Team:Heidelberg/Templates/DelH week17

From 2013.igem.org

Contents

19-08 - 25-08-13

Summary of Amplified DelH Fragments

Fragment Concentration [ng/µl]
G0 6.4
G1/2a 8.5

Rather low yield. So we switched the strategy and try to increase the template of DelH by amplifying it in smaller and more fragments. Therefore, we used the following primers: FS64-FS71, HM08, DN07

Amplification of DelH G0

Re-PCR Conditions G0.W17.A

Reagent G0
Expected length [Kb] 18
Named G0 1
Template 1 µl G0 fragment (c= 6.4 ng/µl)
Primer fw 10 µM 2 µl short2
Primer rev 10 µM 2 µl HM08
Phusion Flash Ready Mix 10 µl
ddH2O 5 µl
Cycles Temperature [°C] Time [s]
1 98 5
30 98 1
65 5
72 4:45 min
1 72 10 min
1 12 inf
  • Lid preheated at 98°C
  • No hot start

Result

Expected band: 18 Kb

Fig.17.1 gel of amplified DelH-G0 fragment from the fragment itself (loaded 20 µL of PCR)
l1: BB amplified with HM16 by 2-step PCR, l2: BB amplified with HM17by 2-step PCR, l3: BB amplified with HM16, l4: BB amplified with HM17, l5: DelH-G0
l5: G0 was not amplified => not our fragment or without DMSO it is not so effective

Gel does not show expected band.

=> G0 was not amplified. Possibly change Mg2+ concentration.


PCR Conditions G0.W17.B

Reagent G0 G0 G0 G0
Expected length [Kb] 18 18 18 18
Named G0 0.5 G0 1 G0 2 G0 N
Template 1 µl glycerol stock D. acidovorans 1 µl glycerol stock D. acidovorans 1 µl glycerol stock D. acidovorans 1 µl glycerol stock D. acidovorans
Primer fw 10 µM 2 µl short2 2 µl short2 2 µl short2 2 µl short2
Primer rev 10 µM 2 µl HM08 2 µl HM08 2 µl HM08 2 µl HM08
Phusion Flash Ready Mix 10 µl 10 µl 10 µl 10 µl
ddH2O 4.5 µl 4 µl 3.5 µl 4 µl
DMSO 1 1 1 1
MgSO4 0.5 µl 1 µl 1.5 µl -
Cycles Temperature DelH [°C] Time [s]
1 98 5
30 98 1
65 5
72 4:45 min
1 72 10 min
1 12 inf
  • Lid preheated at 98°C
  • No hot start

Result

Expected band: 18 Kb

Fig.17.2 gel of amplified DelH-G0 with different MgSO4(loaded 20 µL of PCR)
l1: 1Kb+ ladder, l2: G0 0.5 µl MgSO4, l3: G0 1 µl MgSO4, l4: G0 1.5µl MgSO4, l5: G0 N without MgSO4
l5: G0 was amplified without DMSO => DMSO is important, but MgSO4 is not improve the PCR reaction

Fragments were amplified, but yield not significantly increased.

=> DMSO is important, but MgSO4 is not improve the PCR reaction.


Characterization of DelH Plasmid pHM03 17-08

  • For the miniprep, the cells were centrifuged at 13,000 rpm for 15 min
  • The cell pellet was resuspended in 200 µl P1 + 400 µl P2 and incubated for 120
  • Afterwards, 300 µl S3 were added and transferred into a new 2 ml eppi and centrifuged 20 min at 13,000 rpm
  • 1 ml isopropanol was added and the normal isoprop-ethanol-preipitation
  • It was resuspended in 35 µl ddH2O

Result

Miniprep of colony Concentration [ng/µl]
3 1,868.5
4 1,688.1
5 1,069.2
6 1,778.6
7 2,105.7
8 1,219.7
9 1,083.1
10 1,031.7
11 2,175.3
12 1,449.4


PCR Conditions CP.W17.A

M3 = Miniprep of DelH-pSB6A1(colony 3)

