Team:AITM-Nepal/Part1
From 2013.igem.org
(Difference between revisions)
Gmanandhar (Talk | contribs) (Created page with "<html> <head> <style> /* Igm Css Override */ #catlinks,#top-section,#footer-box,#top,#p-logo { display:none; } h1 { display:none; } - →Css Override Complete: /*...") |
Gmanandhar (Talk | contribs) |
||
Line 218: | Line 218: | ||
<div style="margin:auto; width:1000px; color:#555;" > | <div style="margin:auto; width:1000px; color:#555;" > | ||
- | + | <p>Toll like receptor 8 transfection in HEK 293 cell line | |
- | Toll like receptor 8 transfection in HEK 293 cell line | + | |
Plasmid information : | Plasmid information : | ||
- | + | </p> | |
- | pcDNA3-TLR8-YFP | + | <table> |
- | + | <tr> | |
- | Toll-Like Receptor 8 | + | <th>pcDNA3-TLR8-YFP</th> |
- | + | </tr> | |
- | TLR8 | + | <tr> |
- | + | <td> Gene/insert name:</td> | |
- | 3177 | + | <td>Toll-Like Receptor 8</td> |
- | + | </tr> | |
- | H. sapiens (human) | + | <tr> |
- | + | <td> Alt name:</td> | |
- | NM_016610 | + | <td>TLR8</td> |
- | + | </tr> | |
- | TLR8 (CD288, MGC119599, MGC119600) | + | <tr> |
- | + | <td>Insert size:</td> | |
- | YFP | + | <td>3177</td> |
- | + | </tr> | |
- | C terminal on backbone | + | <tr> |
- | + | <td>Species:</td> | |
- | pcDNA3-YFP | + | <td>H. sapiens (human)</td> |
- | + | </tr> | |
- | + | <tr> | |
- | Mammalian Expression | + | <td>GenBank ID:</td> |
- | + | <td>NM_016610</td> | |
- | 6100 | + | </tr> |
- | + | <tr> | |
- | BamHI | + | <td>Entrez Gene:</td> |
- | + | <td>TLR8 (CD288, MGC119599, MGC119600)</td> | |
- | No | + | </tr> |
- | + | <tr> | |
- | XhoI | + | <td>Fusion protein or tag:</td> |
- | + | <td>YFP</td> | |
- | No | + | </tr> |
- | + | <tr> | |
- | T7 | + | <td>Terminal:</td> |
- | + | <td>C terminal on backbone</td> | |
- | GTCTTGTAGTTGCCGTCGTC | + | </tr> |
- | + | <tr> | |
- | Ampicillin | + | <td>Vector backbone:</td> |
- | + | <td>pcDNA3-YFP</td> | |
- | DH5alpha | + | </tr> |
- | + | <tr> | |
- | 37 | + | <td>Vector type:</td> |
- | + | <td>Mammalian Expression</td> | |
- | High Copy | + | </tr> |
- | + | <tr> | |
- | Neomycin | + | <td>Backbone size w/o insert (bp):</td> |
+ | <td>6100</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>Cloning site 5':</td> | ||
+ | <td>BamHI</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>Site destroyed during cloning:</td> | ||
+ | <td>No</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>Cloning site 3':</td> | ||
+ | <td>XhoI</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>Site destroyed during cloning:</td> | ||
+ | <td>No</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>5' sequencing primer:</td> | ||
+ | <td>T7</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>3' sequencing primer:</td> | ||
+ | <td>GTCTTGTAGTTGCCGTCGTC</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>Bacterial resistance(s)</td> | ||
+ | <td>Ampicillin</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>Growth strain(s)</td> | ||
+ | <td>DH5alpha</td> | ||
+ | </tr> | ||
+ | <td>Growth temperature (℃):</td> | ||
+ | <td>37</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>High or low copy:</td> | ||
+ | <td>High Copy</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>Selectable markers:</td> | ||
+ | <td>Neomycin</td> | ||
+ | </tr> | ||
+ | </table> | ||
Revision as of 07:47, 24 September 2013
Toll like receptor 8 transfection in HEK 293 cell line Plasmid information :
pcDNA3-TLR8-YFP | |
---|---|
Gene/insert name: | Toll-Like Receptor 8 |
Alt name: | TLR8 |
Insert size: | 3177 |
Species: | H. sapiens (human) |
GenBank ID: | NM_016610 |
Entrez Gene: | TLR8 (CD288, MGC119599, MGC119600) |
Fusion protein or tag: | YFP |
Terminal: | C terminal on backbone |
Vector backbone: | pcDNA3-YFP |
Vector type: | Mammalian Expression |
Backbone size w/o insert (bp): | 6100 |
Cloning site 5': | BamHI |
Site destroyed during cloning: | No |
Cloning site 3': | XhoI |
Site destroyed during cloning: | No |
5' sequencing primer: | T7 |
3' sequencing primer: | GTCTTGTAGTTGCCGTCGTC |
Bacterial resistance(s) | Ampicillin |
Growth strain(s) | DH5alpha | Growth temperature (℃): | 37 |
High or low copy: | High Copy |
Selectable markers: | Neomycin |