Team:Heidelberg/Templates/DelH overview18
From 2013.igem.org
Vector Map, Primers and BioBricks

Vector map of the PHM05-DelH-tetR-pSB6A1 Gibson plasmid.
Backbone | Part | Distribution | Plate | Well | Usage | Resistance |
---|---|---|---|---|---|---|
pSB1T3 | J04450 | Spring 2013 | 2 | 2B | Backbone to amplify the tetracycline-resistance | Tetracycline |
pSB6A1 | J04450 | Spring 2012 | 1 | 1K | Backbone for DelH | Ampicillin |
Identifier | Order date | Note | Sequence |
---|---|---|---|
HM14:DelH_tetR_fw | 2013-08-16 | Gibson-Primer DelH-tetR: amplifies the tetracycline resistance from the pSB1T3 Backbone and creates an overlap to the end of DelH | ATTGGCGCTGGAGTACGCGCTGGACTGA atgaagttttaaatcaatctaaag |
HM15:tetR_stop_BB_rev | 2013-08-16 | Gibson-Primer tetR-pSB6A1: amplifies the tetracycline resistance and creates an overlap with the Terminator of the Backbone pSB6A1 | Cgactgagcctttcgttttatttgatgcctggc ctcgtgatacgcctatttttatagg |
HM16:tetR_pSB6A1_fw | 2013-08-16 | Gibson-Primer DelH, amplifies the Backbone pSB6A1 creating an overlap with the tetracycline resistance | Aaaaataggcgtatcacgag gccaggcatcaaataaaacgaaaggctcag |
FS_66: DelH_rv | 2013-08-26 | Amplification of DelH from Delftia acidovorans Gibson Primer | TGGGCATTCACCGCATCGATC |
FS_67: DelH_fw | 2013-08-26 | Amplification of DelH from Delftia acidovorans Gibson Primer | CTTCACGTTGATTGCGCATG |
FS_68: DelH_rv | 2013-08-26 | Amplification of DelH from Delftia acidovorans Gibson Primer | CAGAAGAACTCCCAGACCGAC |
FS_69: DelH_fw | 2013-08-26 | Amplification of DelH from Delftia acidovorans Gibson Primer | GACACCGTTCAGCTTCGATG |
FS_70: DelH_rv | 2013-08-26 | Amplification of DelH from Delftia acidovorans Gibson Primer | GAAGCTGCTCCGCTGATAGAT |
FS_71: DelH_fw | 2013-08-26 | Amplification of DelH from Delftia acidovorans Gibson Primer | ATGTGCTGTCGCTCAAGATG |
FS_72_SR_02_fw | 2013-08-30 | Screening of pHM04 | ATGTGCTGTCGCTCAAGATG |
FS_73_SR_03_fw | 2013-08-30 | Screening of pHM04 | GTGCTGTTTGGCCGTATG |
FS_74_SR_04_fw | 2013-08-30 | Screening of pHM04 | ATCAGGTGCTGAGCTACGAC |
FS_75_SR_05_fw | 2013-08-30 | Screening of pHM04 | CTGTTCATCAACACCTTGCC |
FS_76_SR_06_rv | 2013-08-30 | Screening of pHM04 | GAAGACAGTCATAAGTGCGGC |