incubated at 37°C for 2.5 h

Sample [µl]	Buffer [µl]	Enzyme [µl]
18 BB-16	2.1 CutSmart Buffer	1 DpnI
18 BB-16	2.1 CutSmart Buffer	1 DpnI

Afterwards, a purification was performed with the nucleotide removal kit

Generation of DelH Plasmid pHM04 23-08

Summary of Fragments

Fragment	Concentration [ng/µl]	Date
G0	6.4	22-08
G1/2a	8.5	22-08
G2b	18.6	Example
BB	Example	22-08

Gibson Assembly

Mix name	DelH G0	DelH G1/2a	DelH G2b	BB17	Gibson Master Mix [µl]	Final volume [µl]
E1	9	-	-	0.5	10	20
E2	-	7	2.5	0.5	10	20

Incubate the Gibson Assembly for 1 h at 50°C

Electroporation

Sample	Electroporated with	Plated out	Cuvette "exploded"
1	1 µl of E1 (5 µl Gibson + 10 µl ddH₂O)	22.08.2013	v
2	14 µl of E1 (5 µl Gibson + 10 µl ddH₂O)	22.08.2013	v
3	1 µl of E2 (5 µl Gibson + 10 µl ddH₂O)	22.08.2013	-
4	14 µl of E2 (5 µl Gibson + 10 µl ddH₂O)	22.08.2013	v
5	20 µl of E1 (purified by isoprop-precipitation)	22.08.2013	-
6	20 µl of E2 (purified by isoprop-precipitation)	22.08.2013	- (no pellet observed)

Colony-PCR CP.W17.C

50 colonies of plate 5 (= isoprop purified E1 => G0-complete in Backbone)
10 colonies of plate ...
2 different screening are performed
PC = picked colony
S5 = Sample 5 (watch names above on construct DelH-BB)

Template	50 x 1 PC S5	50 x 1 PC S5	4 x 1 PC S3	4 x 1 PC S3
Expected length [bp]	663	2,500	663	2,500
Named	A -J (5 colonies per tube)	A -J (5 colonies per tube)	1-4	1-4
Primer fw 10 µM	10 x 1 µl VF2	10 x 1 µl HM13	4 x 1 µl VF2	4 x 1 µl HM13
Primer rev 10 µM	10 x 1 µl DN07	10 x 1 µl VR2	1 µl DN07	1 µl VR2
Dream-Taq Polymerase (2x)	10 x 10 µl	10 x 10 µl	4 x 10 µl	4 x 10 µl
ddH₂O	10 x 8 µl	10 x 8 µl	4 x 8 µl	4 x 8 µl

Cycles	Temperature Screening start[°C]	Time [s]	Temperature Screening end [°C]	Time [s]
1	95	120	95	120
12	95	60	95	60
	68 (touchdown -0.5°C)	30	60 (touchdown -0.5°C)	30
	72	45	72	2:30 min
12x/ 34x	95	60	95	60
	65	30	60	30
	72	45	72	2:30 min
1	72	5 min	72	5 min
1	12	inf	12	inf

Result

Expected band: 663 bp (screening start), 2.5 Kb (screening end)

Fig.17.11 colony PCR of Gibson assembled DelH-BB with mRFP (loaded 20 µL of PCR)
l1:
l3-12:show an unexpected fragment at ~ 3Kb

Gel does not show expected bands.

=> Screen 10 minipreped colonies of the plate 5 and pick another 10 colonies of plate 1, 2, 3 and 6 (on plate 4 are no colonies).

Colony-PCR CP.W17.D

2 different screening are performed
PC = picked colony
S5 = Sample 5 (watch names above on construct DelH-BB)

Template	10 x 1 PC S1	10 x 1 PC S1	10 x 1 PC S2	10 x 1 PC S2	10 x 1 PC S3	10 x 1 PC S3	10 x 1 PC S6	10 x 1 PC S6	10 x 1 µl of minipreped colony	10 x 1 µl of minipreped colony
Expected length [bp]	663	2.5	663	2.5	663	2.5	663	2.5	663	2.5
Named	1A-E (2 colonies per tube)	1F-J (2 colonies per tube)	2A-E (2 colonies per tube)	2F-J (2 colonies per tube)	3A-E (2 colonies per tube)	3F-J (2 colonies per tube)	6A-E (2 colonies per tube)	6F-J (2 colonies per tube)	.............	....................
Primer fw 10 µM	5 x 1 µl VF2	5 x 1 µl HM13	5 x 1 µl VF2	5 x 1 µl HM13	5 x 1 µl VF2	5 x 1 µl HM13	5 x 1 µl VF2	5 x 1 µl HM13	5 x 1 µl VF2	5 x 1 µl HM13
Primer rev 10 µM	5 x 1 µl DN07	5 x 1 µl VR2	5 µl DN07	5 µl VR2	5 x 1 µl DN07	5 x 1 µl VR2	5 µl DN07	5 µl VR2	5 x 1 µl DN07	5 x 1 µl VR2
Dream-Taq Polymerase (2x)	5 x 10 µl	5 x 10 µl	5 x 10 µl	5 x 10 µl	5 x 10 µl	5 x 10 µl	5 x 10 µl	5 x 10 µl	5 x 10 µl	5 x 10 µl
ddH₂O	5 x 8 µl	5 x 8 µl	5 x 8 µl	5 x 8 µl	5 x 8 µl	5 x 8 µl	5 x 8 µl	5 x 8 µl	5 x 6 µl	5 x 6 µl

Cycles	Temperature Screening start [°C]	Time [s]	Temperature Screening end [°C]	Time [s]
1	95	120	95	120
12	95	60	95	60
	68 (touchdown -0.5°C)	30	60 (touchdown -0.5°C)	30
	72	45	72	2:30 min
12x/ 34x	95	60	95	60
	65	30	60	30
	72	45	72	2:30 min
1	72	5 min	72	5 min
1	12	inf	12	inf

Result

Expected band: 663 bp (screening start), 2.5 Kb (screening end)

Fig.17.13 colony PCR of Gibson assembled DelH-BB without mRFP with the screening primer VR2 and HM13 (loaded 1 µL of PCR)
l1:2log ladder l2-24: PCR of picked colonies from plate 1,2,3,5,6
no band at 663 bp observed

Fig.17.12 colony PCR of Gibson assembled DelH-BB without mRFP with the screening primer VF2 and DN11(loaded 1 µL of PCR)
l1:2log ladder l2-24: PCR of picked colonies from plate 1,2,3,5,6
no band at 663 bp observed

None of the gels shows expected fragment.

=> Overthink strategy.

Overview
Lab book

Vector Map, Primers and BioBricks

Vector map of the PHM05-DelH-tetR-pSB6A1 Gibson plasmid.

Backbone	Part	Distribution	Plate	Well	Usage	Resistance
pSB1T3	J04450	Spring 2013	2	2B	Backbone to amplify the tetracycline-resistance	Tetracycline
pSB6A1	J04450	Spring 2012	1	1K	Backbone for DelH	Ampicillin

Identifier	Order date	Note	Sequence
HM14:DelH_tetR_fw	2013-08-16	Gibson-Primer DelH-tetR: amplifies the tetracycline resistance from the pSB1T3 Backbone and creates an overlap to the end of DelH	ATTGGCGCTGGAGTACGCGCTGGACTGA atgaagttttaaatcaatctaaag
HM15:tetR_stop_BB_rev	2013-08-16	Gibson-Primer tetR-pSB6A1: amplifies the tetracycline resistance and creates an overlap with the Terminator of the Backbone pSB6A1	Cgactgagcctttcgttttatttgatgcctggc ctcgtgatacgcctatttttatagg
HM16:tetR_pSB6A1_fw	2013-08-16	Gibson-Primer DelH, amplifies the Backbone pSB6A1 creating an overlap with the tetracycline resistance	Aaaaataggcgtatcacgag gccaggcatcaaataaaacgaaaggctcag
FS_66: DelH_rv	2013-08-26	Amplification of DelH from Delftia acidovorans Gibson Primer	TGGGCATTCACCGCATCGATC
FS_67: DelH_fw	2013-08-26	Amplification of DelH from Delftia acidovorans Gibson Primer	CTTCACGTTGATTGCGCATG
FS_68: DelH_rv	2013-08-26	Amplification of DelH from Delftia acidovorans Gibson Primer	CAGAAGAACTCCCAGACCGAC
FS_69: DelH_fw	2013-08-26	Amplification of DelH from Delftia acidovorans Gibson Primer	GACACCGTTCAGCTTCGATG
FS_70: DelH_rv	2013-08-26	Amplification of DelH from Delftia acidovorans Gibson Primer	GAAGCTGCTCCGCTGATAGAT
FS_71: DelH_fw	2013-08-26	Amplification of DelH from Delftia acidovorans Gibson Primer	ATGTGCTGTCGCTCAAGATG
FS_72_SR_02_fw	2013-08-30	Screening of pHM04	ATGTGCTGTCGCTCAAGATG
FS_73_SR_03_fw	2013-08-30	Screening of pHM04	GTGCTGTTTGGCCGTATG
FS_74_SR_04_fw	2013-08-30	Screening of pHM04	ATCAGGTGCTGAGCTACGAC
FS_75_SR_05_fw	2013-08-30	Screening of pHM04	CTGTTCATCAACACCTTGCC
FS_76_SR_06_rv	2013-08-30	Screening of pHM04	GAAGACAGTCATAAGTGCGGC

26-08 - 01-09-13

Generation of DelH Plasmid pHM05 26-08

Overview on Fragments

Fragment	Concentration [ng/µl]	Date
G0	6.4	22-8
G1/2a	8.5	22-08
G2b	18.6	09-08
BB	40.6	22-08
TetR	132.1	26-08

Gibson Assembly

Mix name	DelH-G0	DelH-1/2a	DelH-G2b	BB17	TetR (1:10)	GibsonMasterMix	Final volume
0	8.5 µl	-	-	0.5 µl	1 µl	10 µl	20 µl
1	-	6.5 µl	2 µl	0.5 µl	1 µl	10 µl	20 µl

Incubate the Gibson Assembly for 1 h at 50°C in Thermocycler

Electroporation

In the next step, we purify 10 µl with Isoprop purification protocol and another 5 µl we dilute with ddH₂O (10 µl)

Sample	Amount	Used in Elektroporation
0 A	5 µl + 10 µl ddH₂O	1 µl 14 µl
0 B	20 µl isoprop purified	20 µl
1 A	5 µl + 10 µl ddH₂O	1 µl 14 µl
1 B	20 µl isoprop purified	20 µl

Colony-PCR CP.W18.A

10 colonies of plate 1-8 (names are explained in the following table)
PC = picked colony
S5 = Sample 5 (watch names above on construct DelH-BB)

Template	10 x 1 PC S5	50 x 1 PC S5	4 x 1 PC S3	4 x 1 PC S3
Expected length [bp]	663	663	663	663
Named	A -J (5 colonies per tube)	A -J (5 colonies per tube)	1-4	1-4
Primer fw 10 µM	10 x 1 µl VF2	10 x 1 µl VF2	4 x 1 µl VF2	4 x 1 µl VF2
Primer rev 10 µM	10 x 1 µl DN07	10 x 1 1 µl DN07	1 µl DN07	1 1 µl DN07
Dream-Taq Polymerase (2x)	10 x 10 µl	10 x 10 µl	4 x 10 µl	4 x 10 µl
ddH₂O	10 x 8 µl	10 x 8 µl	4 x 8 µl	4 x 8 µl

Cycles	Temperature Screening start [°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
14	95	60
	65	30
	72	45
1	72	5 min
1	12	inf

Result

Expected band: 663 bp

Fig.18.3 colony PCR of Gibson assembled DelH-BB without mRFP & tetR (loaded 7 µL of PCR) with DN07 & VF2
l1: 2log ladder, l2-5: colony PCRs from Del-rest Team, l6-13: colony PCRs from colonies 32,33,35,39,41,42,46
there is no specific bright band at the expected band of 663 bp

Fig.18.2 colony PCR of Gibson assembled DelH-BB without mRFP & tetR (loaded 7 µL of PCR) with DN07 & VF2
l1: 2log ladder, l27-50: colony PCRs from colonies 26-50
colony 32,33,35,39,41,42,46 shows a shadow specific band at ~600 bp, we expect 663 bp

Fig.18.1 colony PCR of Gibson assembled DelH-BB without mRFP & tetR (loaded 7 µL of PCR) with DN07 & VF2
l1: 2log ladder, l2-26: colony PCRs from colonies 1-25
l16colony 15 shows a shadow specific band at ~600 bp, we expect 663 bp

Colonies 15, 32, 33, 35, 39, 41, 42 and 46 show a shadow specific band at ~600 bp, slightly too low. => ?????

Amplification of DelH G0

Gradient-PCR Conditions G0.W18.A

Reagent	G0	G0	G0	G0
Expected length [Kb]	18	18	18	18
Named	G0 65	G0 66	G0 67	G0 68
Template	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans glycerol stock
Primer fw 10 µM	1 µl DN11	1 µl DN11	1 µl DN11	1 µl DN11
Primer rev 10 µM	1 µl HM08	1 µl HM08	1 µl HM08	1 µl HM08
Phusion Flash Ready Mix	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl
DMSO	1	1	1	1

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65/66/67/68	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 18 Kb

Fig.18.5 gel of amplified DelH-fragment (loaded 20 µL of PCR)
l1: 1Kb+ ladder, l2: G0 amplified at 65°C, l3:G0 amplified at 66°C, l4:G0 amplified at 67°C, l5: G0 amplified at 68°C,
l4: G0 at 67°C was cut out

Fig.18.4 gel of amplified DelH-fragment (loaded 20 µL of PCR)
l1: 1Kb+ ladder, l2: G0 amplified at 65°C, l3:G0 amplified at 66°C, l4:G0 amplified at 67°C, l5: G0 amplified at 68°C,
l2-5: show slightly band at expected 18 Kb, the 5 Kb band is observed at every temperature, the best temperature seems to be 67°C

Gel shows unspecific band at 5 Kb. G0 was best amplified at 67°C.

=> Fragment was cut and gel isolated.

Re-PCR Conditions G0.W18.B

Reagent	G0	G0
Expected length [Kb]	18	18
Named	G0	G0 1
Template	1 µl gel extracted G0 from 22-08	1 µl gel extracted G0 from 26-08
Primer fw 10 µM	1 µl DN11	1 µl DN11
Primer rev 10 µM	1 µl HM08	1 µl HM08
Phusion Flash Ready Mix	10 µl	10 µl
ddH₂O	6 µl	6 µl
DMSO	1	1

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 18 Kb

Fig.18.6 gel of amplified DelH-fragment (loaded 20 µL of PCR)
l1: 1Kb+ ladder, l2: G0 , l3: G0 , l4: G1/2a
a slight band can be observed at 18 Kb, but 5 Kb is much more amplified

A slight band can be observed at 18 Kb, but 5Kb is much more amplified.