Template 1 µl of 1:1000 diluted M3 (pink) 1 µl of 1:1000 diluted M4 (slightly pink) 1 µl of 1:1000 diluted M5 (slightly pink) 1 µl of 1:1000 diluted M6 (pink) 1 µl of 1:1000 diluted M7 (pink) 1 µl of 1:1000 diluted M 8 1 µl of 1:1000 diluted M 9 1 µl of 1:1000 diluted M10 1 µl of 1:1000 diluted M11 1 µl of 1:1000 diluted M12
Expected length [bp] 663 663 663 663 663 663 663 663 663 663
Named 3 4 5 6 7 8 9 10 11 12
Primer fw 10 µM 2 µl VF2 2 µl VF2 2 µl VF2 2 µl VF2 2 µl VF2 2 µl VF2 2 µl VF2 2 µl VF2 2 µl VF2 2 µl VF2
Primer rev 10 µM 2 µl Screen_delH_rev 2 µl Screen_delH_rev 2 µl Screen_delH_rev 2 µl Screen_delH_rev 2 µl Screen_delH_rev 2 µl Screen_delH_rev 2 µl Screen_delH_rev 2 µl Screen_delH_rev 2 µl Screen_delH_rev 2 µl Screen_delH_rev
Dream-Taq Polymerase (2x) 10 µl 10 µl 10 µl 10 µl 10 µl 10 µl 10 µl 10 µl 10 µl 10 µl
ddH2O 6 µl 6 µl 6 µl 6 µl 6 µl 6 µl 6 µl 6 µl 6 µl 6 µl
Cycles Temperature[°C] Time [s]
1 95 120
12 95 60
68 (touchdown -0.5°C) 30
72 45
18 95 60
65 30
72 45
1 12 inf

Result

Expected band: 663 bp

Fig.17.3 colony PCR of Gibson assembled DelH-BB with mRFP (loaded 20 µL of PCR)
l1:
l3-12:show expected fragment

Colonies 3 to 12 show expected size.

=> Perform miniprep and test digest with colonies 3-12.


Test Restriction Digest

Of colonies 3, 4, 5, 6, 7

Component Amount [µl]
DNA of M 3 to 12 (1:10) 19
CutSmart Buffer (10x) .,2
Enzyme (SalI) 1
ddH2O -
Expected bands 14,180 & 9,469 bp
  • Incubated over night at 37°C and shaking

Result

Expected bands: 14.18 and 9.459 Kb

Fig.17.4 gel of test digest of the colonies 3-7 (loaded 20 µL of PCR)
l1:1 Kb+ ladder, l2:Digested miniprep of colony 3, l3:Digested miniprep of colony 4, l4:Digested miniprep of colony 5, l5:Digested miniprep of colony 6, l6:Digested miniprep of colony 7
l2-6:show not the expected fragment, but a band at ~ 4.8 Kb. Also observed pale bands at 20 Kb and ~ 3.8 Kb

None of the colonies shows expected restriction fragments. Additionally, there are pale bands at +20 Kb and ~3.8 Kb, but not the expected bands.

=> Possible explanation: colonies harbor reconjugated backbone AND something else involving DelH.


PCR Conditions CP.W17.B

M3 = Miniprep of DelH-pSB6A1(colony 3)

Template 1 µl of 1:1000 diluted M3 (pink) 1 µl of 1:1000 diluted M4 (slightly pink) 1 µl of 1:1000 diluted M5 (slightly pink) 1 µl of 1:1000 diluted M6 (pink) 1 µl of 1:1000 diluted M7 (pink) 1 µl of 1:1000 diluted M 8 1 µl of 1:1000 diluted M 9 1 µl of 1:1000 diluted M10 1 µl of 1:1000 diluted M11 1 µl of 1:1000 diluted M12
Expected length [bp] 663 663 663 663 663 663 663 663 663 663
Named 3 4 5 6 7 8 9 10 11 12
Primer fw 10 µM 2 µl VF2 2 µl VF2 2 µl VF2 2 µl VF2 2 µl VF2 2 µl VF2 2 µl VF2 2 µl VF2 2 µl VF2 2 µl VF2
Primer rev 10 µM 2 µl Screen_delH_rev 2 µl Screen_delH_rev 2 µl Screen_delH_rev 2 µl Screen_delH_rev 2 µl Screen_delH_rev 2 µl Screen_delH_rev 2 µl Screen_delH_rev 2 µl Screen_delH_rev 2 µl Screen_delH_rev 2 µl Screen_delH_rev
Dream-Taq Polymerase (2x) 10 µl 10 µl 10 µl 10 µl 10 µl 10 µl 10 µl 10 µl 10 µl 10 µl
ddH2O 6 µl 6 µl 6 µl 6 µl 6 µl 6 µl 6 µl 6 µl 6 µl 6 µl
Cycles Temperature DelH-G0 [°C] Time [s]
1 95 120
12 95 60
68 (touchdown -0.5°C) 30
72 45
18 95 60
65 30
72 45
1 12 inf

