"

From 2013.igem.org

Gibson Primers

Name	Sequence	Melting Temperature	Function / Comment
Transmembrane Construct
EnvZ_F	gtaagtcacgacttgcgcacgccgctgac	70	Amplifies EnvZ does not include any overlap of the sensor part.
Envz_R	ggcggccgctctattagtgatggtggtgatgatgttacccttcttttgtcgtgc	75	Amplifies EnvZ (20 bp) and includes overlap (34 bp) of the free space between it and the terminator.
OmpR_F	agaaataattttgtttaactataagaaggagatatacatatgcaagagaactacaagatt	64	Amplifies OmpR and overlaps with the RBS and T7 promoter.  Note the backbone needs to have the T7 promoter and RBS already.
OmpR_R	tcatgctttagagccgtccggtacaaagac	65	Amplifies OmpR and does not include the second RBS to avoid homology.
Aer
Aer_f	tctttgtaccggacggctctaaagcatgaaaggagatataatgtcttctcatccgtatgt	71	Includes overlap with OmpR (29 bp), the RBS (11 bp) and overlap with Aer (20 bp)
Aer_R	TACGCgtcagcggcgtgcgcaagtcgtgacttacatttctgacactggacacctg	77	Include overlap with EnvZ (34 bp) and Aer (21 bp).  The temperature differance is quite extereme.
NarX
NarX_F	tctttgtaccggacggctctaaagcatgaAAGGAGATATAatgcttaaacgttgtctctc	71	Includes overlap with OmpR (29 bp), the RBS (11 bp) and overlap with NarX (20 bp)
NarX_R	tacgcgtcagcggcgtgcgcaagtcgtgacttacatttttatgctccagcccggc	79	Include overlap with EnvZ (34 bp) and NarX (21 bp).  The temperature differance is quite extereme.
Cytoplasmic Construct
NtrC_F	TAGAAATAATTTTGTTTAACTataagaaggagatatacatatgcaacgagggatagtctg	65	Amplifies NtrC and overlaps with the RBS and T7 promoter.  Note the backbone needs to have the T7 promoter and RBS already.
NtrC_R	gagctggggatggagtgaTTTTAACTTACGC	64	Amplifies NtrC and does not include the second RBS to avoid homology.
NtrB_F	ccgatggataaccagcgccgcTTAAGTCAGG	69	Amplifies NtrB does not include any overlap of the sensor part.
NtrB_R	GGCGGCCGCTCTATTAGTGATGGTGGTGATGATGttatttcctgataggcaggt	74	Amplifies NtrB (20 bp) and includes overlap (34 bp) of the free space between it and the terminator.
HemAT
HemAT_F	gtaagttaaaatcactccatccccagctcAAGGAGATATAttgttatttaaaaaagacag	67	Includes overlap with NtrC (29 bp), the RBS (11 bp) and overlap with HemAT (20 bp)
HemAT_R	CTGTTCCTGACTTAAGCggcgctggttatccatcggctggttgtactcgctttgaaac	75	Include overlap with NtrB (34 bp) and HemAT (21 bp).  The temperature differance is quite extereme.
RcoM
RcoM_F	gtaagttaaaatcactccatccccagctcAAGGAGATATAatgtttaaatattttgcaatt	67	Includes overlap with NtrC (29 bp), the RBS (11 bp) and overlap with RcoM (20 bp)
RcoM_R	gttcctgacttaagcggcgctggttatccatcggcttatggacggttacactacc	75	Include overlap with NtrB (34 bp) and RcoM (21 bp).  The temperature differance is quite extereme.
TodS
TodS_F	gtaagttaaaatcactccatccccagctcAAGGAGATATAatgagctccttggatagaaa	70	Includes overlap with NtrC (29 bp), the RBS (11 bp) and overlap with TodS (20 bp)
TodS_R	GTTCCTGACTTAAgcggcgctggttatccatcggatcggtaatattgcgcccttc	75	Include overlap with NtrB (34 bp) and TodS (21 bp)
LasR
LasR_F
LasR_R
			Note: APE and IDT primer Tm differ

[back]