=> By NCBI-Blast we found out that primer HM08 can also bind inside of DelH with 6 mismatches and the forward primer DN11 can also bind with 4 mismatches inside the DelH = possible explanation for 5 Kb.

=> Change the amplification conditions.

PCR Conditions G0.W18.C

Reagent	G0	G0	G0
Expected length [Kb]	18	18	18
Named	0	1	2
Template	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans glycerol stock
Primer fw 10 µM	1 µl DN11	1 µl DN11	1 µl DN11
Primer rev 10 µM	1 µl HM08	1 µl HM08	1 µl HM08
Phusion II Polymerase (Hot Start)	0.2 µl	0.2 µl	0.2 µl
dNTPs	0.4 µl	0.4 µl	0.4 µl
GC buffer (5x)	4 µl	4 µl	4 µl
ddH₂O	12.4 µl	11.4 µl	10.4 µl
DMSO	0 µl	1 µl	2 µl

Cycles	Temperature [°C]	Time [s]
1	98	30
30	98	10
	65	20
	72	5:00 min
1	72	10 min
1	12	inf

Result

Expected band: 18 Kb

Fig.18.7 gel of amplified DelH-fragment with different DMSO concentrations and a GC-buffer (loaded 20 µL of PCR)
l1: 1Kb+ ladder, l2: G0 without DMSO , l3: G0 with 1 µl DMSO, l4:G0 with 2 µl DMSO,
only l4 with 2 µl DMSO shows any band, but not the expected at 18 Kb, only the band at 5 Kb.

Only PCR with 2 µl DMSO shows any band, but not the expected at 18 Kb, only the band at 5 Kb.

=> Further improve PCR condtions.

Amplification of DelH G1/2a

Re-PCR Conditions G1/2a.W18.A

Reagent	G1/2a
Expected length [Kb]	18
Named	G1/2a
Template	1 µl gel extracted G0 from 22-08
Primer fw 10 µM	1 µl DN11
Primer rev 10 µM	1 µl HM06
Phusion Flash Ready Mix	10 µl
ddH₂O	6 µl
DMSO	1

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 18 Kb

Fig.18.6 gel of amplified DelH-fragment (loaded 20 µL of PCR)
l1: 1Kb+ ladder, l2: G0 , l3: G0 , l4: G1/2a
a slight band can be observed at 18 Kb, but 5 Kb is much more amplified

Expected fragment was amplified, but gel shows numerous side bands.

=> Fragment was cut and gel isolated.

Gradient-PCR Conditions G1/2a.W18.A

Reagent	G1/2a	G1/2a	G1/2a	G1/2a
Expected length [Kb]	13	13	13	13
Named	1	2	3	F
Template	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans glycerol stock	1 µl gel extracted G1/2a fragment
Primer fw 10 µM	1 µl DN11	1 µl DN11	1 µl DN11	1 µl DN11
Primer rev 10 µM	1 µl HM06	1 µl HM06	1 µl HM06	1 µl HM06
Phusion Flash Ready Mix	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	5 µl	4 µl	6 µl
DMSO	1	2	3	1

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	67	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Fig.18.7 gel of amplified DelH-fragment (loaded 20 µL of PCR)
l1: 1Kb+ ladder, l2: G1/2a with 1 µl DMSO, l3:G1/2a with 2 µl DMSO, l4:G1/2a with 3 µl DMSO, l5: G1/2a with 1 µl DMSO amplified from the fragment itself
no band at 18 Kb

=> There is no band at 18 Kb visible - entire DelH fragment could not be amplified.

Amplification of DelH FS64 - FS71

PCR Conditions FS64-FS71.W18.A

Reagent	DN11-FS66	FS67-FS68	FS69-HM08	FS69-FS70	FS71-HM08	FS67 -HM08
Expected length [Kb]	4.7	4.0	9.7	7.0	2.8	14.0
Named	1	2	3	4	5	6
Template	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans glycerol stock
Primer fw 10 µM	2.5 µl DN11	2.5 µl FS67	2.5 µl FS69	2.5 µl FS69	2.5 µl FS71	2.5 µl FS67
Primer rev 10 µM	2.5 µl FS66	2.5 µl FS68	2.5 µl HM08	2.5 µl FS70	2.5 µl HM08	2.5 µl HM08
Phusion Flash Ready Mix	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	3 µl	3 µl	3 µl	3 µl	3 µl	3 µl
DMSO	1	1	1	1	1	1

Cycles	Temperature DN11-FS66 [°C]	Time [s]
1	98	5
12	98	1
	68↓	5
	72	1:25 min
18	98	1
	66	5
	72	85
1	72	6 min
1	10	inf

Cycles	Temperature [°C]	Time FS67 - FS68	Time FS69-HM08	Time FS69-FS70	FS67 -HM08	Time FS71-HM08
1	98	5	5	5	5	5
12	98	1	1	1	1	1
	66↓	5	5	5	5	5
	72	70	3:00 min	2:10 min	4:38 min	52
18	98	1	1	1	1	1
	64	5	5	5	5	5
	72	70	3:00 min	2:10 min	4:38 min	52
1	72	5 min	10 min	5 min	5 min	5 min
1	10	inf	inf	inf	inf	inf

Lid preheated at 98°C
No hot start

Result

Expected bands: DN11-FS66 = 4.7 Kb, FS67-FS68 = 4.0 Kb, FS69-HM08 = 9.7 Kb, FS69-FS70 = 7.0 Kb, FS71-HM08 = 2.7 Kb, FS67-HM08 = 14 Kb

Fig.18.8 Gel of amplified DelH-fragments(with different new primer combinations) (loaded 20 µL)
l1:2log ladder, l2: DelH amplified with DN11 & FS66, l3:DelH amplified with FS67 & FS68, l4:DelH amplified with FS71 & HM08,
l2: shows expected band at 4.7 Kb, 4.0 Kb and 2.7 Kb => all 3 bands were cut.

Gel shows expected fragments of DN11-FS66, FS67-FS68 and FS71-HM08

=> Bands were cut. Run gel with remaining sample for gel extraction.

=> Optimize remaining PCRs.

Amplification of DelH DN11-FS66

PCR Conditions DN11-FS66.W18.A

Reagent	4x DN11 - FS66
Expected length [Kb]	4.7
Named	1
Template	1 µl D. acidovorans glycerol stock
Primer fw 10 µM	2.5 µl DN11
Primer rev 10 µM	2.5 µl FS66
Phusion Flash Ready Mix	10 µl
ddH₂O	3 µl
DMSO	1

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	68↓	5
	72	85
18	98	1
	66	5
	72	85
1	72	6 min
1	10	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 4.7 Kb

Fig.18.9 Gel of amplified DelH-fragments(with different new primer combinations) (loaded 20 µL)
l1:2log ladder, l2-5: DelH amplified with DN11 & FS66, l6-9:DelH amplified with FS67 & FS68, l10:DelH amplified with FS67 & HM08, l11:DelH amplified with FS71 & HM08
l2-5: shows expected band at 4.7 Kb, l6-9: at 4.0 Kb, l10 doesn't show band at 14 Kb, l11:show band at 2.7 => all specific bands were cut out

Bands could not be used, because too much UV light was applied.

Amplification of DelH FS67-FS68

PCR Conditions FS67-FS68.W18.A

Reagent	4x FS67-FS68
Expected length [Kb]	4.0
Template	1 µl D. acidovorans glycerol stock
Primer fw 10 µM	2.5 µl FS67
Primer rev 10 µm	2.5 µl FS68
Phusion Flash Ready Mix	10 µl
ddH₂O	3 µl
DMSO	1

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	66↓	5
	72	1:10 min
18	98	1
	64	5
	72	70
1	72	5 min
1	10	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 4.0 Kb

Fig.18.10 Gel of amplified DelH-fragments(with different new primer combinations) (loaded 20 µL)
l1:2log ladder, l2-5: DelH amplified with DN11 & FS66, l6-9:DelH amplified with FS67 & FS68, l10:DelH amplified with FS67 & HM08, l11:DelH amplified with FS71 & HM08
l2-5: shows expected band at 4.7 Kb, l6-9: at 4.0 Kb, l10 doesn't show band at 14 Kb, l11:show band at 2.7 => all specific bands were cut out

Bands could not be used, because too much UV light was applied.

Amplification of DelH FS71-HM08

PCR Conditions FS71-HM08.W18.A

Reagent	FS71-HM08
Expected length [Kb]	2.8
Template	1 µl D. acidovorans glycerol stock
Primer fw 10 µM	2.5 µl FS71
Primer rev 10 µM	2.5 µl HM08
Phusion Flash Ready Mix	10 µl
ddH₂O	3 µl
DMSO	1

Cycles	Temperature A [°C]	Time	Temperature B [°C]	Temperature C [°C]
1	98	5	98	98
12	98	1	98	98
	68↓	5	-	69
	72	52	72	72
18	98	1	98	98
	66	5	-	69
	72	52	72	72
1	72	6 min	72	72
1	10	inf	10	10

Lid preheated at 98°C
No hot start

Result

Expected band: 2.8 Kb

Fig.18.11 Gel of amplified DelH-fragments(with different new primer combinations) (loaded 20 µL)
l1:2log ladder, l2-5: DelH amplified with DN11 & FS66, l6-9:DelH amplified with FS67 & FS68, l10:DelH amplified with FS67 & HM08, l11:DelH amplified with FS71 & HM08
l2-5: shows expected band at 4.7 Kb, l6-9: at 4.0 Kb, l10 doesn't show band at 14 Kb, l11:show band at 2.7 => all specific bands were cut out

Bands could not be used, because too much UV light was applied.

PCR Conditions FS71-HM08.W18.B

Reagent	FS71-HM08
Expected length [Kb]	2.8
Template	1 µl D. acidovorans glycerol stock
Primer fw 10 µM	2.5 µl FS71
Primer rev 10 µM	2.5 µl HM08
Phusion Flash Ready Mix	10 µl
ddH₂O	3 µl
DMSO	1

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	72.3	5
	72	52
30	98	1
	66	5
	72	52
1	72	6 min
1	10	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 2.8 Kb

Fig.18.12 Gel of amplified DelH-fragments(with different FS71 & HM08) (loaded 20 µL)
l1:2log ladder, l2: used constant 68°C annealing, l3:used touch down PCR with 70°C annealing
l2 and l3 show specific band = was cut

Both condistions resulted in the expected fragment.

=> Fragments were cut and gel extracted.

=> Run new PCR with 72.3°C constant annealing temperature because of the slight side bands.

Amplification of DelH FS69-FS70

PCR Conditions FS69-FS70.W18.A

Reagent	FS69-FS70
Expected length [Kb]	7.0
Named	FS69-FS70
Template	1 µl D. acidovorans glycerol stock
Primer fw 10 µM	2.5 µl FS69
Primer rev 10 µM	2.5 µl FS70
Phusion Flash Ready Mix	10 µl
ddH₂O	3 µl
DMSO	1

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	66↓	5
	72	2:10 min
18	98	1
	64	5
	72	2:10 min
1	72	6 min
1	10	inf

Lid preheated at 98°C
No hot start

Characterization of Amplified DelH Fragments

Test Restriction Digest

Fragment	Fragment length [Kb]	Digestes with following enzymes	Expected bands [Kb]
DN11-FS66	4.7	EcoRV	3.7 & 0.9
FS67-FS68	4.0	NotI	2.7 & 1.3
FS69-FS70	7.0	SalI	5.5 & 1.6
FS71-HM08	2.8	NotI & HindIII	1.3 & 1.1 & 0.3

Fragment	Amount in digest	Enzyme	Buffer	ddH₂O	Final amount
DN11-FS66	5 µl	1 µl EcoRV	2 µl 3.1 buffer	10.9 µl	20 µl
FS67-FS68	5 µl	1 µl NotI	2 µl 3.1 buffer	10.9 µl	20 µl
FS69-FS70	5 µl	1 µl SalI-HF	2 µl CutSmart buffer	12 µl	20 µl
FS71-HM08	5 µl	1 µl NotI-HF & HindIII-HF	2 µl CutSmart buffer	11 µl	20 µl

Result

Expected banda are listed above.

Fig.18.14 Test restriction digest
l1:2log ladder, l2: DN11-FS66 (EcoRV), l3:FS67-FS68 (NotI) l4:FS69-FS70 (SalI), l5:FS71-HM08 (NotI & HindIII)

The test digest showed that the first fragment is cut, because the band is around 3.7 Kb, but the third and fourth lane on the gel picture show the complete non-digested fragment and on line 5 the FS71-HM08 fragment is not visible.

=> check again the digests.

Generation of DelH Plasmid pHM04 and pHM05 30-08

Gibson Assembly

Fragment	Concentration [ng/µl]	Amount with BB16 & tetR [µl]	Amount with BB17 [µl]	Amount with mRFP BB of pHM03
DN11-FS66	172.5	1.67	1.47	1.67
FS67-FS68	120.7	2.03	1.79	2.03
FS69-FS70	211.3	2.03	1.79	2.03
FS71-HM08	146	1.18	1.04	1.18
BB16	40.3	2.54	0	0
tetR (1:10)	13.2	0.56	0	0
BB17	23.0	0	3.91	0
BB+mRFP (pHM03)	0	0	0	3.08

Electroporation of pHM04

10 µl H₂O were added to 5 µl of the Gibson assembly mix. 1 µl and 14 µl were electroporated into electrocompetent DH10ß. Cells were incubated at 37°C for 1 h and streaked (10% vs. 90%) on LB Amp plates and stored ON at 37°C.

Colony-PCR Conditions CP.W18.B

14 colonies (#7 was left out) were picked and screened for correct integration of first DelH fragmenta s well as grown in 500 µl LB Amp.

Template	DelH construct pHM04 30-08
Expected length [bp]	663
Named	Colonies 1 - 15
Primer 10 µM fw	2 µl VF2
Primer 10 µM rev	2 µl DN07
Dream-Taq Polymerase (2x)	10 µl
ddH₂O	6 µl

Cycles	Temperature [°C]	Time [s]
1	95	120
12	95	60
	66 (touchdown -0.5°C)	30
	72	2:30 min
18	95	60
	65	30
	72	2:30 min
1	72	5 min
1	12	inf

Result

Expected band: 663 bp

Fig.18.15 Colony PCR for sceening if first DelH fragment was integrated in backbone.
l1:1Kb plus ladder, l2-l7: colonies 1-6, l8-l12: colonies 8-12, l13-l14: 1Kb plus ladder, l15-l7: colonies 13-15

Colonies 1, 3, 4, 6, 12 and 15 show positive band.

=>Of the 250 µl liquid culture, screening PCRs for the correct insertion of the last DelH fragment were performed. To the remaining 250 µl, 8 ml LB Amp were added. Colonies 1 and 3 did not grow and were excluded from further analysis.

