Team:Paris Saclay/Primers

From 2013.igem.org

(Difference between revisions)
(Created page with " {| class="wikitable" |- ! scope="col"| Project ! scope="col"| Sequence ! scope="col"| Description |- ! scope="row"| sdfdsfsd | $649 | Heated lid, good performance, hard to manuf...")
Line 2: Line 2:
{| class="wikitable"
{| class="wikitable"
|-
|-
 +
! scope="col"| Name
! scope="col"| Project
! scope="col"| Project
! scope="col"| Sequence
! scope="col"| Sequence
! scope="col"| Description
! scope="col"| Description
|-
|-
-
! scope="row"| sdfdsfsd
+
! scope="row"| BBa_C0051-Forward
-
| $649
+
| Gemote
-
| Heated lid, good performance, hard to manufacture.
+
| atgagcacaaaaaagaaaccatt
 +
| No description
 +
|-
 +
! scope="row"| BBa_C0051-Forward
 +
| Gemote
 +
|  atgagcacaaaaaagaaaccatt
 +
| No description
|-
|-
! scope="row"| [http://www.instructables.com/id/Arduino-PCR-thermal-cycler-for-under-85/ Arduino PCR]
! scope="row"| [http://www.instructables.com/id/Arduino-PCR-thermal-cycler-for-under-85/ Arduino PCR]
Line 14: Line 21:
| No heated lid, room for only 2 tubes, fan-only cooling.
| No heated lid, room for only 2 tubes, fan-only cooling.
|-
|-
-
! scope="row"| sdvsdfsdfsd
+
 
-
| blqqbdssd
+
-
| No data available, probably slow with no heated lid, 1 slot.
+
-
|-
+
-
! scope="row"| dfgfdgfdfd
+
-
| $350
+
-
| 7 slots, no heated lid, fan-only cooling.
+
-
|-
+
|}
|}

Revision as of 18:23, 3 October 2013

Name Project Sequence Description
BBa_C0051-Forward Gemote atgagcacaaaaaagaaaccatt No description
BBa_C0051-Forward Gemote atgagcacaaaaaagaaaccatt No description
[http://www.instructables.com/id/Arduino-PCR-thermal-cycler-for-under-85/ Arduino PCR] $85 No heated lid, room for only 2 tubes, fan-only cooling.
Retrieved from "http://2013.igem.org/Team:Paris_Saclay/Primers"