Team:NTNU-Trondheim/Notebook/September

From 2013.igem.org

(Difference between revisions)
 
(44 intermediate revisions not shown)
Line 19: Line 19:
-
<div id="top-section3"><center><img src="https://static.igem.org/mediawiki/2013/5/55/Logo-ntnu.png" alt="header" border="0"  usemap="#igemmap" width="1000" height="400"></center></div>
+
<div id="top-section3"><center><img src="https://static.igem.org/mediawiki/2013/2/21/Logo2_NTNU.png" alt="header" border="0"  usemap="#igemmap" width="1000" height="400"></center></div>
Line 31: Line 31:
<div class= "layout-1000" >
<div class= "layout-1000" >
<div class="row">
<div class="row">
-
<div class="col12-2">
+
<div id='cssmenu'>
-
<ul class="topnav">
+
<ul>
-
    <li><a href="https://2013.igem.org/Team:NTNU-Trondheim">Home</a></li>
+
  <li class='active'><a href='https://2013.igem.org/Team:NTNU-Trondheim'><span>Home</span></a></li>
-
    <li>
+
  <li class='has-sub'><a href='#'><span>Project</span></a>
-
        <a href="https://2013.igem.org/Team:NTNU-Trondheim/Project">Project</a>
+
      <ul>
-
    </li>
+
        <li><a href='https://2013.igem.org/Team:NTNU-Trondheim/Project'><span>Project description</span></a></li>
-
    <li>
+
        <li><a href='https://2013.igem.org/Team:NTNU-Trondheim/novelapproach'><span>A novel approach</span></a></li>
-
        <a href="https://2013.igem.org/Team:NTNU-Trondheim/Parts">Parts</a>
+
        <li><a href='https://2013.igem.org/Team:NTNU-Trondheim/Model'><span>Modelling</span></a></li>
-
    </li>
+
        <li><a href='https://2013.igem.org/Team:NTNU-Trondheim/Experiments_and_Results'><span>Experiments and Results</span></a></li>
-
    <li><a href="https://2013.igem.org/Team:NTNU-Trondheim/Notebook">Notebook</a></li>
+
        <li><a href='https://2013.igem.org/Team:NTNU-Trondheim/Parts'><span>BioBrick Parts</span></a></li>
-
    <li><a href="https://2013.igem.org/Team:NTNU-Trondheim/Team">Team</a></li>
+
        <li class='last'><a href='https://2013.igem.org/Team:NTNU-Trondheim/Acknowledgements'><span>Acknowledgements</span></a></li>
-
     <li><a href="https://2013.igem.org/Team:NTNU-Trondheim/Achievements">Judging</a></li>
+
      </ul>
-
    <li><a href="https://2013.igem.org/Team:NTNU-Trondheim/Safety">Safety</a></li>
+
  </li>
 +
  <li class='has-sub'><a href='#'><span>Technical Stuff</span></a>
 +
      <ul>
 +
        <li><a href='https://2013.igem.org/Team:NTNU-Trondheim/Notebook'><span>Notebooks</span></a></li>
 +
        <li><a href='https://2013.igem.org/Team:NTNU-Trondheim/Protocols'><span>Protocols</span></a></li>
 +
        <li><a href='https://2013.igem.org/Team:NTNU-Trondheim/Primers'><span>Primers</span></a></li>
 +
        <li class='last'><a href='https://2013.igem.org/Team:NTNU-Trondheim/Safety'><span>Safety</span></a></li>
 +
      </ul>
 +
  </li>
 +
  <li class='has-sub'><a href='#'><span>Team</span></a>
 +
      <ul>
 +
        <li><a href='https://2013.igem.org/Team:NTNU-Trondheim/Team'><span>Meet the team</span></a></li>
 +
        <li class='last'><a href='https://igem.org/Team.cgi?id=1082'><span>Official Team Profile</span></a></li>
 +
      </ul>
 +
  </li>
 +
  <li class='has-sub'><a href='https://2013.igem.org/Team:NTNU-Trondheim/Outreach'><span>Outreach</span></a>
 +
  </li>
 +
     <li class='has-sub'><a href='#'><span>Judging</span></a>
 +
    <ul>
 +
    <li><a href='https://2013.igem.org/Team:NTNU-Trondheim/Achievements'><span>Achievements</span></a></li>