Colony-PCR CP.W18.C

Template	pHM04 30-08
Expected length [Kb]	2.5
Named	Colonies 1 - 15
Primer 10 µM fw	2 µl HM13
Primer 10 µM rev	2 µl VR
Dream-Taq Polymerase (2x)	10 µl
ddH₂O	6 µl

Cycles	Temperature [°C]	Time [s]
1	95	120
12	95	60
	65 (touchdown -0.5°C)	30
	72	2:30 min
18	95	60
	65	30
	72	2:30 min
1	12	inf

Results

Expected band: 2.5 Kb

Fig.18.16 Colony PCR for sceening if last DelH fragment was integrated in backbone.
l1:2log ladder, l2: colony 6, l3: colony 12, l4: colony 4, l5: colony 15

Colonies 4, 6, 12 and 15 show positive band. => Of 2 ml of the cultures, glycerol stocks were prepared. 3 ml were mini preped and test digested. The remaining 3 ml were stored.

Test Restriction Digest of Colony S4

Clone	Concentration [ng/µl]	Amount in digest	Enzyme	Buffer	ddH₂O	Final amount
pHM04 S4	400 ng/µL	1 µl	1 µl EcoRV	1 µl CutSmart buffer	8 µl	10 µl
pHM04 S4	400 ng/µL	1 µl	1 µl NotI	1 µl CutSmart buffer	8 µl	10 µl
pHM04 S4	400 ng/µL	1 µl	1 µl SalI-HF	1 µl CutSmart buffer	8 µl	10 µl

Result

Expected bands are shown in table below.

Clone	Clone length [bp]	Digestes with following enzymes	Expected bands [bp]
pHM04 S4	22,937	EcoRI	17,829 & 5,108
pHM04 S4	22,937	NotI	11,079, 6201, 3,998 & 1,628
pHM04 S4	22,937	PvuI	11,621, 8628 & 2,685

Fig.18.17 Test restriction digest of pHM04
l1:2log ladder, l2: pHM04 (EcoRI), l3:pHM04 (NotI) l4:pHM04 (PvuI)

The expected bands were not there. So the colony seems not to have the entire DelH-plasmid. .

Overview
Lab book

Results

Sample	Alignment File
S4 A	File:Heidelberg Sequencing Result pHM04 DN07 colony 04.clustal.txt
S6	sequencing insufficient
S15	sequencing insufficient
H7	File:Heidelberg Sequencing Result pHM04 DN07 colony 7.clustal.txt
H19	File:Heidelberg Sequencing Result pHM04 DN07 colony 19-2.clustal.txt
S4 B	File:Heidelberg Sequencing Result pHM04 DN07 colony 04.clustal.txt

02-09 - 08-09-13

Characterization of DelH Plasmid pHM04 30-08 Clone 12

Maxiprep

1 ml of an ON culture DH10ß-DelH were inocculated in 200 ml LB Amp and cultured ON at 37°C.
Maxi prep was performed by upscaling of mini precipitation protocol.

Result

The maxi prep yielded 6x 180 µl.

Maxi prep	Concentration [µg/µl]
1	5.40
2	5.37
3	5.42
4	5.40
5	5.38
6	5.42

Sequencing showed a mutation at the beginning of DelH

Next steps

=> Sequencing the other 3 positive colonies => hopefully one of them has no mutation at the beginning of DelH

=> Sequence D. acidovorans, maybe the organism SPH1 was not perfectly sequenced => amplify with FS35 & DN07

Characterization of DelH Plasmid pHM04 30-08 Clones 4, 6, 15

Sequencing

Miniprep performed
Send in for sequencing => no reliable result
Maxiprep performed => Clone 4: c= 5.51 µg/µl, Clone 6: c= 3.71µg/µl, Clone 15: c= 4.65 µg/µl
Send in for sequencing with DN07 again

Result

Sample	Alignment File
Midi-col 4	File:Heidelberg Sequencing Result pHM04 DN07 colony 04.clustal.txt
Midi-col 6	sequencing insufficient
Maxi-col 15	sequencing insufficient

Electroporation

Because the sequenced DelH colony 12 has a mutation at the beginning of the coding DNA, we are sequencing the other colonies and parallel we transformed with the rest of the same Gibson Mix (15 µl) used for the electroporation before (colonies 4, 6, 12, 15). In advance, we purified it via isoprop purification protocol.

Sample	Isoprop purified Gibson Mix	Colonies grown?
A	10 µl	yes
B	20 µl	yes (a lot more than on sample A)

Colony-PCR conditions CP.W19.A

There were 30 colonies screened. 3 per tube and in total 10 colonies of sample A & 20 colonies of sample B

Template	3 PC of S-A	3 PC of S-A	4 PC of S-A	3 PC of S-B	3 PC of S-B	4 PC of S-B	3 PC of S-B	3 PC of S-B	4 PC of S-B
Expected length [bp]	663	663	663	663	663	663	663	663	663
Named	1-3	4-6	7-10	11-13	14-16	17-20	21-23	24-26	27-30
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07
iTaq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl

Cycles	Temperature DelH [°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
18	95	60
	65	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.19.1 colony PCR of Gibson assembled DelH-BB without mRFP (loaded 20 µL of PCR)
l1:2log, l2:colonies 1-3, l3:colonies 4-6, l4:colonies 7-10, l5:colonies 11-13, l6:colonies 14-16, l7:colonies 17-20, l8:colonies 21-23, l9:colonies 24-26, l10:colonies 27-30
l4, l5,l8,l10:show the specific band at 663 bp

Some of the colony mixes show positive band.

=> Screen again colonies 7-10, 11-13, 17-20, 27-30 in a single PCR tubes.

Colony-PCR conditions CP.W19.B

Template	7	8	9	10	11	12	13	17	18	19	20	27	28	29	30
Expected length [bp]	663	663	663	663	663	663	663	663	663	663	663	663	663	663	663
Named	7	8	9	10	11	12	13	17	18	19	20	27	28	29	30
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07
iTaq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl

Cycles	Temperature DelH [°C]	Time [s]
1	95	120
12	95	30
	68 (touchdown -0.5°C)	30
	72	45
18	95	30
	65	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.19.3 colony PCR of Gibson assembled DelH-BB without mRFP (loaded 20 µL of PCR)
l1:50 bp ladder, l2:colonies 18, l3:colonies 19, l4:colonies 20, l5:colonies 27, l6:colonies 28, l7:colonies 29, l8:colonies 30
l3 and l7 show the expected band at 663 bp = col 19 & 29

Fig.19.2 colony PCR of Gibson assembled DelH-BB without mRFP (loaded 20 µL of PCR)
l1:50 bp ladder, l2:colonies 7, l3:colonies 8, l4:colonies 9, l5:colonies 10, l6:colonies 11, l7:colonies 12, l8:colonies 13, l9:colonies 17
l2 and l8show the expected band at 663 bp = col 7 & 13

Colonies 7,13, 19 & 29 show a definit result

=> Add medium and perform a mediprep the next day for sending in for sequencing.

Midiprep

Performed with 300 µl P1, 600 µl P2 and after incubating for 180 450 µl S3. Protocol was performed with isoprop/ethanol purification.

Sample	Concentration [ng/µl]
Midi-col 7	2628.5
Midi-col 13	2379.3
Midi-col 19	2846.6
Midi-col 29	2846.6

Test Restriction Digest

We performed a test digest with EcoRI-HF of the screened samples col 7, col 13, col 19, col 29. We expect a band of 17.9 Kb and 4.9 Kb.

Sample	Concentration [ng/µl]	Amount in restriction digest	EcoRI-HF [µl]	CutSmartBuffer [µl]	ddH₂O [µl]	Total amount [µl]
Midi-col 7	2628.5	0.5 µl = 1314.25 ng	1	2	16.5	20
Midi-col 13	2379.3	0.5 µl = 1189.65 ng	1	2	16.5	20
Midi-col 19	2846.6	0.5 µl = 1423.3 ng	1	2	16.5	20
Midi-col 29	2846.6	0.5 µl = 1423.3 ng	1	2	16.5	20

Incubation time: 1 h at 37 °C

Result

Expected bands: 17.9 Kb and 4.9 Kb

Fig.19.4. Test digest of pHM04 from different colonies with EcoRI-HF (loaded 20 µL of PCR)
l1:1kb+ ladder,l2:colony 7,l3:colony 19,l4:colony 29,l5:colony 13,
l2-3:show the expected bands at ~5 Kb and ~18 Kb

Colonies 7 & 13 show a definit result

=> Add medium and perform a mediprep the next day for send in for sequencing.

Sequencing

The colonies 7 & 19 were sent in MWG for sequencing. There for we prepared 15 µl of the plasmid (midiprep) with a concentration of 50-100 ng/µl and added 2 µl DN07 primer (10µM)

Sample	Concentration [ng/µl]	Amount for sequencing	ddH₂O added up to 15 µl	Final concentration [ng/µl]
Midi-col 7	2628.5	0.5 µl = 1314.25 ng	14.5	87.62
Midi-col 19	2846.6	0.5 µl = 1423.3 ng	14.5	94.89
Maxi-col 4	5500	2 µl of 1:10 dilution = 1100 ng	13	73.3

Result

Sample	Alignment File
Midi-col 7	File:Heidelberg Sequencing Result pHM04 DN07 colony 7.clustal.txt
Midi-col 19	File:Heidelberg Sequencing Result pHM04 DN07 colony 19-2.clustal.txt
Maxi-col 4	File:Heidelberg Sequencing Result pHM04 DN07 colony 04.clustal.txt

Test Restriction Digest

We performed a test digest with EcoRI-HF and PvuI-HF of the screened samples col 4, col 7, col 19. We expect a band of 17.9 Kb and 4.9 Kb for the digest with EcoRI-HF and bands of 11.5 Kb, 8.5 Kb and 2.6 Kb.

Sample	Concentration [ng/µl]	Amount in restriction digest	Enzyme	CutSmartBuffer [µl]	ddH₂O [µl]	Total amount [µl]
Midi-col 4	5500	0.25 µl = 1375 ng	EcoRI-HF 1 µl	2	16.75	20
Midi-col 4	5500	0.25 µl = 1375 ng	PvuI-HF 1 µl	2	16.75	20
Midi-col 7	2628.5	0.5 µl = 1314.25 ng	PvuI-HF 1 µl	2	16.5	20
Midi-col 19	2846.6	0.5 µl = 1423.3 ng	PvuI-HF 1 µl	2	16.5	20

Incubation time: 1:20 h at 37 °C

Result

Expected band: 17.9 Kb and 4.9 Kb (EcoRI-HF) and 11.5 Kb, 8.5 Kb and 2.6 Kb (PvuI)

Fig.19.5. Test digest of pHM04 from different colonies with EcoRI-HF and PvuI (loaded 20 µL of PCR)
l1:1kb+ ladder,l2:colony 4 EcoRI,l3:colony 4 PvuI,l4:colony 7 PvuI,l5:colony 19 PvuI,
l2-3:show the expected bands

Colony 7 is the only colony which is positiv for all restriction digests.

=> Electroporate plasmid together with DelRest plasmid, as well as the Methylmanolyl-CoA plasmid.

Sequencing of D. acidovorans

PCR Conditions DA.W19.A

For being sure that the mutation at the beginning of DelH is not some mistake in the sequenced genome we amplify this part with one primer binding the delG (FS35) and the screening primer binding at the beginning of DelH (DN07) and let it sequence with GATC.

Template	1 µl glycerol stock of D. acidovorans	1 µl glycerol stock of D. acidovorans
Expected length [Kb]	6.5	6.5
Named	TD	2step
Primer fw 10 µM	2 µl FS35	2 µl FS35
Primer rev 10 µM	2 µl DN07	2 µl DN07
Phusion Flash (2x)	10 µl	10 µl
ddH₂O	4 µl	4 µl
DMSO	1 µl	1 µl

Cycles	Temperature A [°C]	Time [s]	Temperature B[°C]	Time [s]
1	98	10	98	10
12	98	1	98	1
	68 (touchdown -0.5°C)	5	-	-
	72	130	72	120
18	98	1	98	1
	66	5	-	-
	72	130	72	120
1	72	10 min	72	10 min
1	12	inf	12	inf

Result

Expected band: 6.5 Kb

Fig.19.7 Amplified fragments of DelG-DelH-beginning (loaded 20 µL of PCR)
l1:2log, l3-4PCR of 2 step, l5-6 PCR of 68 td
l3-6:show expected band at 7 Kb = was cut

Fig.19.6 Amplified fragments of DelG-DelH-beginning (loaded 20 µL of PCR)
l1:2log, l3-4PCR of 2 step, l5-6 PCR of 68 td
l3-6:show expected band at 7 Kb

Gel shows expected band.

=> Fragments were cut but not extracted, because side bands were cut too.

=> Run again PCR with 72.3 °C annealing temperature.

PCR Conditions DA.W19.B

Template	1 µl glycerol stock of D. acidovorans
Expected length [Kb]	6.5
Named	FS35-DN07
Primer fw 10 µM	2 µl FS35
Primer rev 10 µM	2 µl DN07
Phusion Flash (2x)	10 µl
ddH₂O	4 µl
DMSO	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
	72.3	5
	72	120
1	72	10 min
1	12	inf

Result

Expected band: 6.5 Kb

Fig.19.9 Amplified fragments of DelG-DelH-beginning (loaded 20 µL of PCR)
l1:1kb plus ladder, l2-4PCR with 72.3°C annealing :show expected band at 7 Kb = was cut

Fig.19.8 Amplified fragments of DelG-DelH-beginning (loaded 20 µL of PCR)
l1:1kb plus ladder, l2-4PCR with 72.3°C annealing :show expected band at 7 Kb

Gel shows expected band at ~7 Kb.

=> The fragment was cut and gel purified. Nevertheless the bands were rather weak, so the PCR was repeated.

PCR Conditions DA.W19.C

Template	1 µl glycerol stock of D. acidovorans
Expected length [Kb]	6.5
Named	FS35-DN07
Primer fw 10 µM	2 µl FS35
Primer rev 10 µM	2 µl DN07
Phusion Flash (2x)	10 µl
ddH₂O	4 µl
DMSO	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
	72.3	5
	72	120
1	72	10 min
1	12	inf

Result

Expected band: 6.5 Kb

Fig.19.11 Amplified fragments of DelG-DelH-beginning (loaded 20 µL of PCR)
l1:1kb plus ladder, l2-4PCR with 72.3°C annealing :show expected band at 7 Kb = was cut out

Fig.19.10 Amplified fragments of DelG-DelH-beginning (loaded 20 µL of PCR)
l1:1kb plus ladder, l2-4PCR with 72.3°C annealing :show expected band at 7 Kb

Gel shows expected fragment.

=> The fragment was cut and gel purified.

=> Send in for sequencing with DN07.