Result

Expected band: 663 bp

Fig.17.5 colony PCR of Gibson assembled DelH-BB with mRFP (loaded 20 µL of PCR)
l1:
l3-12:show an unexpected fragment at ~ 3Kb

Gel shows unexpected fragments at ~3 Kb.

=> Clones are negative despite of latest results. Current strategy does not work out. Development new strategy.


New Gibson Strategy

Gibson Strategy without mRFP

Try a new construct without mRFP, so that we can exclude the red clones from the screening. Therefore we are going to use a new reverse primer for the Backbone which includes only the terminator of the mRFP, but not the mRFP. The primers for the Backbone are HM11 & HM17. The construct is named pHM04 and shown in week 16 were the idea was specified. For first approach pHM04, we will amplify the backbone without mRFP, avoiding backbone reassembly due to ribosome binding site homology. In the second strategy pHM05, we will additionally introduce a tetracycline resistance, to ensure integration of the insert.

Vector Maps and Primers

1st strategy: DelH & pSB6A1 without mRFP

Vector map of the PHM04-DelH-pSB6A1(without mRFP) Gibson plasmid.
Identifier Order date Note Sequence
HM17:DelH_Terminator_BB_fw 16-08-2013 Amplification of Backbone pSb6A1-lacI-mRFP ATTGGCGCTGGAGTACGCGCTGGACTGA
aggcatcaaataaaacgaaaggctcag


2nd strategy: DelH & tetracycline resistance & pSB6A1 without mRFP

Vector map of the PHM05-DelH-tetR-pSB6A1 Gibson plasmid.
Identifier Order date Note Sequence
HM14:DelH_tetR_fw2013-08-16 Gibson-Primer DelH-tetR: amplifies the tetracycline resistance from the pSB1T3 Backbone and creates an overlap to the end of DelH ATTGGCGCTGGAGTACGCGCTGGACTGA atgaagttttaaatcaatctaaag
HM15:tetR_stop_BB_rev2013-08-16 Gibson-Primer tetR-pSB6A1: amplifies the tetracycline resistance and creates an overlap with the Terminator of the Backbone pSB6A1 Cgactgagcctttcgttttatttgatgcctggc ctcgtgatacgcctatttttatagg
HM16:tetR_pSB6A1_fw2013-08-16Gibson-Primer DelH, amplifies the Backbone pSB6A1 creating an overlap with the tetracycline resistance Aaaaataggcgtatcacgag gccaggcatcaaataaaacgaaaggctcag


Amplification of Tetracycline Fragment

Preparation of Tetraycline Medium

  • Weight 100 mg of tetracycline and dissolve it in 10 ml ethanol = stock solution
  • Add 500 µl of stock solution in 100 ml LB and mix


Transformation of Tetrazyklin Backbone

  • For the new strategy we need a tetracycline resistance (length ~1.2 Kb) of the pSB1T3 Backbone (2013 Distribution, Plate 5, well 7A, insert: BBa_J04450) [http://parts.igem.org/Part:pSB1T3:Design|pSB1T3]
  • The primers are already designed and shown in the table above
  • With these primers, we amplify the tetracycline resistance and include an overlap to DelH end and the backbone pSB6A1 excluding the mRFP
  • For the transformation I incubated 10 min at room temperature the well 7A of plate 5 with 10 µl ddH2O