 +
    <li class='last'><a href='https://2013.igem.org/Team:NTNU-Trondheim/Medalcriteria'><span>Medal criteria</span></a></li>
 +
    </ul>
 +
    </li>
 +
  <li class='last'><a href='https://2012.igem.org/Team:NTNU_Trondheim/Matchmaker'><span>Matchmaker</span></a></li>
</ul>
</ul>
 +
</div>
<div> <div class ="row-end"> </div>
<div> <div class ="row-end"> </div>
</div>
</div>
</div>
</div>
 +
<div class="row">
<div class="row">
-
<div class="col12" id="spacer2"></div>
+
<div class="col12" id="spacer3"></div>
<div class="row-end"> </div>
<div class="row-end"> </div>
</div>
</div>
<div class="row">
<div class="row">
-
<div class="col12" id="spacer2"></div>
+
<div class="col12-3" align = "justify">
-
<div class="row-end"> </div>
+
<div class="col12-3" align = "center" style="background-color:#C3A7F3;>
 +
<p style="text-align:center; color:black; "><b> September </b></p> </div>
 +
<div class ="row-end"> </div>
</div>
</div>
Line 65: Line 92:
<p style="text-align:center; color:black; "> Tuesday 03.09.2013</p> </div>
<p style="text-align:center; color:black; "> Tuesday 03.09.2013</p> </div>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
-
</div
+
</div>
<div class="row">
<div class="row">
Line 72: Line 99:
<p style="text-align:center; color:black; ">Analysis of sequencing results</p> </div>
<p style="text-align:center; color:black; ">Analysis of sequencing results</p> </div>
<br><br>
<br><br>
-
<p>Today we got back the sequencing results from last week (see Thursday 29.08.2013). The figures below show the alignments of the samples (always first line) and the expected sequences (always second line). Red indicates proper alignment, blue indicates mismatches.
+
<p>Today we got back the sequencing results from last week (see Thursday 29.08.2013). The figures below show the alignments of the samples (always first line) and the expected sequences (always second line). Red indicates proper alignment, blue indicates mismatches.<br>
-
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/6/6c/PrG_S2.jpg"> <img src="https://static.igem.org/mediawiki/2013/6/6c/PrG_S2.jpg" width="303">
+
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/6/6c/PrG_S2.jpg"> <img src="https://static.igem.org/mediawiki/2013/6/6c/PrG_S2.jpg" width="230">
  <p style="text-align:center; color:black; "> Figure:  Alignment of tat_ProteinG S2. As the last time there seems to be a deletion on a guanine residue that shifting the reading frame. In addition the last part of the sequence does not seem to match like S3 and D8 did.</p> </div>
  <p style="text-align:center; color:black; "> Figure:  Alignment of tat_ProteinG S2. As the last time there seems to be a deletion on a guanine residue that shifting the reading frame. In addition the last part of the sequence does not seem to match like S3 and D8 did.</p> </div>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
</div>
</div>
-
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/f/f3/PrG_C4.jpg"> <img src="https://static.igem.org/mediawiki/2013/f/f3/PrG_C4.jpg" width="303">
+
<div class="col3-2" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/f/f3/PrG_C4.jpg"> <img src="https://static.igem.org/mediawiki/2013/f/f3/PrG_C4.jpg" width="230">
-
  <p style="text-align:center; color:black; "> Figure 1.</p> </div>
+
  <p style="text-align:center; color:black; "> C4 </p> </div>
-
<div class ="row-end"> </div>
+
 