Overview
Lab book

Results

Colony	Alignment File	Conclusion
H33	sequencing insufficient	-
H39	sequencing insufficient	-
H40	sequencing insufficient	-
H46	sequencing insufficient	-
H51v	sequencing insufficient	-
H58	File:Heidelberg Sequencing Result pHM04 DN07 colony H58 DN07.clustal.txt	Insertion in the primer region of DelH to Backbone
I 4E	File:Heidelberg Sequencing Result pHM04 DN07 colony I4E.clustal.txt	Deletion of G in coding sequence
I 4H	File:Heidelberg Sequencing Result pHM04 DN07 colony I4H.clustal.txt	Deletion of G in coding sequence
I 6B	File:Heidelberg Sequencing Result pHM04 DN07 colony I6B.clustal.txt Sequencing of clone I 6B with VF2	Deletion in the RBS
I 6C	File:Heidelberg Sequencing Result pHM04 DN07 colony I6C.clustal.txt	Deletion
I 6D	File:Heidelberg Sequencing Result pHM04 DN07 colony I6D.clustal.txt	Deletion
I 7H	File:Heidelberg Sequencing Result pHM04 DN07 colony I7H.clustal.txt	Deletion
I 8G	File:Heidelberg Sequencing Result pHM04 DN07 colony I8G.clustal.txt	Deletion
I 8B	-	Deletion of G in coding sequence
I 10B	-	Deletion of G in coding sequence
I 10G	-	Insertion of G in coding sequence
I 11F	-	Deletion of G in coding sequence
II 3G	-	G Deletion of the ATG (start-codon) and 3 bp later deletion of C
II 4E	-	Deletion of G in coding sequence
II 7G	-	G Deletion of the ATG (start-codon) and 3 bp later deletion of C

09-09 - 15-09-13

Characterization of DelH Plasmid pHM04 30-08 Clones 4, 7, 15

Colony-PCR Conditions CP.W20.A

Because the sequenced DelH-colonies 4, 7, 15 had different kinds of mutations (Deletion of one basepair but also an insertion of a whole sequence part => results are shwon in week 19) we made a new screening PCR of 30 new picked colonies named 31-60 of the plate 2 of the electroporated cells realized in week 19.
There were 30 colonies screened.

Template	30x 1 PC of S-A
Expected length [bp]	663
Named	31-60
Primer fw 10 µM	30x 2 µl VF2
Primer rev 10 µM	30x 2 µl DN07
iTaq Polymeras (2x)	30x 10 µl
ddH₂O	30x 6 µl

Cycles	Temperature [°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
18	95	60
	65	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.20.2 Colony PCR of Gibson assembled DelH-BB without mRFP (loaded 10 µL of PCR)
l1:50 bp ladder, l2-15:colonies 47-60, l16: ddH₂O
l6, l13:show the specific band at 663 bp

Fig.20.1 Colony PCR of Gibson assembled DelH-BB without mRFP (loaded 10 µL of PCR)
l1:50 bp ladder, l2-17:colonies 31-46
l4, l10,l11,l17:show the specific band at 663 bp

Colonies 33, 39, 40, 46, 51, 58 showed band.

=> Send in for sequencing after isopropanol ethanol purification.

Sequencing

The colonies 33, 39, 40, 46, 51, 58 were sent in MWG for sequencing. There for we prepared 15 µl of the plasmid (midiprep) with a concentration of 50-100 ng/µl and add 2 µl DN07 primer (10µM).

Result

Colony	Alignment File	Conclusion
H33	sequencing insufficient
H39	sequencing insufficient
H40	sequencing insufficient
H46	sequencing insufficient
H51v	sequencing insufficient
H58	File:Heidelberg Sequencing Result pHM04 DN07 colony H58 DN07.clustal.txt	insertion in the primer region of DelH-backbone (pHM04)

Colony-PCR Conditions CP.W20.B

New picked olonies 2x 95 well plate

Template	95x 1 µl of colony
Expected length [bp]	663
Named	I 1A - I 12H , II 1A - II 12H
Primer fw 10 µM	105x 2 µl VF2
Primer rev 10 µM	105x 2 µl DN07
iTaq Polymerase (2x)	105x 10 µl
ddH₂O	105x 5 µl

Cycles	Temperature DelH [°C]	Time [s]
1	95	120
12	95	30
	68 (touchdown -0.5°C)	30
	72	45
18	95	30
	65	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.20.10 Colony PCR of Gibson assembled DelH-BB without mRFP 96 well plate II (loaded 10 µL of PCR)
l1:50 bp ladder, l2-l26:colonies 9H-12H

Fig.20.9 Colony PCR of Gibson assembled DelH-BB without mRFP 96 well plate II (loaded 10 µL of PCR)
l2-l26:colonies 6G-9G

Fig.20.8 Colony PCR of Gibson assembled DelH-BB without mRFP 96 well plate II (loaded 10 µL of PCR)
l1:50 bp ladder, l2-l24:colonies 3H-6F

Fig.20.7 Colony PCR of Gibson assembled DelH-BB without mRFP 96 well plate II (loaded 10 µL of PCR)
l1:50 bp ladder, l2-l26:colonies 1A-3G

Fig.20.6 Colony PCR of Gibson assembled DelH-BB without mRFP 96 well plate I (loaded 10 µL of PCR)
l1:50 bp ladder, l2-l26:colonies 10A-12H

b

Fig.20.5 Colony PCR of Gibson assembled DelH-BB without mRFP 96 well plate I(loaded 10 µL of PCR)
l1:50 bp ladder, l2-l26:colonies 7C-9H

Fig.20.4 Colony PCR of Gibson assembled DelH-BB without mRFP 96 well plate I (loaded 10 µL of PCR)
l1:50 bp ladder, l2-l26:colonies 4B-7B

Fig.20.3 Colony PCR of Gibson assembled DelH-BB without mRFP 96 well plate I(loaded 10 µL of PCR)
l1:50 bp ladder, l2-l26:colonies 1A-4A

Colonies collected in table below show a definit result.

=> Add medium and perform a mediprep the next day for send in for sequencing:

Colony of plate I	Colony of plate II
1F	2D
1G	2C
2A	3G
2H	4A
3B	4E
4C	7C
4E	7G
4F	8B
4H	10E
5E	10H
5F	11A
5G
(5H)
6B
6C
6D
7H
8B
8D
8F
8G
9B
9C
9F
10B
10C
10G
11F
12G

=> The next step is a test restriction digest with PvuI

Test Restriction Digest

We performed a test digest with PvuI-HF of the screened samples which showed a postive band at 663 bp in the screening PCR. Therefore we prepared a Master Mix with:

Enzyme	CutSmartBuffer [µl]	ddH₂O [µl]	Total amount [µl]
45x 0.5 µl = 22.5 µl	45x 2 µl = 90 µl	45x 16.5 µl = 742.5 µl	45x 19 µl = 855 µl

Incubation time: 1:20 h at 37 °C

Result

Expected bands: 11.5 Kb, 8.5 Kb and 2.6 Kb.

Fig.20.14. Test digest of pHM04 from different colonies with PvuI (loaded 20 µL of PCR)
l1:2log,l2:4E,l3: 7C,l4: 7G,l5: 8A,l6: 8B,l7:10E,l8: 10H,l9:11A

Fig.20.13. Test digest of pHM04 from different colonies with PvuI (loaded 20 µL of PCR)
l1:2log,l2:plate I 10A,l3: 10B,l4: 10C,l5: 10D,l6: 10G,l7: 11F,l8: 12G,l9: plateII 2B,l10: 2D,l11: 2C,l12: 3G,l13: 4A

Fig.20.12. Test digest of pHM04 from different colonies with PvuI (loaded 20 µL of PCR)
l1:2log,l2:6B,l3: 6C,l4: 6D,l5: 7H,l6: 8B,l7:8D,l8: 8F,l9:8G,l10: 9B,l11: 9C,l12:9F,l13: 10C

Fig.20.11. Test digest of pHM04 from different colonies with PvuI (loaded 20 µL of PCR)
l1:2log,l2:1F,l3: 1G,l4: 2A,l5: 3B,l6: 4C,l7: 4E,l8: 4F,l9: 4H,l10: 5E,l11: 5F,l12: 5G,l13: 5H

Some colonies showed the expected bands (see table below).

=> These are sent in for sequencing after a miniprep.

The table below shows the result of the restriction digest of different colonies containing the pHM04 plasmid. The restriction digest was positive if the expected bands were pesent.

Colony of plate I	Show expected bands	Colony of plate II	Show expected bands
1F	-	2D	-
1G	-	2C	-
2A	-	3G	+
2H	-	4A	-
3B	-	4E	+
4C	-	7C	-
4E	+	7G	+
4F	-	8B	+
4H	+	10E	-
5E	-	10H	-
5F	-	11A	-
5G	-	-	-
(5H)	-	-	-
6B	+	-	-
6C	+	-	-
6D	+	-	-
7H	+	-	-
8B	-	-	-
8D	-	-	-
8F	-	-	-
8G	+	-	-
9B	-	-	-
9C	-	-	-
9F	-	-	-
10B	+	-	-
10C	-	-	-
10G	+	-	-
11F	+	-	-
12G	-	-	-

Colony	Concentration ng/µl
I 4E	1597
I 4H	495
I 6B	255
I 6C	2445
I 6D	2101
I 7H	1539
I 8G	1589
I 10B	1359
I 10G	1863
I 11F	1886
II 3G	564
II 4E	2107
II 7G	1913
II 8B	955

Sequencing

Colony of plate I	Concentration ng/µl	Amount for sequencing [µl]	ddH₂O [µl]	Primer (DN07 [10 µM]) added [µl]
I 4E	1597	1	14	2
I 4H	495	1.5	13.5	2
I 6B	255	5	10	2
I 6C	2445	0.5	14.5	2
I 6D	2101	0.5	14.5	2
I 7H	1539	1	14	2
I 8G	1589	1	14	2

Result

Colony	Sequencing	Notes	Alignment File
I 4E	-	(Deletion of G in coding sequence)	File:Heidelberg Sequencing Result pHM04 DN07 colony I4E.clustal.txt
I 4H	-	(Deletion of G in coding sequence)	File:Heidelberg Sequencing Result pHM04 DN07 colony I4H.clustal.txt
I 6B	+ ?	a deletion in the RBS	File:Heidelberg Sequencing Result pHM04 DN07 colony I6B.clustal.txt File:Heidelberg Sequencing Result pHM04 VF2 colony 6B VF2 VF 2.clustal.txt
I 6C	-	(9 deletion)	File:Heidelberg Sequencing Result pHM04 DN07 colony I6C.clustal.txt
I 6D	-	Deletion	File:Heidelberg Sequencing Result pHM04 DN07 colony I6D.clustal.txt
I 7H	-	Deletion	File:Heidelberg Sequencing Result pHM04 DN07 colony I7H.clustal.txt
I 8G	-	Deletion	File:Heidelberg Sequencing Result pHM04 DN07 colony I8G.clustal.txt
I 8B	-	Deletion of G in coding sequence	discarded
I 10B	-	Deletion of G in coding sequence	discarded
I 10G	-	Insertion of G in coding sequence	discarded
I 11F	-	Deletion of G in coding sequence	discarded
II 3G	-	G Deletion of the ATG (start-codon) and 3 bp later deletion of C	discarded
II 4E	-	Deletion of G in coding sequence	discarded
II 7G	-	G Deletion of the ATG (start-codon) and 3 bp later deletion of C	discarded

Because the colony 6B is possibly positive, the next steps are:

1. SDS-PAGE

2. Sequencing over gibson-assembled parts

3. Triple electroporation with the plasmig of Del-rest and MalonylCoA (see lab book Delftibactin)

Amplification of Backbone pSB6A1

PCR Conditions BB.W20.A

Reagent	BB pSB6A1	BB pSB6A1
Expected length [Kb]	4.4	4.4
Template	0.5 µl pSB6A1 30-8	0.5 µl pSB6A1 30-8
Primer 10 µM fw	2 µl HM_17	2 µl HM_17
Primer 10 µM rev	2 µl FS_77	2 µl FS_77
Phusion Flash Master Mix (2x)	10 µl	10 µl
DMSO	1 µl	1 µl
ddH₂O	4.5 µl	4.5 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
12	98	1
	68↓	5
	72	3:00 min
18	98	1
	66	5
	72	3:00 min
1	72	5:00 min
1	4	inf

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
30	72	3:00 min
1	72	5:00 min
1	4	inf

Result

Expected band: 4.4 Kb

Fig.20.15. Amplification of BB pSB6A1 with new primer and primer HM17 (loaded 20 µL of PCR)
l1:2 log ladder,l2:BB amplified HM17 and FS77 (68td),l3:BB amplified HM17 and HM20 (68td),l4: BB amplified HM17 and FS77 (2step),l5: BB amplified HM17 and HM20 (2step) - no yield

Very weak amplification, Primer-Dimers/Oligomers, carry over of Backbone pSB6A1 (including mRFP and therefore creating a double band, since template is 700bp longer than expected PCR product).

=> Repeat PCR with less stringent conditions to increase yield until unexpected bands appear or yield is high enough and reduce amount of template DNA (use 0.5 µL of a 1:10 delution)

=>Furthermore, elongation time was reduced, as template is only about 4.4 Kb long instead of the putative 7 Kb.

PCR Conditions BB.W20.B

Reagent	BB pSB6A1	BB pSB6A1
Expected length [Kb]	4.4	4.4
Template	0.5 µl pSB6A1 (3 ng/µL)	0.5 µl pSB6A1 (3 ng/µL)
Primer 10 µM fw	2 µl HM_17	2 µl HM_17
Primer 10 µM rev	2 µl FS_77	2 µl FS_77
Phusion Flash Master Mix (2x)	10 µl	10 µl
DMSO	1 µl	1 µl
ddH₂O	4.5 µl	4.5 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
12	98	1
	66↓	5
	72	80
18	98	1
	64	5
	72	80
1	72	5:00 min
1	4	inf

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
30	58	5
72	80
1	72	5:00 min
1	4	inf

Result

Expected band: 4.4 Kb

Fig.20.16. Amplification of BB pSB6A1 with new primer and primer HM17 with different PCR conditions(loaded 20 µL of PCR)
l1:2 log ladder,l2:BB amplified HM17 and HM20 (66°C),l3:BB amplified HM17 and FS77 (66°C),l4:BB amplified HM17 and HM20 (58°C), l5:BB amplified HM17 and FS77 (58°C) - l4-5 show the expected band at 4.4 KB

Gel shows best amplification of fragment using annealing temperature at 58°C.

=> Repetition of PCR at a constant annealing temperature of 58°C.

PCR Conditions BB.W20.C

Performed 6x PCR with FS77 & 6x PCR with HM20, so we have enough yield for the Gibson assembly.

