Team:Heidelberg/Templates/Del week15 overview

From 2013.igem.org

Contents

Strategy

Vector map of pFSN plasmid including Primers FS_01 to FS_35/SR_01 used for assembly of the desired genes from the D. acidovorans genome and the partsregistry backbone pSB4K5 .
Primers designed for a nested PCRs of the fragment DelO-P. The primers are shown on the Del-cluster as they are no more situated in DelO or DelP.

As already indicated last week, we decided to order another primer for the sequence region of DelF-G, beeing the primer FS_35_SR_01. This primer shows significantly better secondary structures and therefore annealing should be better. Furthermore we ordered various primers suitable for a nested PCR of DelOP.


Primer pairs, corresponding sequences and usage

Identifier Order date Note Sequence
FS_35: DelG_fw2013-08-05 Amplification of DelG from Delftia acidovorans Gibson Primer CATGCAGATCATCGTGGATGAATTC

Cultivation of D. acidovorans substrain SPH-1

Single read sequencing of several PCR products obtained so far was carried out by GATC. We aligned the so obtained sequences to the SPH-1 reference genome. (6.8 Mbp, NCBI Genome). Our alignments revealed significant differences between the two D. acidovorans strains: DSM-39 which we used as PCR template and SPH-1 based on which we have designed all PCR primers. As result of this sequence analysis, the strain D. acidovorans SPH-1 was ordered in order to have a suitable template for the primers we already designed and ordered so far. We hoped, that haveing the right strain at hand now, our PCRs should work better and we could hopefully proceed with the Gibson assembly soon. Lyohilized D. Acidovorans SPH-1 cells obtained from DSMZ were reactivated with Reactivation_medium and cultivated in Acidovorax complex medium according to the recoomondations by the DSMZ. Subsequently, liquid culture were inocculated (for glycerol stocks) and bacteria were also spread onto ACM-agar plates. Then we repeated our PCRs either by doing colony-PCR from colonies on the ACM-agar plates or by using 1┬ÁL of glycerol stock as template.

Amplification of Del Genes from D. acidovorans SPH-1 genome

Goals

Since we wanted to ensure that our amplicons fit the intended sequence and avoid any mutations resulting from primer missmatches all PCRs were repeated (even the previously successful ones), now using D. Acidovorans SPH-1 as template. Established PCR protocols will be repeated with the new strain as template and adopted if necessary. For the DelF-G fragment with which we have had problems before, we will try whether PCRs work better with the new template or the recently ordered primer FS_35/SR_01. The amplification of DelO-P will be repeated with the intially ordered Primers FS_22 and FS_13 to test whether the changed template also improves these PCRs. If it turns out, that primers are still not able to bind to the intended template, the abovementioned nested PCR strategy will be conducted as primers FS_27 to FS_33 also arrived this week.

Results



PCRs from D.acidovorans SPH-1
Gene(s) Fragment Primer combination Successful?
DelA
DelB
DelC
DelD
DelE
DelF
DelG
DelA-E Primer FS_02 and FS_03
Heidelberg Yes check.svg.png
DelA-F Primer FS_02 and FS_05
Heidelberg Yes check.svg.png
DelA-G Primer FS_02 and FS_23
Heidelberg Red x.svg.png
Primer FS_02 and FS_11
Heidelberg Red x.svg.png
Primer FS_02 and FS_26
Heidelberg Red x.svg.png
DelF-G Primer FS_21 and FS_26
Heidelberg Yes check.svg.png
DelG Primer FS_08 and FS_23
Heidelberg Yes check.svg.png
Primer SR_01 and FS_23
Heidelberg Yes check.svg.png
DelO
DelP

DelL
DelO-P Primer FS_22 and FS_13
Heidelberg Yes check.svg.png
Primer FS_22 and FS_13_short
Heidelberg Yes check.svg.png
Primer FS_22 and FS_27
Heidelberg Yes check.svg.png
Primer FS_33 and FS_13_short
Heidelberg Yes check.svg.png
Primer FS_33 and FS_27
Heidelberg Yes check.svg.png
Primer FS_31 and FS_29
Heidelberg Red x.svg.png
Primer FS_31 and FS_30
Heidelberg Tilde.png
Primer FS_32 and FS_29
Heidelberg Red x.svg.png
Primer FS_32 and FS_30
Heidelberg Yes check.svg.png
Primer FS_22 and FS_28
Heidelberg Yes check.svg.png
Primer FS_22 and FS_29
Heidelberg Red x.svg.png
DelL Primer FS_14 and FS_15
Heidelberg Yes check.svg.png
pSB4K5 pSB4K5 Primer FS_01 and FS_16
Heidelberg Yes check.svg.png



Test restriction digests of PCR amplified fragments
Fragment Primer Digestion enzyme Expected bands
DelF-G Primer FS_21 and FS_26 ClaI 2743, 1519, 1208
BglII 5500
DelG Primer FS_08 and FS_23 ClaI 3415, 3115
DelO-P Primer FS_22 and FS_13 EcoRI-HF 1883, 960