-
</div>
+
<div class="col3-2" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/f/fa/PrG_C5.jpg"> <img src="https://static.igem.org/mediawiki/2013/f/fa/PrG_C5.jpg" width="230">
-
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/f/fa/PrG_C5.jpg"> <img src="https://static.igem.org/mediawiki/2013/f/fa/PrG_C5.jpg" width="303">
+
  <p style="text-align:center; color:black; ">C5</p> </div>
-
  <p style="text-align:center; color:black; "> Figure 1.</p> </div>
+
 
-
<div class ="row-end"> </div>
+
<div class="col3-2" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/8/86/PrG_DT2.jpg"> <img src="https://static.igem.org/mediawiki/2013/8/86/PrG_DT2.jpg" width="230">
-
</div>
+
  <p style="text-align:center; color:black; ">DT2 </p> </div>
-
<div class="col4" style="background-color:white;><a href="https://2013.igem.org/File:PrG_DT2.jpg"> <img src="https://2013.igem.org/File:PrG_DT2.jpg" width="303">
+
 
-
<p style="text-align:center; color:black; "> Figure 1.</p> </div>
+
<div class="col3-2" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/a/a7/PrG_DT7.jpg"> <img src="https://static.igem.org/mediawiki/2013/a/a7/PrG_DT7.jpg" width="230">
-
<div class ="row-end"> </div>
+
  <p style="text-align:center; color:black; ">DT7</p> </div>
-
</div>
+
-
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/a/a7/PrG_DT7.jpg"> <img src="https://static.igem.org/mediawiki/2013/a/a7/PrG_DT7.jpg" width="303">
+
-
  <p style="text-align:center; color:black; "> Figure 1.</p> </div>
+
-
<div class ="row-end"> </div>
+
-
</div>
+
-
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/0/04/PrG_DT10.jpg"> <img src="https://static.igem.org/mediawiki/2013/0/04/PrG_DT10.jpg" width="303">
+
-
  <p style="text-align:center; color:black; "> Figure 1.</p> </div>
+
<div class ="row-end"> </div>
<div class ="row-end"> </div>
</div>
</div>
-
<center>figures: Alignment of tat_ProteinG C4, tat_ProteinG C5, tat_ProteinG DT2, tat_ProteinG DT7 and tat_ProteinG  DT10. None of these sequences makes any sense. It is safe to conclude that ProteinG is not in these sequences.</center>
+
<div class="col3-2" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/0/04/PrG_DT10.jpg"> <img src="https://static.igem.org/mediawiki/2013/0/04/PrG_DT10.jpg" width="230">
 +
<p style="text-align:center; color:black; "> DT10</p> </div>
-
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/a/a9/PrG_DT5.jpg"> <img src="https://static.igem.org/mediawiki/2013/a/a9/PrG_DT5.jpg" width="303">
+
<div class="col3-2" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/a/a9/PrG_DT5.jpg"> <img src="https://static.igem.org/mediawiki/2013/a/a9/PrG_DT5.jpg" width="230">
-
  <p style="text-align:center; color:black; "> Figure 1.</p> </div>
+
  <p style="text-align:center; color:black; ">DT5</p> </div>
 +
 
 +
<div class="col3-2" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/d/de/PrG_DT6.jpg"> <img src="https://static.igem.org/mediawiki/2013/d/de/PrG_DT6.jpg" width="230">
 +
<p style="text-align:center; color:black; "> DT6</p> </div>
 +
 
 +
<div class="col3-2" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/1/13/PrG_DT9.jpg"> <img src="https://static.igem.org/mediawiki/2013/1/13/PrG_DT9.jpg" width="230">
 +
<p style="text-align:center; color:black; "> DT9</p> </div>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
</div>
</div>
-
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/d/de/PrG_DT6.jpg"> <img src="https://static.igem.org/mediawiki/2013/d/de/PrG_DT6.jpg" width="303">
+
 
-
<p style="text-align:center; color:black; "> Figure 1.</p> </div>
+
<div class="row">
-
<div class ="row-end"> </div>
+
<div class="col12-3" align = "justify">
-
</div>
+
<p>Figures: Alignment of tat_ProteinG C4, tat_ProteinG C5, tat_ProteinG DT2, tat_ProteinG DT7 and tat_ProteinG  DT10. None of these sequences makes any sense. It is safe to conclude that ProteinG is not in these sequences.<br></p>
-
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/1/13/PrG_DT9.jpg"> <img src="https://static.igem.org/mediawiki/2013/1/13/PrG_DT9.jpg" width="303">
+
-
<p style="text-align:center; color:black; "> Figure 1.</p> </div>
+
<div class ="row-end"> </div>
<div class ="row-end"> </div>
</div>
</div>
-
<center>figures: Alignment of tat_ProteinG DT5, tat_ProteinG DT6 and tat_ProteinG DT9. ProteinG seems to be there but most of tat is absent. Only the first part of tat is there.</center>
+
<div class="col3-2" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/d/d8/TCY1.jpg"> <img src="https://static.igem.org/mediawiki/2013/d/d8/TCY1.jpg" width="230">
 +
<p style="text-align:center; color:black; "> TCY1</p> </div>
 +
 