Reagent	BB pSB6A1	BB pSB6A1
Expected length [Kb]	4.4	4.4
Template	0.5 µl pSB6A1 (3 ng/µL)	0.5 µl pSB6A1 (3 ng/µL)
Primer 10 µM fw	2 µl HM_17	2 µl HM_17
Primer 10 µM rev	2 µl FS_77	2 µl FS_77
Phusion Flash Master Mix (2x)	10 µl	10 µl
DMSO	1 µl	1 µl
ddH₂O	4.5 µl	4.5 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
	58	5
	72	80
1	72	5:00 min
1	4	inf

Result

Expected band: 4.4 Kb

Fig.20.17. Amplification of BB pSB6A1 with new primer and primer HM17 with a constant annealing temperature at 58°C(loaded 20 µL of PCR)
l1:2 log ladder,l2-7:BB amplified HM17 and FS77,l8-13:BB amplified HM17 and HM20 - no bands visible

Gel does not show the expected bands.

=> What happened? Why is it not reproducible? Run a PCR with other conditions.

PCR Conditions BB.W20.D

Reagent	BB pSB6A1	BB pSB6A1
Expected length [Kb]	4.4	4.4
Template	1 µl pSB6A1 (3 ng/µL)	1 µl pSB6A1 (3 ng/µL)
Primer 10 µM fw	2 µl HM_17	2 µl HM_17
Primer 10 µM rev	2 µl FS_77	2 µl FS_77
Phusion Flash Master Mix (2x)	10 µl	10 µl
ddH₂O	5.0 µl	5.0 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
12	98	1
	60↓	5
	72	80
18	98	1
	68	5
	72	80
1	72	5:00 min
1	4	inf

Result

Expected band: 4.4. Kb

Fig.20.18. Amplification of BB pSB6A1 with new primer and primer HM17 with a td PCR (60°C) and a constant annealing temperature of 68°C(loaded 20 µL of PCR)
l1:2 log ladder,l2:BB amplified HM17 and FS77,l3:BB amplified HM17 and HM20 - no yield

Gel shows again no amplification of backbone.

=> Further optimize PCR conditions.

PCR Conditions BB.W20.E

Reagent	BB pSB6A1	BB pSB6A1
Expected length [Kb]	4.4	4.4
Template	0.5 µl pSB6A1 (3 ng/µL)	0.5 µl pSB6A1 (3 ng/µL)
Primer 10 µM fw	1 µl HM_17	1 µl HM_17
Primer 10 µM rev	1 µl FS_77	1 µl FS_77
Phusion Flash Master Mix (2x)	10 µl	10 µl
DMSO	1	1
ddH₂O	6.5 µl	6.5 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
	58	5
	72	80
1	72	5:00 min
1	4	inf

Cycles	Temperature [°C]	Time [s]
1	98	10
12	98	1
	66↓	5
	72	1:20 min
18	98	1
	64	5
	72	80
1	72	5:00 min
1	4	inf

Result

Expected band: 4.4 Kb

Fig.20.19. Amplification of BB pSB6A1 with new primer and primer HM17 (loaded 20 µL of PCR)
l1:2 log ladder,l2:BB amplified HM17 and HM20 (66td),l3:BB amplified HM17 and FS77 (66td),l4: BB amplified HM17 and HM20 (58°C),l5: BB amplified HM17 and FS77 (58°C) - l4-5 show specific band - was cut out

Gel shows amplification using new HM17.

=> Fragments were cut and gel extracted.

PCR Conditions BB.W20.F

Run 6x PCR with HM20 and 6x PCR with FS77 for higher yield

Reagent	BB pSB6A1	BB pSB6A1
Expected length [Kb]	4.4	4.4
Template	0.5 µl pSB6A1 (3 ng/µL)	0.5 µl pSB6A1 (3 ng/µL)
Primer 10 µM fw	1 µl HM_17	1 µl HM_17
Primer 10 µM rev	1 µl FS_77	1 µl FS_77
Phusion Master Mix (2x)	10 µl	10 µl
DMSO	1	1
ddH₂O	6.5 µl	6.5 µl

Cycles	Temperature [°C]	Time
1	98	10
30	98	1
	58	5
	72	80
1	72	5:00 min
1	4	inf

The PCR was direcly digested with DpnI afterwards.

Restriction Digest with DpnI

10 of the 12 PCRs (5x FS & 5x HM) were cut with DpnI. There we used the exact PCR product as generated earlier.
Incubated at 37°C ON
The following table presents the amount for all reactions

Sample	Buffer	Enzyme	ddH₂O
10x 20 µl PCR	10x 2.5 µl CutSmart Buffer	2.5 µl DpnI	23 µl

Afterwards, a 0.8% gel was run for 1 h at 100 V and a gel-purification was performed with the Qiagen Gel Extraction Kit

Result

Expected band: 4.4 Kb

Fig.20.21. Restriction digested BB pSB6A1 with new primer and primer HM17 at an annealing temperature of 58°C (loaded 20 µL of PCR)
l1:2 log ladder,l2-7:BB amplified HM17 and FS77,l8-13:BB amplified HM17 and HM20 - specific band at 4 Kb

Fig.20.20. Restriction digested BB pSB6A1 with new primer and primer HM17 at an annealing temperature of 58°C (loaded 20 µL of PCR)
l1:2 log ladder,l2-7:BB amplified HM17 and FS77,l8-13:BB amplified HM17 and HM20 - specific band at 4 Kb

Gel shows expected bands.

=> Fragments were gel extracted.

Sample	DpnI digested	Concentration [ng/µl]
BB 16 (amplified with FS77)	yes	6.2
BB 16 (amplified with HM20)	yes	6.6

Generation of DelH Plasmid pHM04 15-09

Gibson Assembly

Fragment	Concentration [ng/µl]	Amount with BB16 (FS77) [µl]	Amount with BB16 (HM20) [µl]
DN11-FS66	172.5	0.78	0.81
FS67-FS68	120.7	0.95	0.99
FS69-FS70	211.3	0.94	0.98
FS71-HM08	146	0.55	0.57
BB16 amplified with FS77	6.2	6.78	-
BB16 amplified with HM20	6.6	-	6.64

Incubate for 1h at 50°C

Electroporation

Afterwards, 5 µl of each Gibson assembly were taken out and 10 µl ddH₂O was added
With 10 µl of the Gibson assembly, isopropanol purification was performed
6 different electroporations were performed (see scheme below)

Electroporation name	Inserted amount of Gibson Assembly	Plated out on agar plates
HM20 1	1 µl (Gibson + ddH₂O)	* 10 µl * rest
HM20 14	14 µl (Gibson + ddH₂O)	* 10 µl * rest
HM20 20	20 µl (isopropanol purified)	* 10 µl * rest
FS77 1	1 µl (Gibson + ddH₂O)	* 10 µl * rest
FS77 14	14 µl (Gibson + ddH₂O)	* 10 µl * rest
FS77 20	20 µl (isopropanol purified)	* 10 µl * rest

Overview
Lab book

Results

Colonies	Alignment File	Sequence
I C5	File:Heidelberg Sequencing Result pHM04 DN07 colony 05 old.clustal.txt	Amino Acid Substitution
I C7	sequencing insufficient	-
I C12	sequencing insufficient	-

Vector Maps and Primers

As pointed out before, we ordered new shorter and HPLC purified primers for the assembly of pHM04 as well as for the mutagenesis.

Vector map of the PHM04-DelH-pSB6A1(without mRFP) Gibson plasmid.

Identifier	Order date	Note	Sequence
HM_20:BB_HPLC_rev	11-09-2013	HPLC version of HM11 Gibson-Primer rev, amplify the Backbone with overlap with the RBS and the lacI-promotor and it creates and overlap to the start of DelH	GATTTGGCGCAGGCGGCCACGGTCCATctagtatttctcctctttc
FS_77:BB_HPLC_rev	11-09-2013	Gibson-Primer rev, amplify the Backbone with overlap with the RBS and the lacI-promotor and it creates and overlap to the start of DelH	GCGATTTGGCGCAGGCGGCCACGGTCCATCTAGTATTTCTCCTCTTTC
HM21:fw_lacI_BbsI_Xba	2013-09-15	Forward primer for cutting out mutated fragment for mutagenesis	TTTTGAAGACAA CTAGGCAATACGCAA
HM22:rev_RBS	2013-09-15	Reverse Primer in RBS for mutagenesis	TTTTGAAGACAA CTCTTTCTCTAGTATGTGTGAAATTG
HM23:fw_RBS	2013-09-15	Forward Primer in RBS for mutagenesis	TTTTGAAGACAA AGAGGAGAAATACTAGATGGACCGTGGC
HM24:rev_BbsI_MfeI	2013-09-15	Reverse primer for cutting out mutated fragment for mutagenesis	TTTTGAAGACAA AATTGGACAGCGCGGCATGCCGGTTG

16-09 - 22-09-13

Generation of DelH Plasmid pHM04 15-09

Colony-PCR Conditions CP.W21.A

Template	96x 1 picked colony
Expected length [bp]	663
Named	1A - 12H
Primer fw 10 µM	100x 2 µl VF2
Primer rev 10 µM	100x 2 µl DN07
iTaq Polymerase (2x)	100x 10 µl
ddH₂O	96x 6 µl

Cycles	Temperature DelH [°C]	Time [s]
1	95	120
12	95	30
	68 (touchdown -0.5°C)	30
	72	45
18	95	30
	65	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.21.4 Colony PCR of Gibson assembled DelH-BB without mRFP 96 well plate I (loaded 10 µL of PCR)
l1:50 bp ladder, l2-l26:colonies 10A-12H

Fig.21.3 Colony PCR of Gibson assembled DelH-BB without mRFP 96 well plate I(loaded 10 µL of PCR)
l1:50 bp ladder, l2-l26:colonies 7C-9H

Fig.21.2 Colony PCR of Gibson assembled DelH-BB without mRFP 96 well plate I (loaded 10 µL of PCR)
l1:50 bp ladder, l2-l26:colonies 4B-7B

Fig.21.1 Colony PCR of Gibson assembled DelH-BB without mRFP 96 well plate I(loaded 10 µL of PCR)
l1:50 bp ladder, l2-l26:colonies 1A-4A

The following colonies seem positive, because they show the expected band at 663 bp.

Picture	Positive colonies
21.1	1B, 1C, 1E, 1F, 1H, 2A, 2B, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3F, 3G
21.2	4A, 4C, 4D, 4G, 5A, 5B, 5C, 5D, 5E, 6A, 6B, 6C, 6E, 6F
22.3	7A, 7B, 7C, 7D, 8A, 8B, 8C, 9A, 9E, 9F
22.4	11 A, 11E, 11G, 11H, 12D, 12E

Test Restriction Digest

24 of these positive screened colonies were minipreped and digested with PvuI

Sample	CutSmartBuffer	PvuI
8.5 µl of colonies	1 µl	0.5 µl

Another restriction digest was performed. Colony 7D was digested with EcoRI-HF

Sample	CutSmartBuffer	EcoRI-HF
8.5 µl of colony 7D	1 µl	0.5 µl

Result

Expected bands: 11,621, 8,690 and 2,685 bp (PvuI) and 17,801 and 5,105 bp (EcoRI)

Fig.21.5 restriction digest of positive colonies with PvuI (loaded 10 µL of PCR)
l1:2 log ladder, l2-l13:colonies 1E-11E

None of the analyzed clones shows correct band pattern.

=> Clones are discarded.

Amplification of Backbone

New Template

Because the backbone amplification yield from pSB6A1 + BBa_J04450 from Spring distribution 2012 (plate 1, well K1) was so low and the screening did not result in positive restriction digests with PvuI or EcoRI, we go a step back and transform E.coli ToP10 with a new pSB6A1 part from the 2013 distribution. Therefore, we transform on the one hand with the part on plate 2 well 2L and on the other hand with the part from the plate 5 well 1K from the Spring 1023 diestricbution.
Aditionally we ran a PCR directly from the two wells with the backbone primers (HM20, HM17 & FS77).

PCR Conditions BB.W21.A

Amplification of pSB6A1 directly from the parts registry
1x PCR with HM_20 and 1x PCR with FS_77

Reagent	BB pSB6A1	BB pSB6A1	BB pSB6A1	BB pSB6A1
Expected length [Kb]	4.4	4.4	4.4	4.4
Template	1 µl pSB6A1 plate 5, well K1	1 µl pSB6A plate 2, well L2	1 µl pSB6A1 plate 5, well K1	1 µl pSB6A plate 2, well L2
Primer 10 µM fw	1 µl HM_17	1 µl HM_17	1 µl HM_17	1 µl HM_17
Primer 10 µM rev	1 µl FS_77	1 µl FS_77	1 µl HM_20	1 µl HM_20
Phusion Flash Master Mix (2x)	10	10	10	10
DMSO	1	1	1	1
ddH₂O	6	6	6	6

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
	58	5
	72	80
1	72	5:00 min
1	4	inf

Result

Expected band: 4. Kb

Fig.21.7 Amplification of backbone pSB6A1 directly from two wells (loaded 10 µL of PCR)
l1:2log ladder, l2HM20 aus 1K, l3FS77 aus 1K, l4HM20 aus 2L, l5FS77 aus 2L - was cut out

Fig.21.6 Amplification of backbone pSB6A1 directly from two wells (loaded 10 µL of PCR)
l1:2log ladder, l2HM20 aus 1K, l3FS77 aus 1K, l4HM20 aus 2L, l5FS77 aus 2L

Amplification worked with the template pSB6A1 from the biobrick distribution 2013 plate 2, well L2.

=> The fragment was gel extracted with QIAquick gel extraction kit, digested with DpnI, and gel extracted again, resulting in final concentrations of 10.7 ng/µl for FS_77 and 4.8 ng/µL for HM_20

=> PCR will be repeated with several samples from the colonies transformed with pSB6A1 from the biobrick distribution 2013 plate 2, well L2

PCR Conditions BB.W21.A

Amplification of backbone fragment pSB6A1 from colonies of DH10ß, transformed with pSB6A1 from the biobrick distribution 2013 plate 2, well L2
4x PCR with HM_20 and 4x PCR with FS_77

Reagent	BB pSB6A1	BB pSB6A1
Expected length [Kb]	4.4	4.4
Template	colony of DH10B transformed with pSB6A1 plate 5, well K1	colony of DH10B transformed with pSB6A1 plate 5, well K1
Primer 10 µM fw	1 µl HM_17	1 µl HM_17
Primer 10 µM rev	1 µl FS_77	1 µl FS_77
Phusion Master Mix (2x)	10	10
DMSO	1	1
ddH₂O	6	6

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
	58	5
	72	80
1	72	5:00 min
1	4	inf

Result

Expected band: 4.4 Kb

Fig.21.9 Amplification of backbone pSB6A1 from colony transformed with pSB6A1 from biobrick distribution 2013 plate 2, well L2
l1:2log ladder, l2 FS_77, l3HM20 after DpnI digest - was cut

Fig.21.8 Amplification of backbone pSB6A1 from colony transformed with pSB6A1 from biobrick distribution 2013 plate 2, well L2
l1:2log ladder, l2 FS_77, l3HM20 after DpnI digest

Gel shows amplification of fragment.

=> Fragment was cut and gel extracted, then DpnI digested and gel purified again.

