Team:Heidelberg/Templates/DelH overview18

From 2013.igem.org

(Difference between revisions)
 
Line 1: Line 1:
 +
===Vector Map, Primers and BioBricks===
===Vector Map, Primers and BioBricks===
[[File:Heidelberg_PHM05-DelH-tetR-pSB6A1.png|300px|left|thumb|Vector map of the [[:File:Heidelberg_PHM05-DelH-tetR-pSB6A1.gb|PHM05-DelH-tetR-pSB6A1 Gibson plasmid]].]]
[[File:Heidelberg_PHM05-DelH-tetR-pSB6A1.png|300px|left|thumb|Vector map of the [[:File:Heidelberg_PHM05-DelH-tetR-pSB6A1.gb|PHM05-DelH-tetR-pSB6A1 Gibson plasmid]].]]

Latest revision as of 09:41, 2 October 2013

Vector Map, Primers and BioBricks

Backbone Part Distribution Plate Well Usage Resistance
pSB1T3 J04450 Spring 2013 2 2B Backbone to amplify the tetracycline-resistance Tetracycline
pSB6A1 J04450 Spring 2012 1 1K Backbone for DelH Ampicillin
Identifier Order date Note Sequence
HM14:DelH_tetR_fw2013-08-16 Gibson-Primer DelH-tetR: amplifies the tetracycline resistance from the pSB1T3 Backbone and creates an overlap to the end of DelH ATTGGCGCTGGAGTACGCGCTGGACTGA atgaagttttaaatcaatctaaag
HM15:tetR_stop_BB_rev2013-08-16 Gibson-Primer tetR-pSB6A1: amplifies the tetracycline resistance and creates an overlap with the Terminator of the Backbone pSB6A1 Cgactgagcctttcgttttatttgatgcctggc ctcgtgatacgcctatttttatagg
HM16:tetR_pSB6A1_fw2013-08-16Gibson-Primer DelH, amplifies the Backbone pSB6A1 creating an overlap with the tetracycline resistance Aaaaataggcgtatcacgag gccaggcatcaaataaaacgaaaggctcag
FS_66: DelH_rv2013-08-26 Amplification of DelH from Delftia acidovorans Gibson Primer TGGGCATTCACCGCATCGATC
FS_67: DelH_fw2013-08-26 Amplification of DelH from Delftia acidovorans Gibson Primer CTTCACGTTGATTGCGCATG
FS_68: DelH_rv2013-08-26 Amplification of DelH from Delftia acidovorans Gibson Primer CAGAAGAACTCCCAGACCGAC
FS_69: DelH_fw2013-08-26 Amplification of DelH from Delftia acidovorans Gibson Primer GACACCGTTCAGCTTCGATG
FS_70: DelH_rv2013-08-26 Amplification of DelH from Delftia acidovorans Gibson Primer GAAGCTGCTCCGCTGATAGAT
FS_71: DelH_fw2013-08-26 Amplification of DelH from Delftia acidovorans Gibson Primer ATGTGCTGTCGCTCAAGATG
FS_72_SR_02_fw2013-08-30 Screening of pHM04 ATGTGCTGTCGCTCAAGATG
FS_73_SR_03_fw2013-08-30 Screening of pHM04 GTGCTGTTTGGCCGTATG
FS_74_SR_04_fw2013-08-30 Screening of pHM04 ATCAGGTGCTGAGCTACGAC
FS_75_SR_05_fw2013-08-30 Screening of pHM04 CTGTTCATCAACACCTTGCC
FS_76_SR_06_rv2013-08-30 Screening of pHM04 GAAGACAGTCATAAGTGCGGC