 +
<div class="col3-2" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/9/92/TCY2.jpg"> <img src="https://static.igem.org/mediawiki/2013/9/92/TCY2.jpg" width="230">
 +
<p style="text-align:center; color:black; ">TCY2</p> </div>
 +
 
 +
<div class="col3-2" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/9/9e/TCY3.jpg"> <img src="https://static.igem.org/mediawiki/2013/9/9e/TCY3.jpg" width="230">
 +
<p style="text-align:center; color:black; ">TCY3</p> </div>
-
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/d/d8/TCY1.jpg"> <img src="https://static.igem.org/mediawiki/2013/d/d8/TCY1.jpg" width="303">
+
<div class="col3-2" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/8/82/TCY4.jpg"> <img src="https://static.igem.org/mediawiki/2013/8/82/TCY4.jpg" width="230">
-
  <p style="text-align:center; color:black; "> Figure 1.</p> </div>
+
  <p style="text-align:center; color:black; ">TCY4 </p> </div>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
</div>
</div>
-
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/9/92/TCY2.jpg"> <img src="https://static.igem.org/mediawiki/2013/9/92/TCY2.jpg" width="303">
+
 
-
<p style="text-align:center; color:black; "> Figure 1.</p> </div>
+
<div class="row">
 +
<div class="col12-3" align = "justify">
 +
<p>Figures: Alignment of Gibson tCY 1, Gibson tCY 2, Gibson tCY 3 and SLIC tCY. tat and YFP is present, but CFP is absent in all of these sequences.</p>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
</div>
</div>
-
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/9/9e/TCY3.jpg"> <img src="https://static.igem.org/mediawiki/2013/9/9e/TCY3.jpg" width="303">
 
-
<p style="text-align:center; color:black; "> Figure 1.</p> </div>
 
-
<div class ="row-end"> </div>
 
-
</div>
 
-
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/8/82/TCY4.jpg"> <img src="https://static.igem.org/mediawiki/2013/8/82/TCY4.jpg" width="303">
 
-
<p style="text-align:center; color:black; "> Figure 1.</p> </div>
 
-
<div class ="row-end"> </div>
 
-
</div>
 
-
 
-
<center>figures: Alignment of Gibson tCY 1, Gibson tCY 2, Gibson tCY 3 and SLIC tCY. tat and YFP is present, but CFP is absent in all of these sequences.</center>
 
-
 
<div class="row">
<div class="row">
<div class="col12-2" align = "justify">
<div class="col12-2" align = "justify">
<div class="col12-3" align = "center" style="background-color:white;>
<div class="col12-3" align = "center" style="background-color:white;>
-
<p style="text-align:center; color:black; "Fluorescence of ER1 and ER2</p> </div>
+
<p style="text-align:center; color:black; ">Fluorescence of ER1 and ER2</p> </div>
<br><br>
<br><br>
<p>After the positive sequence results we had (see tuesday 27.08.2013), we decided to check weather there where any GFP in the ER1 and ER2 bacteria (see figure 8).<br>
<p>After the positive sequence results we had (see tuesday 27.08.2013), we decided to check weather there where any GFP in the ER1 and ER2 bacteria (see figure 8).<br>
-
LB media samples with ER1, ER2 (see figure 8) and ''E.coli'' cells transformed with standard RFP, which served as a referance, were centrifuged. The palets were resuspended in DPBSS buffer. These solutions were den studied in a fluorometer by doing a excitation and emmision scan (see figures below):<br>
+
LB media samples with ER1, ER2 (see figure 8) and <i>E.coli</i> cells transformed with standard RFP, which served as a referance, were centrifuged. The pellets were resuspended in DPBSS buffer. These solutions were then studied in a fluorometer by doing a excitation and emission scan (see figures below):<br>
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/a/a3/Excitation.jpg"> <img src="https://static.igem.org/mediawiki/2013/a/a3/Excitation.jpg" width="303">
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/a/a3/Excitation.jpg"> <img src="https://static.igem.org/mediawiki/2013/a/a3/Excitation.jpg" width="303">
-
  <p style="text-align:center; color:black; "> Figure 1.</p> </div>
+
  <p style="text-align:center; color:black; "> Excitation</p> </div>
 +
 