PCR Conditions TR.W17.A

Reagent pSB1T3 pSB1T3
Template picked colony 1 picked colony 2
Primer fw 10 µM 1 µl HM14 1 µl HM14
Primer rev 10 µM 1 µl HM15 1 µl HM15
Phusion Ready Mix 10 µl 10 µl
ddH2O 8 µl 8 µl
Cycles Temperature DelH [°C] Time [s]
1 98 5
12 98 1
68 (touchdown -0,5°C) 5
72 30
18 98 1
67 5
72 30
1 72 5 min
1 4 inf

Result

Expected band: 1.468 Kb

Fig.17.6 gel of amplified tetracycline resistance (loaded 20 µL of PCR)
l1: 2 log, l2: tetracycline resistance amplified from colony, l3: tetracycline resistance amplified from colony 2
l2-3: show no band = maybe annealing temperature to high

Gel does not schow any band.

=> Try amplification with lower annealing temperature.


PCR Conditions TR.W17.B

Reagent pSB1T3
Template picked colony
Primer fw 10 µM 1 µl HM14
Primer rev 10 µM 1 µl HM15
Phusion Ready Mix 10 µl
ddH2O 8 µl
DMSO -
Cycles Temperature DelH BB [°C] Time [s]
1 98 5
12 98 1
55 (touchdown -0,5°C) 5
72 30
18 98 1
55 5
72 30
1 72 5 min
1 4 inf

Result

Expected band: 1.468 Kb

Fig.17.7 gel of amplified tetracycline resistance (loaded 20 µL of PCR)
l1: 2 log, l2: tetracycline resistance amplified from new picked colony 1, l3: tetracycline resistance amplified from new picked colony 2,
l2-3: show no band

Gel does not show expected band.

=> Repeat amplification with miniprep, therefore miniprep the 3 colonies containing pSB1T3.


PCR Conditions TR.W17.C

Reagent pSB1T3 pSB1T3 pSB1T3
Template Minipreped pSB1T3 Minipreped pSB1T3 Minipreped pSB1T3
Primer fw 10 µM 2 µl HM14 2 µl HM14 2 µl HM14
Primer rev 10 µM 2 µl HM15 2 µl HM15 2 µl HM15
Phusion Ready Mix 10 µl 10 µl 10 µl
ddH2O 6 µl 6 µl 6 µl
Cycles Temperature [°C] Time [s]
1 98 5
12 98 1
55 (touchdown -0,5°C) 5
72 30
18 98 1
55 5
72 30
1 72 5 min
1 4 inf

Result

Expected band: 1.468 Kb

Fig.17.8 gel of amplified tetracycline resistance (loaded 20 µL of PCR)
l1: tetracycline resistance amplified from minipreped colony 1, l2: tetracycline resistance amplified from minipreped colony 2, l3: tetracycline resistance amplified from minipreped colony 3,l4: 2 log,
l1-3: show expected band = was cut

Gel does show expected band.

=> Fragment was cut and gel extracted (c= 132.1 ng/µl).


Amplification of Backbone

PCR Conditions BB.W7.A

With new primers (HM16 & HM17)

Reagent BB with tetracycline & without mRFP BB without mRFP
Template 1 µl BB 3.08 1 µl BB 3.08
Primer fw 10 µM 2 µl HM11 2 µl HM11
Primer rev 10 µm 2 µl HM16 2 µl HM17
Phusion Flash Ready Mix 10 µl 10 µl
ddH2O 5µl 5 µl
Cycles Temperature DelH BB [°C] Time [s]
1 98 5
12 98 1
69 (touchdown -0,5°C) 5
72 75
18 98 1
68 5
72 75
1 72 5 min
1 4 inf

Result

Expected band: ~ 4.4 Kb

Fig.17.9 gel of amplified BB (loaded 25 µL of PCR)
l1: BB amplified with HM16, l2: BB amplified with HM17
l1:specific band as expected = was cut out

Gel shows specific band for amplification using HM16.

=> Fragment wa scut and gel extracted. For HM17, run a two-step PCR because of it's high annealing temperature. Also we are going to rise the amplification time to 1:30 min.


