Team:UNITN-Trento/Notebook/Labposts/07/20

From 2013.igem.org

(Difference between revisions)

Revision as of 08:26, 3 October 2013

{ "date" : "2013-07-10", "author" : "gabriele-viola", "title" : "Reboot: starting from the beginning", "content" : "Since the new forward primer (with the entire prefix) arrived, I started again from the beginning.

SAM synthetase extraction

The new primer forward has just the EcoRI restriction site added at its beginning (complete prefix):
GAATTCGCGGCCGCTTCTAGAGAAGGAGGAACTACTATGGCAAAACACCTTTTT
It has a Tm = 68.7°C.

Then I performed two Phusion PCR (one GC and one HF) and one Phusion/RBC PCR to identify the best protocol for SAM synthetase extraction with the new primer.

Phusion PCRs

PCR Mixes
	Mix HF (1)	Mix GC (2)
Phusion Buffer HF	10µl	0
Phusion Buffer GC	0	10µl
dNTPs	1µl
template	1µl
Primer Fw	2.5µl
Primer Rv
Phusion pol	0.5µl
Water	33.5µl

Phusion Settings
Step	Temperature	Time	Go to
1	98°C	30 sec
2	98°C	10 sec
3	72°C	35 sec	step #2, 30 times
4	72°C	10 min
5	4°C	pause

Phusion/RBC PCR

PCR Mix
	Mix RBC (3)
Template	1µl
dNTPs	0.5µl
Primer Fw	1µl
Primer Rv
Buffer RBC	5µl
Phusion pol	0.3µl
RBC	0.25µl
Water	40.95µl

PCR Settings
Step	Temperature	Time	Go to
1	94°C	2 min
2	94°C	1 min
3	62.5°C	1 min
4	72°C	1 min 9 sec	step #2, 30 times
5	72°C	7 min
6	4°C	pause

The products of these three PCRs were then loaded on a 1% agarose gel.

Gel

Loading scheme
1kb ladder	GC(2)	HF(1)	RBC(3)

$\"Gel\"$

As showed by the gel, only the Phusion/RBC PCR was successful.

Purifications

Then, I purified the EX-SAMsynthetase-SP sample produced today with the Phusion/RBC PCR, and the 5 R0010 PCR insert that were amplified on tuesday 02/07.

Sample	Type	Quantity
RBC(3)	EX-SAMsynthetase-SP	103.6ng/µl
HF1	R0010 insert	17.5ng/µl
HF2	R0010 insert	19.5ng/µl
HF3	R0010 insert	15.9ng/µl
G1	R0010 insert	17.8ng/µl
G2	R0010 insert	16.3ng/µl

OverNight Purification

Then, Viola was so polite to prepare the O/N digestion mixes (with the usual protocol) and incubate them at 37°C. An EX-SAMsynthetase-SP sample (RBC#3 from today, 103.6ng/µl) and a linear pSB1C3 sample (G3A from 01/07, 44.8ng/µl) were restricted with XbaI and PstI (Nebuffer2).

Digestion mixes

	RBC#3	G3A
Template	40µl	50µl
XbaI	2.5µl	1.5µl
PstI
NEBuffer 2	10µl	5µl
BSA	10µl	5µl
Water	35µl	0