Generation of DelH Plasmid pHM04 18-09

Gibson Assembly

Fragment	Concentration [ng/µl]	Amount with BB16 (FS77) [µl]	Amount with BB16 (HM20) [µl]
DN11-FS66	172.5	1.77	1.84
FS67-FS68	120.7	2.15	2.24
FS69-FS70	211.3	2.12	2.21
FS71-HM08	146	1.24	1.30
BB16 amplified with FS77	43.1	2.72	-
BB16 amplified with HM20	35.8	-	2.42

Incubate for 1 h at 50°C

Electroporation

Afterwards 3 µl of each Gibson assembly were taken and 2 µl ddH₂O were added
With 17 µl of the Gibson assembly, isopropanol purification was performed, DNA was eluted in 20 µl ddH₂O
6 different electroporations in E.coli BL21 DE3 were performed and grown at RT (see scheme below)

Electroporation name	Inserted amount of Gibson Assembly	Plated out on agar plates
HM20 1	3 µl (Gibson + ddH₂O)	* 10 µl * rest
HM20 20	20 µl (isopropanol purified)	* 10 µl * rest
FS77 1	1 µl (Gibson + ddH₂O)	* 10 µl * rest
FS77 20	20 µl (isopropanol purified)	* 10 µl * rest

Colony-PCR CP.W21.A

Template	96x 1 picked colony
Expected length [bp]	663
Named	1A - 12H DelH I
Primer fw 10 µM	100x 2 µl VF2
Primer rev 10 µM	100x 2 µl DN07
One-Taq Polymerase (2x)	100x 10 µl
ddH₂O	96x 6 µl

Cycles	Temperature [°C]	Time [s]
1	95	120
12	95	30
	68 (touchdown -0.5°C)	30
	72	45
18	95	30
	65	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.21.13 Colony PCR of Gibson assembled DelH-BB without mRFP 96 well plate I (loaded 4 µL of PCR)
l1:2-log ladder, l2-l26:colonies G4-H12

Fig.21.12 Colony PCR of Gibson assembled DelH-BB without mRFP 96 well plate I(loaded 4 µL of PCR)
l1:2-log ladder, l2-l26:colonies E3-G3

Fig.21.11 Colony PCR of Gibson assembled DelH-BB without mRFP 96 well plate I (loaded 4 µL of PCR)
l1:2-log ladder, l2-l26:colonies C2-E2

Fig.21.10 Colony PCR of Gibson assembled DelH-BB without mRFP 96 well plate I(loaded 4 µL of PCR)
l1:2-log ladder, l2-l26:colonies A1-C1

The following colonies seem positive, because they show the expected band at 663 bp

Picture	Positive colonies
21.12	-
21.13	C3, C5, C7, C11, C12, D1, D2, D3, D5, D6, D7, D8, D9, D12
21.14	E2, E9, F4, F11
21.15	G3, G6, G11, G12, H6, H8, H11

Colony-PCR CP.W21.B

Template	96x 1 picked colony
Expected length [bp]	663
Named	1A - 12H, DelH II
Primer fw 10 µM	100x 2 µl VF2
Primer rev 10 µM	100x 2 µl DN07
One-Taq Polymerase (2x)	100x 10 µl
ddH₂O	96x 6 µl

Cycles	Temperature [°C]	Time [s]
1	95	120
12	95	30
	68 (touchdown -0.5°C)	30
	72	45
18	95	30
	65	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.21.17 Colony PCR of Gibson assembled DelH-BB without mRFP 96 well plate II (loaded 4 µL of PCR)
l1:2-log ladder, l2-l26:colonies G1-H12

Fig.21.16 Colony PCR of Gibson assembled DelH-BB without mRFP 96 well plate II (loaded 4 µL of PCR)
l1:2-log ladder, l2-l26:colonies E1-F12

Fig.21.15 Colony PCR of Gibson assembled DelH-BB without mRFP 96 well plate II (loaded 4 µL of PCR)
l1:2-log ladder, l2-l26:colonies C1-D12

Fig.21.14 Colony PCR of Gibson assembled DelH-BB without mRFP 96 well plate II(loaded 4 µL of PCR)
l1:2-log ladder, l2-l26:colonies A1-B12

The following colonies seem positive, because they show the expected band at 663 bp

Picture	Positive colonies
21.16	A6, A7, A10, B2, B6
21.17	C2, C4, C6, C8, C9, C10, D2, D3, D8, D9
21.18	E7, E8, E9, E10, F6
21.19	G1, G3, G6, G7, G9, G10, H2, H3, H8, H11

Test Restriction Digest

The positive screened colonies were digested with PvuI.

Template DNA	CutSmart Buffer	PvuI	ddH₂O	Total Volume
8.5 µl 1 µl	0.5 µl	-	10 µl

Result

Expected bands: 11,621, 8,628 & 2,685 bp

Fig.21.20 Test digest with PvuI (loaded 10 µL of PCR)
l1: 2log ladder, l2: II B7,l3: II G3, l4: II G10, l5:II H2

Fig.21.19 Test digest with PvuI (loaded 10 µL of PCR)
l1: 2log ladder, l2: E2,l3: F4, l4: F9, l5: F11, l6: G6,l7: G11, l8: G12 l9: H6, l10: H8,l11: H11A, l12:H11B, l13:II B6

Fig.21.18 Test digest with PvuI (loaded 10 µL of PCR)
l1: 2log ladder, l2: C3,l3: C5, l4: D1, l5: C7, l6: C11,l7: C12, l8: D3, l9: D5, l10: D7,l11: D8, l12:D9, l13:D12

The following colonies show the correct pattern:

Colonies	Positive in Digest	Concentration in Midiprep [ng/µl]
I C5	+	454
I C7	+	1312
I C12	+	5995
I G11	+	3887
II A6	+	1017
II D2	+	926

Sequencing

Clones C5, C7, C12, G11, II A6 and II D2 were send for sequencing with VF2.

Result

Colonies	Alignment File
I C5	File:Heidelberg Sequencing Result pHM04 DN07 colony 05 old.clustal.txt
I C7	sequencing insufficient
I C12	sequencing insufficient
I G11	discarded
II A6	discarded
II D2	discarded

Amplification of Backbone

PCR Conditions BB.W21.B

Amplification of backbone parts registry well 2L, transformed 19-09 using HPLC purified HM11

Reagent	HM11
Template	1 µl of minipreped pSB6A1 (2L)
Primer fw 10 µM	2 µl HM11
Primer rev 10 µM	2 µl HM17
Phusion Flash Ready Mix	10 µl
ddH₂O	5 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	68 (touchdown -0,5°C)	5
	72	90
18	98	1
	68	5
	72	90
1	72	5 min
1	4	inf

Result

Expected band: 4.4 Kb

Fig.21.21 gel of amplified BB with HM11 (loaded 20 µL of PCR)
l1: BB amplified with HM11 HPLC-purified at 68°C td l2: 2log
no product

Gel does not show amplified backbone fragment.

=> Further optimize PCR conditions.

PCR Conditions BB.W21.C

Reagent	HM11
Template	1 µl of minipreped pSB6A1 (2L)
Primer fw 10 µM	2 µl HM11
Primer rev 10 µM	2 µl HM17
Phusion Flash Ready Mix	10 µl
ddH₂O	5 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	68	5
	72	90
1	72	5 min
1	4	inf

Result

Expected band: ~ 4.4 Kb

Fig.21.22 Gel of BB amplified with HM11: l1:2 log ladder, l2: BB without DMSO, l3: BB with DMSO

Gel shows strong and specific amplification of backbone.

=> Fragments were cut and gel isolated.

Generation of DelH Plasmid pHM04 20-09

Gibson Assembly

Fragment	Concentration [ng/µl]	Amount with BB16 (FS77) [µl]	Amount with BB16 (HM20) [µl]
DN11-FS66	172.5	1.77	1.84
FS67-FS68	120.7	2.15	2.24
FS69-FS70	211.3	2.12	2.21
FS71-HM08	146	1.24	1.30
BB16 amplified with FS77	43.1	2.72	-
BB16 amplified with HM20	35.8	-	2.42

Incubate for 1 h at 50°C

Electroporation

Afterwards 3 µl of each Gibson assembly were taken and 2 µl ddH₂O were added
With 17 µl of the Gibson assembly, isopropanol purification was performed, DNA was eluted in 20 µl ddH₂O
6 different electroporations in E.coli DH10ß were performed and grown at RT (see scheme below)

Electroporation name	Inserted amount of Gibson Assembly	Plated out on agar plates
HM20 1	3 µl (Gibson + ddH₂O)	* 10 µl * rest
HM20 20	20 µl (isopropanol purified)	* 10 µl * rest
FS77 1	1 µl (Gibson + ddH₂O)	* 10 µl * rest
FS77 20	20 µl (isopropanol purified)	* 10 µl * rest

New HPLC Purified Primers

As pointed out before, we suspect DelH to be toxic for E. coli and therefore, only colinies containing mutated constructs survive. To avoid this, we ordered new shorter and HPLC purified primers for the assembly of pHM04.

Vector map of the PHM04-DelH-pSB6A1(without mRFP) Gibson plasmid.

Identifier	Order date	Note	Sequence
HM_20:BB_HPLC_rev	11-09-2013	HPLC version of HM11 Gibson-Primer rev, amplify the Backbone with overlap with the RBS and the lacI-promotor and it creates and overlap to the start of DelH	GATTTGGCGCAGGCGGCCACGGTCCATctagtatttctcctctttc
FS_77:BB_HPLC_rev	11-09-2013	Gibson-Primer rev, amplify the Backbone with overlap with the RBS and the lacI-promotor and it creates and overlap to the start of DelH	GCGATTTGGCGCAGGCGGCCACGGTCCATCTAGTATTTCTCCTCTTTC

Mutagenesis of DelH clones I 6B and 15

Strategy

As our clones which have the DelH construct keep on having mutations and deletions we decided to fix this problem by carrying out site-directed mutagenesis. The targeted mutations are the deletion of parts of the ribsome binding site in clone I6B and the deletion at the beginning of DelH in clone 15. For this we make use of two restriction enzymes (MfeI & XbaI) which both only cut in the construct once. By this we excise the fragment with the mutation. The larger fragment (17.3 kbp) without mutation is kept.
Furthermore we ordered four new primers. The smaller fragment is then PCR amplified with those primers in two fragments. Primer HM22 and HM23 cure the mutations. With those primers also recognitions sites for the restriction enzyme BbsI are introduced, which is needed for religation of the two fragments. BbsI cuts two basepair after its recognition site.

HM21 and HM24 are the corresponding primer. They introduce XbaI and MfeI sites as well as in each on BbsI recognition site. Those are needed for religation.

In the end the two fragments are both digested with BbsI. In the adjacent ligation the two fragments can ligate together due to the BbsI recognition sites. Furthermore BbsI opens the introduced MfeI and XbaI sites through which the two fragments can ligate with the digested 17.3 kb fragment.

However the XbaI site is not introduced correctly again. Therefore we can test if the mutagenesis had been successful by digesting with XbaI. If the site is not present anymore we successfully got rid of the mutations.

New Primers

Identifier	Order date	Note	Sequence
HM21_fw_lacI_BbsI_Xba	2013-09-15	Forward primer for cutting out mutated fragment for mutagenesis	TTTTGAAGACAA CTAGGCAATACGCAA
HM22_rev_RBS	2013-09-15	Reverse Primer in RBS for mutagenesis	TTTTGAAGACAA CTCTTTCTCTAGTATGTGTGAAATTG
HM23_fw_RBS	2013-09-15	Forward Primer in RBS for mutagenesis	TTTTGAAGACAA AGAGGAGAAATACTAGATGGACCGTGGC
HM24_rev_BbsI_MfeI	2013-09-15	Reverse primer for cutting out mutated fragment for mutagenesis	TTTTGAAGACAA AATTGGACAGCGCGGCATGCCGGTTG

Purification of Midiprep of Clone I6B

Fig.21.23 Midipreps of colonies I6B and 15

As can be seen in figure 21.23, the midi-prep of colony I 6B is contaminated. Thus, we tried to purify only the largest band by gel extraction with the QIAEX II Gel Extraction Kit (Qiagen). The procedure was as following:

Application of 2 µl of midiprep on gel (4596.7 ng/µl --> ~10 µg)
Excision of band at about 17.4 kb
Gel extraction of DNA with QIAEX II Gel Extraction Kit (Qiagen)

Result

The concentration of the purified fragment was only 4.7 ng/µl after extraction.

=> We are trying to elute again.

The second elution did not work either

Amplification of HM23 to HM24

1x 20 µl for each colony

Template	0.2 µl of either midiprep colony I6B or 15
Expected length [kbp]	5.3
Named	I6B or 15 HM23-HM24
Primer fw 10µM	2 µl HM23
Primer rev 10 µM	2 µl HM24
Phusion Flash (2x)	10 µl
ddH₂O	5 µl

Cycles	Temperature [°C]	Time [s]
1	98	10 s
12	98	1
	68 (touchdown -0.5°C)	5
	72	1:50 min
18	98	1
	65	5
	72	1:50 min
1	72	7 min
1	12	inf

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
	69	5
	72	1:50 min
1	72	7 min
1	12	inf

Template	0.2 µl of either midiprep colony I6B or 15
Expected length [kbp]	5.3
Named	I6B or 15 HM23-HM24
Primer fw 10µM	2 µl HM23
Primer rev 10 µM	2 µl HM24
Phusion Flash (2x)	10 µl
ddH₂O	4 µl
DMSO	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	10 s
30	98	1 s
30	72	1:40 min
1	72	7 min
1	12	inf

Result

Gels for amplification of HM23 to HM24

Fig.21.24	Fig.21.25	Fig.21.26	Fig.21.27
Fig.21.28	Fig.21.29

Amplification of HM21 to HM22

Template	0.2 µl of either midiprep colony I6B or 15
Expected length [kbp]	200 bp
Named	I6B or 15 HM21-HM22
Primer fw 10µM	2 µl HM21
Primer rev 10µM	2 µl HM22
Phusion Flash (2x)	10 µl
ddH₂O	5 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
	63	5
	72	10
1	72	5 min
1	12	inf

Result

Gels for amplification of HM21 to HM22

Fig.21.30

Fig.21.31

Restriction Digest of pHM04 (I6B) with XbaI and MfeI

Reagent	Volume [µl]
Midiprep colony I6B or 15	0.5
Cutsmart buffer	2
XbaI	1.5
MfeI-HF	1.5
ddH₂O	14.5

Incubation for 2 h at 37°C

Result

Expected band pattern: 17.3 kbp, 5.3 kbp

Gels for restriction Digest of pHM04 (I6B) with XbaI and MfeI

Fig.21.32

Fig.21.33

Fig.21.34

Fig.21.35

The MfeI already expired in 2011

=> We will test digest the construct again with a new enzyme

Restriction Digest of pHM04 (I6B) with XbaI and MfeI

Reagent	Volume [µl]
Midiprep colony I6B or 15	0.5
Cutsmart buffer	5
XbaI	1.5
MfeI-HF	1.5
ddH₂O	14.5
Incubation for 2 h at 37°C	Expected band pattern: 17.3 kbp, 5.3 kbp

Reagent	Volume [µl]
Midiprep colony I6B purified 1:10	1
Cutsmart buffer	2
XbaI	1
MfeI-HF	1
ddH₂O	15
Incubation at room temperature, over night	Expected band pattern: 17.3 kbp, 5.3 kbp

Result

Due to the contamination in DelH it was not possible to decide whether the fragment really had been digested. Thus we have to test whether MfeI Cutting site is really present.