PCR Conditions BB.W7.B

Reagent BB with tetracycline & without mRFP BB without mRFP BB with tetracycline & without mRFP BB without mRFP
Template 1 µl BB 3,08 1 µl BB 3,08 1 µl BB 3,08 1 µl BB 3,08
Primer fw 10 µM 2 µl HM11 2 µl HM11 5 µl HM11 5 µl HM11
Primer rev 10 µM 2 µl HM16 2 µl HM17 5 µl HM16 5 µl HM17
Phusion Flash Ready Mix 10 µl 10 µl 25 µl 25 µl
ddH2O 5 µl 5 µl 14 µl 14 µl
Cycles Temperature (20 µl = sample 1 & 2) [°C] Time Temperature (50 µl = sample 3 & 4) [°C] Time [s]
1 98 5 98 5
12 98 1 98 1
69 (touchdown -0,5°C) 5 -
72 90 72 90
18 98 1 98 1
68 5 -
72 90 72 90
1 72 5 min 72 5 min
1 4 inf 4 inf

Result

Expected band: ~ 4.4 Kb

Fig.17.10 gel of amplified BB with different primers (loaded 20 µL of PCR)
l1: BB amplified with HM16 by 2-step PCR, l2: BB amplified with HM17by 2-step PCR, l3: BB amplified with HM16, l4: BB amplified with HM17, l5: DelH-G0
all 4 samples (l1-4) showed a specific band at 4.4 Kb = was cut

All samples show expected length.

=> Fragments were cut and gel extracted.
Sample Concentration [ng/µl]
BB-16 76.7
BB-17 51.3


Restriction Digest with DpnI

  • Incubated at 37°C for 2.5 h
Sample [µl] Buffer [µl] Enzyme [µl]
18 BB-16 2.1 CutSmart Buffer 1 DpnI
18 BB-16 2.1 CutSmart Buffer 1 DpnI
  • Afterwards, a purification was performed with the nucleotide removal kit


Generation of DelH Plasmid pHM04 23-08

Summary of Fragments

Fragment Concentration [ng/µl] Date
G0 6.4 22-08
G1/2a 8.5 22-08
G2b 18.6 Example
BB Example 22-08


Gibson Assembly

Mix name DelH G0 DelH G1/2a DelH G2b BB17 Gibson Master Mix [µl] Final volume [µl]
E1 9 - - 0.5 10 20
E2 - 7 2.5 0.5 10 20
  • Incubate the Gibson Assembly for 1 h at 50°C


Electroporation

Sample Electroporated with Plated out Cuvette "exploded"
1 1 µl of E1 (5 µl Gibson + 10 µl ddH2O) 22.08.2013 v
2 14 µl of E1 (5 µl Gibson + 10 µl ddH2O) 22.08.2013 v
3 1 µl of E2 (5 µl Gibson + 10 µl ddH2O) 22.08.2013 -
4 14 µl of E2 (5 µl Gibson + 10 µl ddH2O) 22.08.2013 v
5 20 µl of E1 (purified by isoprop-precipitation) 22.08.2013 -
6 20 µl of E2 (purified by isoprop-precipitation) 22.08.2013 - (no pellet observed)


Colony-PCR CP.W17.C

  • 50 colonies of plate 5 (= isoprop purified E1 => G0-complete in Backbone)
  • 10 colonies of plate ...
  • 2 different screening are performed
  • PC = picked colony
  • S5 = Sample 5 (watch names above on construct DelH-BB)
Template 50 x 1 PC S5 50 x 1 PC S5 4 x 1 PC S3 4 x 1 PC S3
Expected length [bp] 663 2,500 663 2,500
Named A -J (5 colonies per tube) A -J (5 colonies per tube) 1-4 1-4
Primer fw 10 µM 10 x 1 µl VF2 10 x 1 µl HM13 4 x 1 µl VF2 4 x 1 µl HM13
Primer rev 10 µM 10 x 1 µl DN07 10 x 1 µl VR2 1 µl DN07 1 µl VR2
Dream-Taq Polymerase (2x) 10 x 10 µl 10 x 10 µl 4 x 10 µl 4 x 10 µl
ddH2O 10 x 8 µl 10 x 8 µl 4 x 8 µl 4 x 8 µl
Cycles Temperature Screening start[°C] Time [s] Temperature Screening end [°C] Time [s]
1 95 120 95 120
12 95 60 95 60
68 (touchdown -0.5°C) 30 60 (touchdown -0.5°C) 30
72 45 72 2:30 min
12x/ 34x 95 60 95 60
65 30 60 30
72 45 72 2:30 min
1 72 5 min 72 5 min
1 12 inf 12 inf