 +
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/3/3a/Emission.jpg"> <img src="https://static.igem.org/mediawiki/2013/3/3a/Emission.jpg" width="303">
 +
<p style="text-align:center; color:black; "> Emission.</p> </div>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
</div>
</div>
-
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/3/3a/Emission.jpg"> <img src="https://static.igem.org/mediawiki/2013/3/3a/Emission.jpg" width="303">
+
 
-
<p style="text-align:center; color:black; "> Figure 1.</p> </div>
+
<div class="row">
 +
<div class="col12-2" align = "justify">
 +
<p>Figures: Excitation and emission scan of ER1, ER2 and the referance sample with RFP.<br></p>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
</div>
</div>
-
<center>figures: Excitation and emission scan of ER1, ER2 and the referance sample with RFP.</center>
 
<div class="row">
<div class="row">
<div class="col12-2" align = "justify">
<div class="col12-2" align = "justify">
<p>There are no significant differance between the referance sample and the ER samples. It seems that GFP is not present or doesent fold properly.<br></p>
<p>There are no significant differance between the referance sample and the ER samples. It seems that GFP is not present or doesent fold properly.<br></p>
 +
<div class ="row-end"> </div>
 +
</div>
 +
 +
 +
<div class="row">
 +
<div class="col12-2" align = "justify">
 +
<div class="col12-3" align = "center" style="background-color:white;>
 +
<p style="text-align:center; color:black; ">Wednesday 04.09.13</p> </div>
 +
<br><br>
 +
<p>Transformed the parts needed for testing the promoter: GFP generator (<a href="http://parts.igem.org/BBa_E0240">BBa_E0240</a>), backbone (<a href="http://parts.igem.org/pSB3K3"> pSB3K3</a> and the reference promoter (<a href="http://parts.igem.org/BBa_I20260"> BBa_I20260</a>).
 +
<br></p>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
</div>
</div>
Line 168: Line 206:
<p>We wanted to try to fix the addition and deletion in tat-ProteinG DT and S3 (respectively) by using the forward primer for tat (F_pl.b_tat) that has the right sequence. PCR-reactions for amplifying the backbones (BB) and the tat_ProteinG of both DT8 and S3 were run. These 4 samples were then run on a gel to confirm the results (figure below).<br>
<p>We wanted to try to fix the addition and deletion in tat-ProteinG DT and S3 (respectively) by using the forward primer for tat (F_pl.b_tat) that has the right sequence. PCR-reactions for amplifying the backbones (BB) and the tat_ProteinG of both DT8 and S3 were run. These 4 samples were then run on a gel to confirm the results (figure below).<br>
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/c/cf/PCR_on_DT8_and_S3.png"> <img src="https://static.igem.org/mediawiki/2013/c/cf/PCR_on_DT8_and_S3.png" width="303">
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/c/cf/PCR_on_DT8_and_S3.png"> <img src="https://static.igem.org/mediawiki/2013/c/cf/PCR_on_DT8_and_S3.png" width="303">
-
  <p style="text-align:center; color:black; "> Figure: PCR products of tat_ProteinG and BB from DT8 (well 1 and 2) and S3 (well 3 and 4). Ladder applied is [http://66.155.211.155/nebecomm/products_intl/productN3232.asp 1 kb DNA ladder]. The fragments nicely matches the expected sizes of 2800 bp for backbone and 1300-1400 for tat_proteinG.</p> </div>
+
  <p style="text-align:center; color:black; "> Figure: PCR products of tat_ProteinG and BB from DT8 (well 1 and 2) and S3 (well 3 and 4). Ladder applied is <a href="http://66.155.211.155/nebecomm/products_intl/productN3232.asp"> 1 kb DNA ladder</a>. The fragments nicely matches the expected sizes of 2800 bp for backbone and 1300-1400 for tat_proteinG.
 +
</p> </div>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
</div>
</div>
Line 174: Line 213:
<div class="row">
<div class="row">
<div class="col12-2" align = "justify">
<div class="col12-2" align = "justify">
-
<p>The PCR products were also incubated at 37 &deg;C with Dpn1 to remove all old plasmids. The PCR products where then used in direct transformation of ''E.coli'' DH5&alpha;. The fragments that originated from the same plasmid where used together (BB from DT8 with tat_PrG from DT8 and so on). There was also performed a direct transformation tat_GFPmut3 with BB from S3. There were made two parallels of all combinations yielding 6 direct transformation. Controls with all the 5 fragments used was also prepared.<br></p>
+
<p>The PCR products were also incubated at 37 &deg;C with Dpn1 to remove all old plasmids. The PCR products where then used in direct transformation of ''E.coli'' DH5&alpha;. The fragments that originated from the same plasmid where used together (BB from DT8 with tat_PrG from DT8 and so on). There was also performed a direct transformation tat_GFPmut3 with BB from S3. There were made two parallels of all combinations yielding 6 direct transformation. Controls with all the 5 fragments used was also prepared.<br>
 +
The transformed cells from yesterday was transfered to liquid media and incubated at 37&deg;C overnight.<br></p>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
</div>
</div>
 +
<div class="row">
<div class="row">
Line 190: Line 231:
<p style="text-align:center; color:black; "> PCR</p> </div>
<p style="text-align:center; color:black; "> PCR</p> </div>
<br><br>
<br><br>
-
<p>Turned the Pm XylS promoter system into a biobrick using PCR. The following recipe was used:
+
<p>Turned the Pm XylS promoter system into a biobrick using PCR. The following recipe was used:<br>
 +
* 31.5 &mu;l dH<sub>2</sub>O<br>
 +
* 10 &mu;l 10x phusion buffer<br>
 +
* 1 &mu;l dNTPs<br>
 +
* 2.5 &mu;l fwd primer diluted 1:10 compared to stock solution (primer sequence: GAATTCGCGGCCGCTTCTAGTCAAGCCACTTCCTTTTTGC)<br>
 +
* 2.5 &mu;l rev primer diluted 1:10 compared to stock solution (primer sequence: TACTAGTAGCGGCCGCTGCAGTGCATAAAGCCTAAGGGGTAGG)<br>
 +
* 1 &mu;l template DNA<br>
 +
* 1 &mu;l DMSO<br>
 +
* 0.5 &mu;l Phusion DNA polymerase<br>
 +
Two different templates were used, and two samples were made for each template, giving in total four PCR batches. The first template was the Pm XylS plasmid, while the second was a PCR product of the Pm XylS promoter, modified in order to eliminate an XbaI restriction site.<br>
 +
The following PCR program was used:<br>
-
* 31.5 &mu;l dH<sub>2</sub>O
 