Test for MfeI Cutting Site

Fig.21.36 Test if MfeI restriction site is present

Reagent	Volume [µl]
Midiprep colony I6B	0.5
Cutsmart buffer	2
NotI-HF	1
ddH₂O	16.5

Reagent	Volume [µl]
Midiprep colony I6B	0.5
Cutsmart buffer	2
NotI-HF	1
MfeI-HF	1
ddH₂O	15.5

Incubation at room temperature over night.
--> As the upper band is lower for the digest with both enzymes the MfeI restriction site is apparently present. Therefore the mutagenesis is tried.

Restriction Digest of Fragment HM21-HM22 (I6B) and HM23-HM24 (I6B) with BbsI

PCR fragments: HM21-HM22 (36.6 ng/µl) and HM23-HM24 (32.4 ng/µl)

Reagent	Volume [µl]
PCR fragment	20
2.1 buffer	5
BbsI	1
ddH₂O	24

Ligation of Digested pHM04 (I6B), HM21-HM22 and HM23-HM24

Reagent	Volume [µl]
digested and purified pHM04 (I6B)	3
digested HM21-HM22	0.5
digested HM23-HM24	0.5
T4 ligase buffer	2
T4 ligase	1
ddH₂O	13

Transformation of Ligation

1 µl and 5 µl were transformed in 50 µl electrocompetent DH10β each by electroporation. The cells were recovered in 400 µl SOC media and plated on LB Amp.

Overview
Lab book

Results

Colonies	Alignment File	Sequence
III F7	File:Heidelberg Sequencing Result pHM04 VF2 colony DH10b F7.clustal.txt	Mutation
III F9	File:Heidelberg Sequencing Result pHM04 VF2 colony DH10b F9.clustal.txt	Mutation
III G3	File:Heidelberg Sequencing Result pHM04 VF2 colony DH10b G3.clustal.txt	Mutation
III G4	File:Heidelberg Sequencing Result pHM04 VF2 colony DH10b G4.clustal.txt	Mutation

Vector Maps and Primers

Strategy A: weak Promotor, weak RBS
Expression of the possibly toxic DelH module on pFS02 is minimized by usage of a weak promoter: BBa_J23114 as well as a weak RBS: BBa_0032.

Vector map of the weak promotor and weak RBS DelH plasmid pFS02 (pSB6A1_BBa_J23114_BBa_B0032_DelH) Gibson plasmid.

Identifier	Order date	Note	Sequence
FS_78:BB_HPLC_rev	26-09-2013	Gibson-Primer rev, amplify the Backbone pSB6A1 introducing the RBS BBa_B0032 and the promotor BBa_J23114 and creating an overlap to the first fragment of DelH amplified with primer DN_11	GATTTGGCGCAGGCGGCCACGG TCCATCTAGTACTTTCCTGTGTGACTCTA GAGCTAGCATTGTACCTAGGACTGAGCT AGCCATAAACTCTAGAAGCGGCCGCGAATTC
FS_84:BB_HPLC_fw	26-09-2013	Gibson-Primer fw to amplify first fragment of DelH introducing the RBS BBa_B0032 and creating an overlap to primer FS_85 thereby partially introducing the promotor BBa_J23114	GCTCAGTCCTAGGTACAATGCTAGC TCTAGAGTCACACAGGAAAGTACTAGATGGA CCGTGGCCGCCTGCG
FS_85:BB_HPLC_rev	26-09-2013	Gibson-Primer rev to amplify the Backbone pSB6A1, partially introducing the promotor BBa_B0032 with overlap to primer FS_84 and therefore the promotor BBa_J23114, it creates an overlap to the beginning of DelH	GCGATTTGGCGCAGGCGGCCACGGT CCATCTAGTATTTCTCCTCTTTC

Strategy B: ccdB Construct
Selection for mutated and thus truncated DelH sequences will be minimized by using a ccdB strategy. DelH will be integrated in a pSB4K5 backbone flanked by KpnI and BamHI sites (pFS02). The pSB6A1 backbone will be assembled with a ccdB cassette flanked by KpnI and BamHI sites (pFS03). The final DelH plasmid will be assembled by restriction - ligation of pFS02 and pFS03 to pFS05.

Identifier	Order date	Note	Sequence
FS_85:BB_HPLC_rev	26-09-2013	Gibson-Primer rev to amplify the Backbone pSB6A1, partially introducing the promotor BBa_B0032 with overlap to primer FS_84 and therefore the promotor BBa_J23114, it creates an overlap to the beginning of DelH	GCGATTTGGCGCAGGCGGCCACGGTCCATCTAGTATTTCTCCTCTTTC
FS_86:BB_HPLC_rev	26-09-2013	Gibson-Primer rev to amplify the Backbone pSB4K5 without any promotor introducing a KpnI cutting site for restriction cloning, creates an overlap to DelH and will be used for the ccdB strategy	GGCGATTTGGCGCAGGCGGCCACGGTCCATGTACTTCGAGTCACTAAGGGCTAAC
FS_87:BB_HPLC_fw	26-09-2013	Gibson-Primer fw to amplify the Backbone pSB6A1 introducing a BamHI cutting site for restriction cloning and creating an overlap to the last fragment of DelH	CGCTGGAGTACGCGCTGGACTGAGATCCCAGGCATCAAATAAAACG
FS_90:ccdB_HPLC_fw	26-09-2013	Gibson-Primer fw to amplify the ccdB cassette from the template pDonor Plasmid introducing a KpnI cutting site for restriction cloning, creates an overlap to the promotor BBa_J23114 and will be used for the ccdB strategy	CTCAGTCCTAGGTACAATGCTAGCTCTAGAGTCACACAGGAAAGCAGTAC ACTGGCTGTGTATAAGGGAG
FS_93:ccdB_HPLC_rev	26-09-2013	Gibson-Primer rev to amplify the ccdB cassette from the template pDonor Plasmid introducing a BamHI cutting site for restriction cloning, creates an overlap to the backbone pSB6A1 and will be used for the ccdB strategy	GTTCACCGACAAACAACAGATGATCCGCGTGGATCCGGCTTAC
FS_94:BB_HPLC_fw	26-09-2013	Primer fw to amplify the backbone pSB6A1, will be used for the ccdB strategy	ATCTGTTGTTTGTCGGTGAACGC

Vector map of the DelH plasmid without promoter in pSB4K5 pFS03 (pSB4K5min_KpnI_DelH_BamHI) Gibson plasmid.

Vector map of the pSB6A1 backbone with ccdB cassette pFS04 (pSB6A1_BBa_J23114_BBa_B0032_ccdB_cassette) Gibson plasmid.

Vector map of the final DelH plasmid in pSB6A1 pFS05 (DelH_final_pSB6A1_BBa_J23114_BBa_B0032_KpnI_DelH_BamHI) Gibson plasmid.

23-09 - 29-09-13

Mutagenesis of DelH Clone I 6B

Screening-PCR Conditions CP.W22.A

Screening of the 11 colonies, which grew on the agar plate.

Template	11x 1 picked colony + positve control (Midiprep I6B)
Expected length [bp]	319 (VFII+HM22); 395 (FS66+SR03)
Named	Mut1-11 (VFII+HM22), Mut1-11 (FS66+SR03)
Primer fw 10 µM	2 µl VF2 / FS66
Primer rev 10 µM	2 µl HM22 / SR03
One-Taq (2x)	10 µl
ddH₂O	6 µl

Cycles	Temperature DelH [°C]	Time [s]
1	95	900
35	95	30
	55	30
	72	25
1	12	inf

Result

Expected bands: 319 bp (HM22-VFII) and 395 bp (FS_66-SR_03)

Fig.22.1 Colony PCR for screening of DelH-pSB6A1 construct

10 ml of each colony were cultured.

The screening with primer FS_66 to SR_03 did not work. The positive control was negative.
The screening with primer VFII to HM22 was positive for 4 colonies (2,3,4,7,8,10)
These colonies have to be midi-preped and digested to test whether it is the original DelH or the mutated one

Midiprep of Clones 2,3,4,7,8 and 10

Centrifugation of 10 ml culures at 3750 rpm for 15 min
Kept pellet an resuspended in 400 µl P1 buffer
Added 800 µl P2 buffer and incubated for 180
Neutralized with S3 buffer
Centrifugated for 15 min at 13 000 rpm
Kept supernatant and added 50:50 Isopropanol

Test restriction digest of Midipreps with MfeI and XbaI

Expected band: 22.9 kb

Fig.22.2 Test restriction digest with XbaI and MfeI to see if mutagenesis has worked.

Reagent	Volume [µl]
Midiprep colonies	0.2
Cutsmart buffer	2
XbaI	1.5
MfeI-HF	1.5
ddH₂O	14.75

Incubation for 2 h at 37°C

Apparently the mutagenesis did not work. The band was too low. Maybe recombination occured.

Sequencing

The Midiprep of clone 2 was send to sequencing to see what had happened during the mutagenesis.

Sequencing results for colony 2 with primer VFII after mutagenesis.

Result

The mutagenesis did not work. Apparently recombination occured. As the result was the same for all the colonies we suspect that repeating the mutagenesis would lead to the same result. Therefore the mutagenesis part is stopped.

SDS-PAGE of Clone C5

Lysis of Cells

1 ml over night cultures in LB of electrocompetent BL21-pLys and BL21-pLys with pHM04 (C5)
Meausured ODs (BL21-pLys = 1.33; BL21-pLys + pHM04= 1.03 )
Centrifugation at 13000 rpm for 10 min
Discarded supernatant
Resuspended cells in 133 µl (BL21-pLys) and 103 µl (BL21-pLys + pHM04) 1x loading buffer (40% ddH₂O, 12.5% TrisHCl pH=7.5, 20% Glycerol (50%), 20% SDS (10%), 5% β-Mercaptoethanol, 2.5% Bromophenol blue)
Boiled samples for 10 min at 98°C

Electrophoresis

Applied 25 µl of each sample on SDS-polyacrylamide gel
Run at 100 V for 5 min and afterwards at 140 V for another 50 min

Staining and Destaining Procedure

Gel was stained in Coomassie Brilliant Blue for 1 h on shaker
Destaining with destaining buffer (50% ddH₂O, 40% Methanol, 10% Acetic acid) until band were visible

Result

Fig.22.3: SDS page of DelH clone C5 in E. coli BL21 DE3

As shown in figure 22.3, there is a faint very high band, which is DelH (~600 kDa). Clone C5 expresses DelH despite of the amino acid substitution. Next, we will electroporate DelH C5 with DelRest and pIK8.6 in E. coli BL21 DE3 and analyze Delftibactin expression by Micro-TOF.

Generation of DelH Plasmid pHM04 18-09

Colony-PCR CP.W22.B

Template	48x 1 picked colony
Expected length [bp]	663
Named	1A - 12E, DelH III
Primer fw 10 µM	50x 2 µl VF2
Primer rev 10 µM	50x 2 µl DN07
One-Taq Polymerase (2x)	50x 10 µl
ddH₂O	48x 6 µl

Cycles	Temperature [°C]	Time [s]
1	95	120
12	95	30
	68 (touchdown -0.5°C)	30
	72	45 s
18	95	30
	65	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.22.6 Colony PCR of Gibson assembled DelH-BB without mRFP 96 well plate II (loaded 4 µL of PCR)
l1:2-log ladder, l2-l26:colonies E1-F12

Fig.22.5 Colony PCR of Gibson assembled DelH-BB without mRFP 96 well plate II (loaded 4 µL of PCR)
l1:2-log ladder, l2-l26:colonies C1-D12

Fig.22.4 Colony PCR of Gibson assembled DelH-BB without mRFP 96 well plate II(loaded 4 µL of PCR)
l1:2-log ladder, l2-l26:colonies A1-B12

The following colonies seem positive, because they show the expected band at 663 bp

Picture	Positive colonies
22.1	A9
22.2	D7, D9, D11
22.3	E5, E6, E7, F7

Test Restriction Digest

The positive screened colonies were digested with PvuI.

Template DNA	CutSmart Buffer	PvuI	ddH₂O	Total Volume
8.5 µl 1 µl	0.5 µl	-	10 µl

Result

Expected bands: 11,621, 8628 & 2,685 bp

Fig.22.7 Test restricion digest of colonies from plate II and III

The following colonies show the correct pattern:

Colonies	Positive in Digest	Concentration in Midiprep [ng/µl]
II A9	yes	2,153
III D7	yes	3,371
III D9	yes	697
III D11	yes	3,523
III E6	yes	2,745
III E7	yes	3,649

They were not sequenced due to exclusively found mutations in BL21 DE3 (pLys).

Generation of DelH Plasmid pHM04 20-09

Colony-PCR CP.W22.C

Template	48x 1 picked colony
Expected length [bp]	663
Named	1F - 12H, DelH III
Primer fw 10 µM	50x 2 µl VF2
Primer rev 10 µM	50x 2 µl DN07
One-Taq Polymerase (2x)	50x 10 µl
ddH₂O	48x 6 µl

Cycles	Temperature [°C]	Time [s]
1	95	120
12	95	30
	68 (touchdown -0.5°C)	30
	72	45 s
18	95	30
	65	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.22.4 Colony PCR of Gibson assembled DelH-BB without mRFP 96 well plate II (loaded 4 µL of PCR)
l1:2-log ladder, l2-l26:colonies G1-H12

Fig.22.3 Colony PCR of Gibson assembled DelH-BB without mRFP 96 well plate II (loaded 4 µL of PCR)
l1:2-log ladder, l2-l26:colonies E1-F12

The following colonies seem positive, because they show the expected band at 663 bp

Picture	Positive colonies
22.3	F7, F9, F11
22.4	G3, G4, G12, H6, H11

Test Restriction Digest

The positive screened colonies were digested with PvuI.

Template DNA	CutSmart Buffer	PvuI	ddH₂O	Total Volume
8.5 µl 1 µl	0.5 µl	-	10 µl

Result

Expected bands: 11,621, 8628 & 2,685 bp

Fig.22.x Test restriction digest of DelH colonies

The following colonies show the correct pattern:

Colonies	Positive in Digest	Concentration in Midiprep [ng/µl]
III F7	yes	3,856
III F9	yes	1,283
III F11	no	4,507
III G3	yes	5,823
III G4	yes	3,622
III G12	no	3,615
III H6	no	3,985
III H11	no	3,605

Sequencing

Colonies F7, F9, G3 and G4 were send for sequencing with VF2.