Result

Expected band: 663 bp (screening start), 2.5 Kb (screening end)

Fig.17.11 colony PCR of Gibson assembled DelH-BB with mRFP (loaded 20 µL of PCR)
l1:
l3-12:show an unexpected fragment at ~ 3Kb

Gel does not show expected bands.

=> Screen 10 minipreped colonies of the plate 5 and pick another 10 colonies of plate 1, 2, 3 and 6 (on plate 4 are no colonies).


Colony-PCR CP.W17.D

  • 2 different screening are performed
  • PC = picked colony
  • S5 = Sample 5 (watch names above on construct DelH-BB)
Template 10 x 1 PC S1 10 x 1 PC S1 10 x 1 PC S2 10 x 1 PC S2 10 x 1 PC S3 10 x 1 PC S3 10 x 1 PC S6 10 x 1 PC S610 x 1 µl of minipreped colony 10 x 1 µl of minipreped colony
Expected length [bp] 663 2.5 663 2.5 663 2.5 663 2.5 663 2.5
Named 1A-E (2 colonies per tube) 1F-J (2 colonies per tube) 2A-E (2 colonies per tube) 2F-J (2 colonies per tube) 3A-E (2 colonies per tube) 3F-J (2 colonies per tube) 6A-E (2 colonies per tube) 6F-J (2 colonies per tube) ............. ....................
Primer fw 10 µM 5 x 1 µl VF2 5 x 1 µl HM13 5 x 1 µl VF2 5 x 1 µl HM13 5 x 1 µl VF2 5 x 1 µl HM13 5 x 1 µl VF2 5 x 1 µl HM13 5 x 1 µl VF2 5 x 1 µl HM13
Primer rev 10 µM 5 x 1 µl DN07 5 x 1 µl VR2 5 µl DN07 5 µl VR2 5 x 1 µl DN07 5 x 1 µl VR2 5 µl DN07 5 µl VR2 5 x 1 µl DN07 5 x 1 µl VR2
Dream-Taq Polymerase (2x) 5 x 10 µl 5 x 10 µl 5 x 10 µl 5 x 10 µl 5 x 10 µl 5 x 10 µl 5 x 10 µl 5 x 10 µl 5 x 10 µl 5 x 10 µl
ddH2O 5 x 8 µl 5 x 8 µl 5 x 8 µl 5 x 8 µl 5 x 8 µl 5 x 8 µl 5 x 8 µl 5 x 8 µl 5 x 6 µl 5 x 6 µl
Cycles Temperature Screening start [°C] Time [s] Temperature Screening end [°C] Time [s]
1 95 120 95 120
12 95 60 95 60
68 (touchdown -0.5°C) 30 60 (touchdown -0.5°C) 30
72 45 72 2:30 min
12x/ 34x 95 60 95 60
65 30 60 30
72 45 72 2:30 min
1 72 5 min 72 5 min
1 12 inf 12 inf

Result

Expected band: 663 bp (screening start), 2.5 Kb (screening end)

Fig.17.13 colony PCR of Gibson assembled DelH-BB without mRFP with the screening primer VR2 and HM13 (loaded 1 µL of PCR)
l1:2log ladder l2-24: PCR of picked colonies from plate 1,2,3,5,6
no band at 663 bp observed
Fig.17.12 colony PCR of Gibson assembled DelH-BB without mRFP with the screening primer VF2 and DN11(loaded 1 µL of PCR)
l1:2log ladder l2-24: PCR of picked colonies from plate 1,2,3,5,6
no band at 663 bp observed

None of the gels shows expected fragment.

=> Overthink strategy.


Retrieved from "http://2013.igem.org/Team:Heidelberg/Templates/DelH_week17"