", "tags" : "SAMsynthetase" }

@@ Line 1: / Line 1: @@
 {
-	"date" : "2013-07-23",
+	"date" : "2013-07-10",
-	"author" : "fabio",
+	"author" : "gabriele-viola",
-	"title" : " the blue ligation: the never ending story !",
+	"title" : "Reboot: starting from the beginning",
-	"content" : "<html> this morning I added Sap to the 016 digestion and dPnl to the other two, then I purified them and quantified'em: <br>O16: 29,8 ng/ul <br>006: 16,2 ng/ul <br>R0010: 6,1 ng/ul <br>Then I started the ligation following the ligation protocol: at the end of it, I transformed 10ul of the ligation in 200 Neb10b and plated.Meanwhile Bruno miniprepped k952003 inocula and the screening was successful!!</html>",
+	"content" : "<html>Since the new forward primer (with the entire prefix) arrived, I started again from the beginning.<br/><br/><h3>SAM synthetase extraction</h3>The new primer forward has just the EcoRI restriction site added at its beginning (complete prefix):<br/>GAATTCGCGGCCGCTTCTAGAGAAGGAGGAACTACTATGGCAAAACACCTTTTT<br/>It has a Tm = 68.7&deg;C.<br/><br/>Then I performed two Phusion PCR (one GC and one HF) and one Phusion/RBC PCR to identify the best protocol for SAM synthetase extraction with the new primer.</html>{{:Team:UNITN-Trento/Templates/Styles/Spoiler|Phusion PCRs|<html><center><table class=\"tn-sp-table\"><tr><th colspan=\"3\">PCR Mixes</th></tr><tr><td style=\"border:none;\"></td><th>Mix HF (1)</th><th>Mix GC (2)</th></tr><tr><td>Phusion Buffer HF</td><td>10&micro;l</td><td>0</td></tr><tr><td>Phusion Buffer GC</td><td>0</td><td>10&micro;l</td></tr><tr><td>dNTPs</td><td colspan=\"2\">1&micro;l</td></tr><tr><td>template</td><td colspan=\"2\">1&micro;l</td></tr><tr><td>Primer Fw</td><td colspan=\"2\" rowspan=\"2\">2.5&micro;l</td></tr><tr><td>Primer Rv</td></tr><tr><td>Phusion pol</td><td colspan=\"2\">0.5&micro;l</td></tr><tr><td>Water</td><td colspan=\"2\">33.5&micro;l</td></tr></table><br/><br/><table class=\"tn-sp-table\"><tr><th colspan=\"4\">Phusion Settings</th></tr><tr><th>Step</th><th>Temperature</th><th>Time</th><th>Go to</th></tr><tr><td>1</td><td>98&deg;C</td><td>30 sec</td><td></td></tr><tr><td>2</td><td>98&deg;C</td><td>10 sec</td><td></td></tr><tr><td>3</td><td>72&deg;C</td><td>35 sec</td><td>step #2, 30 times</td></tr><tr><td>4</td><td>72&deg;C</td><td>10 min</td><td></td></tr><tr><td>5</td><td>4&deg;C</td><td>pause</td><td></td></tr></table></center></html>}}<html></html>{{:Team:UNITN-Trento/Templates/Styles/Spoiler|Phusion/RBC PCR|<html><center><table class=\"tn-sp-table\"><tr><th colspan=\"2\">PCR Mix</th></tr><tr><td style=\"border:none;\"></td><td>Mix RBC (3)</td></tr><tr><td>Template</td><td>1&micro;l</td></tr><tr><td>dNTPs</td><td>0.5&micro;l</td></tr><tr><td>Primer Fw</td><td rowspan=\"2\">1&micro;l</td></tr><tr><td>Primer Rv</td></tr><tr><td>Buffer RBC</td><td>5&micro;l</td></tr><tr><td>Phusion pol</td><td>0.3&micro;l</td></tr><tr><td>RBC</td><td>0.25&micro;l</td></tr><tr><td>Water</td><td>40.95&micro;l</td></tr></table><br/><br/><table class=\"tn-sp-table\"><tr><th colspan=\"4\">PCR Settings</th></tr><tr><th>Step</th><th>Temperature</th><th>Time</th><th>Go to</th></tr><tr><td>1</td><td>94&deg;C</td><td>2 min</td><td></td></tr><tr><td>2</td><td>94&deg;C</td><td>1 min</td><td></td></tr><tr><td>3</td><td>62.5&deg;C</td><td>1 min</td><td></td></tr><tr><td>4</td><td>72&deg;C</td><td>1 min 9 sec</td><td>step #2, 30 times</td></tr><tr><td>5</td><td>72&deg;C</td><td>7 min</td><td></td></tr><tr><td>6</td><td>4&deg;C</td><td>pause</td><td></td></tr></table></html>}}<html><br/>The products of these three PCRs were then loaded on a 1% agarose gel.</html>{{:Team:UNITN-Trento/Templates/Styles/Spoiler|Gel|<html><center><table class=\"tn-sp-table\"><tr><th colspan=\"4\">Loading scheme</th></tr><tr><td>1kb ladder</td><td>GC(2)</td><td>HF(1)</td><td>RBC(3)</td></tr></table><img src=\"https://static.igem.org/mediawiki/2013/8/82/Tn-20130710-GG_SAMsynthetase_newPrimers_chosePCR.jpg\" alt=\"Gel\" width=\"450px\"></center></html>}}<html>As showed by the gel, only the Phusion/RBC PCR was successful.<br/><br/><hr><h3>Purifications</h3>Then, I purified the EX-SAMsynthetase-SP sample produced today with the Phusion/RBC PCR, and the 5 R0010 PCR insert that were amplified on <a href=\"https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/Notebook#tn-post-2013-07-02-gabriele\">tuesday 02/07</a>.<center><table class=\"tn-sp-table\"><tr><th>Sample</th><th>Type</th><th>Quantity</th></tr><tr><td>RBC(3)</td><td>EX-SAMsynthetase-SP</td><td>103.6ng/&micro;l</td></tr><tr><td>HF1</td><td>R0010 insert</td><td>17.5ng/&micro;l</td></tr><tr><td>HF2</td><td>R0010 insert</td><td>19.5ng/&micro;l</td></tr><tr><td>HF3</td><td>R0010 insert</td><td>15.9ng/&micro;l</td></tr><tr><td>G1</td><td>R0010 insert</td><td>17.8ng/&micro;l</td></tr><tr><td>G2</td><td>R0010 insert</td><td>16.3ng/&micro;l</td></tr></table></center><br><hr><h3>OverNight Purification</h3>Then, Viola was so polite to prepare the O/N digestion mixes (<a href=\"https://2013.igem.org/Team:UNITN-Trento/Protocols#Digestion\">with the usual protocol</a>) and incubate them at 37&deg;C. An EX-SAMsynthetase-SP sample (RBC#3 from today, 103.6ng/&micro;l) and a linear pSB1C3 sample (G3A from <a href=\"https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/Notebook#tn-post-2013-07-01-Gabriele\">01/07</a>, 44.8ng/&micro;l) were restricted with XbaI and PstI (Nebuffer2).</html>{{:Team:UNITN-Trento/Templates/Styles/Spoiler|Digestion mixes|<html><center><table class=\"tn-sp-table\"><tr><td style=\"border:none;\"></td><th>RBC#3</th><th>G3A</th></tr><tr><td>Template</td><td>40&micro;l</td><td>50&micro;l</td></tr><tr><td>XbaI</td><td rowspan=\"2\">2.5&micro;l</td><td rowspan=\"2\">1.5&micro;l</td></tr><tr><td>PstI</td></tr><tr><td>NEBuffer 2</td><td>10&micro;l</td><td>5&micro;l</td></tr><tr><td>BSA</td><td>10&micro;l</td><td>5&micro;l</td></tr><tr><td>Water</td><td>35&micro;l</td><td>0</td></tr></table></center></html>}}<html></html>",
-	"tags" : " YF1_FixJ - FixK2- ho1_PcyA_cph8-OmpR- YF1_FixJ_PfixK2_amilGFP "
+	"tags" : "SAMsynthetase"
 }