Result

Colonies	Alignment File
III F7	File:Heidelberg Sequencing Result pHM04 VF2 colony DH10b F7.clustal.txt
III F9	File:Heidelberg Sequencing Result pHM04 VF2 colony DH10b F9.clustal.txt
III G3	File:Heidelberg Sequencing Result pHM04 VF2 colony DH10b G3.clustal.txt
III G4	File:Heidelberg Sequencing Result pHM04 VF2 colony DH10b G4.clustal.txt

Contamination of Cells with Chloramphenicol Resistance

Preparation of Electrocompetent BL21 DE3

Electrocompetent BL21 DE3 were prepared according to the protocol. The following day, the LB Chlor plate was covered with colonies. Since BL21 are in contrast to BL21 pLys not ntaurally resistant to Chloramphenicol, they are obviously contaminated. In order to check whether this is also caused by an Indigoidine plasmid, extensive evaluation of stocks and transformed cells will be undertaken.

Test for Chloramphenicol Resistance

All stocks of competent cells were streaked on LB Chlor plates and incubated at 37°C ON.

Result

Cells	Prepared	Growth on Plate
E.coli DH10ß elec	older	no
E.coli DH10ß elec	21-09	no
E.coli BL21 DE3 chem	original stock	yes
E.coli BL21 DE3 elec	older	yes
E.coli BL21 DE3 elec	22-09	yes
E.coli BL21 pLys elec	older	yes

Thus, the BL21 DE3 we obtained most probably are BL21 DE3 pLys, too.

New BL21 DE3

We obtained new BL21 DE3 from the Russel Lab, which were obtained from NEB directly. Cells were inocculated in 10 ml LB and streaked on LB Chlor plates. The vial was frozen again at -80°C.

Test for Indigoidine Contamination A

All competent cells as well as important transformed cells and recent mini preps of possible DelH plasmids were tested for contamination with an Indigoidine plasmid (which carries chloramphenicol resistance).

Reagent	Amount [µl]
Template	0.5 or colony
RB69 10 µM	1
VF2 10 µM	1
OneTaq Master Mix	5
ddH₂O	2.5

Cycles	Temperature [°C]	Time [s]
1	95	300
35	95	30
	53	30
	72	90
1	72	600
1	12	inf

Result

Expected band: 540 bp

Fig.22.x Numerous samples were analyzed for contamination with Indigoidine.

The following samples show Indigoidine band:

Name	Cells	Plasmids	Indigoidine band
1	E.coli BL21 DE3 original	-	no
2	E.coli BL21 DE3 older	-	no
3	E.coli BL21 DE3 22-09	-	no
4	E.coli DH10ß 21-09 LB	-	no
5	miniprep	DelH C5	yes
6	miniprep	DelH C7	yes
7	miniprep	DelH C12	yes
8	miniprep	DelH G11	yes
9	miniprep	DelH IIA6	yes
10	miniprep	DelH IID2	yes
11	E.coli BL21 DE3 older	DelCluster 25-1B + pIK8.6	no
12	E.coli BL21 DE3 older	DelCluster 25-1C + pIK8.6	no
13	E.coli BL21 DE3 older	DelCluster 25-2A + pIK8.6	no
14	E.coli BL21 DE3 older	DelCluster 25-3A + pIK8.6	no
15	E.coli BL21 DE3 older	DelCluster 25-3B + pIK8.6	no
16	E.coli BL21 DE3 older	DelCluster 25-4 + pIK8.6	no
17	E.coli BL21 DE3 older	DelCluster 25-5 + pIK8.6	no
18	E.coli BL21 pLys	-	no
19	E.coli BL21 pLys	DelH C5 + pIK8.6	no
20	E.coli BL21 pLys	DelH C7 + pIK8.6	no
21	E.coli BL21 pLys	DelH C12 + pIK8.6	no
22	E.coli BL21 pLys	DelH G11 + pIK8.6	no
23	E.coli BL21 pLys	DelH IIA6 + pIK8.6	no
24	E.coli BL21 pLys	DelH IID2 + pIK8.6	no
25	miniprep	pIK2.6	yes
26	E.coli DH10ß white colony	DelRest + DelH I6B + pIK2.6	no
27	E.coli DH10ß 21-09 ACM	-	no
+	miniprep	pRB22.4	yes

All stocks are clean, only the DelH minipreps as well as the one from pIK2.6 are positive for Indigoidine. Therefore, we identified the source of contamination for the triple clone, which turned blue. We however cannot explain the positive result for the DelH minipreps, which obviously harbour a second plasmid.

Test for Indigoidine Contamination B

Again, all minipreps which were send for sequencing as well as a positive control a negative control and two recently prepared minipreps from other teams were tested for an Indigoidine contamination

Reagent	Amount [µl]
Template	0.5 or colony
RB69 10 µM	1
VF2 10 µM	1
OneTaq Master Mix	5
ddH₂O	2.5

Cycles	Temperature [°C]	Time [s]
1	95	300
35	95	30
	53	30
	72	90
1	72	600
1	12	inf

Result

Expected band: 540 bp

Fig.22.x Test for contamination with Indigoidine plasmid

Lane	Cells originating from	Miniprep	Indigoidine band
upper row
2	E.coli BL21 DE3 22-09	DelH Plasmid I C5 23-09	yes
3	E.coli BL21 DE3 22-09	DelH Plasmid I C7 23-09	yes
4	E.coli BL21 DE3 22-09	DelH Plasmid I C12 23-09	yes
5	E.coli BL21 DE3 22-09	DelH Plasmid I G11 23-09	yes
6	E.coli BL21 DE3 22-09	DelH Plasmid II A6 23-09	yes
7	E.coli BL21 DE3 22-09	DelH Plasmid II D2 23-09	yes
8	E.coli BL21 DE3 22-09	DelH Plasmid III A9 23-09	yes
9	E.coli BL21 DE3 22-09	DelH Plasmid III D7 23-09	yes
10	E.coli BL21 DE3 22-09	DelH Plasmid III D9 23-09	yes
11	E.coli BL21 DE3 22-09	DelH Plasmid III D11 23-09	yes
12	E.coli BL21 DE3 22-09	DelH Plasmid III E6 23-09	yes
13	E.coli BL21 DE3 22-09	DelH Plasmid III E7 23-09	yes
14	E.coli DH10ß older	DelH Plasmid III F6 23-09	yes
15	E.coli DH10ß older	DelH Plasmid III F7 23-09	yes
16	E.coli DH10ß older	DelH Plasmid III G3 23-09	yes
17	E.coli DH10ß older	DelH Plasmid III G4 23-09	yes
18	E.coli DH10ß chem	Indigoinide Plasmid pRB22 (positive)	yes
lower row
2	E.coli DH10ß chem	Indigoinide Plasmid pRB17 (negative)	yes
3	E.coli DH10ß chem	Indigoinide Plasmid recent miniprep K1 (negative)	yes
4	E.coli DH10ß chem	Indigoinide Plasmid recent miniprep K1 (negative)	yes
5	E.coli DH10ß chem	Indigoinide Plasmid pRB22 (positive)	yes

Surprisingly, all samples show Indigoidine band at ~540 bp. There is a contamination and we have to identify the source!

Test for Indigoidine Contamination C

Again, all minipreps which were send for sequencing as well as positive and negative controls and recently prepared minipreps from other teams were tested for an Indigoidine contamination. using two different primer pairs. Additionally, fake minipreps were performed to identify DNA contamination of buffers.

Reagent	Amount [µl]
Template	0.5 or colony
RB69 10 µM	1
VF2 10 µM	1
OneTaq Master Mix	5
ddH₂O	2.5

Cycles	Temperature [°C]	Time [s]
1	95	300
35	95	30
	53	30
	72	90
1	72	600
1	12	inf

Reagent	Amount [µl]
Template	0.5 or colony
KH05 10 µM	1
VR 10 µM	1
OneTaq Master Mix	5
ddH₂O	2.5

Cycles	Temperature [°C]	Time [s]
1	95	300
35	95	30
	53	30
	72	90
1	72	600
1	12	inf

Result

Expected band: ~1 Kb for KH05 and 540 bp for RB69

Fig.22.x Testing for indigoidin Contamination uding RB69 and VF2

Fig.22.x Testing for indigoidin Contamination uding KH05 and VR

Lane	Date	Template	Indigoidine band
KH05 and VR
2	24-09 (negative)	Fake miniprep: all old	no
3	24-09 (negative)	Fake miniprep: P1 aliquot 20-09	no
4	24-09 (negative)	Fake miniprep: fresh P1	no
5	24-09 (negative)	Fake miniprep: fresh P2	no
6	24-09 (negative)	Fake miniprep: P2 aliquot	no
7	24-09 (negative)	Fake miniprep: fresh S3	no
8	24-09 (negative)	Fake miniprep: fresh isoprop	no
9	21-07 (negative)	pKH1	no
10	21-07 (negative)	pKH1 + new polymerase	yes
11	21-07 (negative)	pSB3C5 + new polymerase	yes
12	-	pRB22 (positive)	yes
13	23-09 (negative)	DelH Plasmid I C7 23-09	yes
14	23-09 (negative)	DelH Plasmid I C12 23-09	yes
15	23-09 (negative)	DelH Plasmid I G11 23-09	yes
16	23-09 (negative)	DelH Plasmid II A6 23-09	yes
17	23-09 (negative)	DelH Plasmid II D2 23-09	yes
18	23-09 (negative)	DelH Plasmid III F7 23-09	yes
19	23-09 (negative)	DelH Plasmid III F9 23-09	yes
20	23-09 (negative)	DelH Plasmid III G3 23-09	yes
21	23-09 (negative)	DelH Plasmid III G4 23-09	yes
22	23-09 (negative)	DelH Plasmid I C5 23-09	yes
23	E.coli DH10ß culture (negative)	DelH Plasmid II A6	no
24	-	-	no

Lane	Date	Template	Indigoidine band
RB69 and VF2
2	24-09 (negative)	Fake miniprep: all old	yes
3	24-09 (negative)	Fake miniprep: P1 aliquot 20-09	yes
4	24-09 (negative)	Fake miniprep: fresh P1	yes
5	24-09 (negative)	Fake miniprep: fresh P2	yes
6	24-09 (negative)	Fake miniprep: P2 aliquot	yes
7	24-09 (negative)	Fake miniprep: fresh S3	yes
8	24-09 (negative)	Fake miniprep: fresh isoprop	yes
9	04-08 (negative)	6 maxi HM	no
10	15-09 (negative)	pPW06 BCI	no
11	19-09 (negative)	ccdB 7	no
12	19-09 (negative)	c.3 7	no
13	19-09 (negative)	c.3 14.B	no
14	21-07 (negative)	pKH1	no
15	- (positive)	pRB22	yes
16	-	-	no

Amplification with KH05 shows contamination of new polymerase vial (shorter band) as well of DelH minipreps. Interestingly, the tested culture is NOT contaminated.

Overview
Lab book

Amplification of 1

== 30-09 - 06-10-13 ==

Generation of DelH Plasmid pHM04 15-09

Colony-PCR Conditions CP.W23.A

Template	23x 1 picked colony, positive control
Expected length [bp]	663
Named	1A - 12H
Primer fw 10 µM	100x 2 µl VF2
Primer rev 10 µM	100x 2 µl DN07
iTaq Polymerase (2x)	100x 10 µl
ddH₂O	96x 6 µl

Cycles	Temperature DelH [°C]	Time [s]
1	95	120
12	95	30
	68 ↓ 0.5	30
	72	45
18	95	30
	65	30
	72	45
1	12	inf

Result

Expected band: 663 bp
[[|200px|thumb|right|Fig.23.1 Colony PCR of Gibson assembled DelH-BB without mRFP 23 colonies]]

Amplification of backbone pSB6A1 for strategy pFS02

Reagent	Amount
Template	1 µl of minipreped pSB6A1 (2L)
Primer fw 10 µM	2 µl FS78
Primer rev 10 µM	2 µl HM17
Phusion Flash Ready Mix	10 µl
ddH₂O	5 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	1:25
18	98	1
	68	5
	72	1:25
1	72	5 min
1	4	inf

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	58	5
	72	1:25
1	72	5 min
1	4	inf

Results

Amplification of backbone pSB6A1 for strategy pFS02

Reagent	Amount
Template	1 µl of minipreped pSB6A1 (2L)
Primer fw 10 µM	2 µl FS85
Primer rev 10 µM	2 µl HM17
Phusion Flash Ready Mix	10 µl
ddH₂O	5 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	1:25
18	98	1
	68	5
	72	1:25
1	72	5 min
1	4	inf

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	58	5
	72	1:25
1	72	5 min
1	4	inf

====Result====

@@ Line 1: / Line 1: @@
-{{:Team:Heidelberg/Templates/scrollbar-css}}
 {{:Team:Heidelberg/Templates/Navigation}}
+{{:Team:Heidelberg/Templates/scrollbar-css}}
 <html>
 <style type="text/css">
@@ Line 938: / Line 939: @@
 </div>
 </html>
+{{:Team:Heidelberg/Templates/Footer-Nav}}
 {{:Team:Heidelberg/Templates/Footer-DelH}}

Team:Heidelberg/Delftibactin/DelH

From 2013.igem.org

Revision as of 12:16, 4 October 2013

Team

Project

Notebook

Parts

Software

Human Practice

Safety

Modeling

Del H. This nasty 18 kb fragment.

Week 1

Week 2

Week 3

Week 4

Week 5

Week 6

Week 7

Week 8

Week 9

Week 10

Week 11

Week 12

Week 13

Week 14

Week 15

Week 16

Week 17

Week 18

Week 19

Week 20

Week 21

Week 22

Week 23

Methods:

Restriction Digest and Ligation Strategy

Vector Maps, Primers and BioBricks

29-04 - 05-05-13

Generation of Plasmid Backbones

Transformation of Biobricks

Result

Amplification of DelH Fragments

Design of Primers

BioBricks

06-05 - 12-05-13

Amplification of BioBricks

Miniprep of BioBricks

Result

Generation of Plasmid Backbones

Restriction Digest of BioBrick pSB6A1

Result

Generation of LacZ Fragment

Restriction Digest of BioBrick pSB1AK3 Conditions A

Result

Restriction Digest of BioBrick K173004(lacZ) Conditions B

Result

Restriction Digest of BioBrick K173004(lacZ) Conditions C

Result

Generation of AraC Fragment

Amplification of BioBricks containing I13453 and K206000

Amplification of DelH F1

PCR Conditions F1.W2.A

Result

PCR Conditions F1.W2.B

Result

PCR Conditions F1.W2.C

Result

Amplification of DelH F2

PCR Conditions F2.W2.A

Result

PCR Conditions F2.W2.B

Results

Primers

13-05 - 19-05-13

Amplification of DelH F1

Gel Purification

Result

re-PCR Conditions F1.W3.A

Result