-
* 10 &mu;l 10x phusion buffer
 
-
* 1 &mu;l dNTPs
 
-
* 2.5 &mu;l fwd primer diluted 1:10 compared to stock solution (primer sequence: GAATTCGCGGCCGCTTCTAGTCAAGCCACTTCCTTTTTGC)
 
-
* 2.5 &mu;l rev primer diluted 1:10 compared to stock solution (primer sequence: TACTAGTAGCGGCCGCTGCAGTGCATAAAGCCTAAGGGGTAGG)
 
-
* 1 &mu;l template DNA
 
-
* 1 &mu;l DMSO
 
-
* 0.5 &mu;l Phusion DNA polymerase
 
-
Two different templates were used, and two samples were made for each template, giving in total four PCR batches. The first template was the Pm XylS plasmid, while the second was a PCR product of the Pm XylS promoter, modified in order to eliminate an XbaI restriction site.
+
<table style="border:1px solid black;">
-
The following PCR program was used:
+
<tr>
 +
<th>Program step</th>
 +
<th>Temperature</th>
 +
<th>Duration</th>
 +
</tr>
 +
<tr>
 +
<td>Heated lid</td>
 +
<td>103&deg;C</td>
 +
<td> - </td>
 +
</tr>
 +
<tr>
 +
<td>Initial denaturation</td>
 +
<td>98&deg;C</td>
 +
<td>30 s</td>
 +
</tr>
 +
<tr>
 +
<td>Cycle 30x</td>
 +
<td> </td>
 +
<td> </td>
 +
</tr>
 +
<tr>
 +
<td>Denaturation</td>
 +
<td>98&deg;C</td>
 +
<td>15 s</td>
 +
</tr>
 +
<tr>
 +
<td>Annealing</td>
 +
<td>64&deg;C</td>
 +
<td>15 s</td>
 +
</tr>
 +
<tr>
 +
<td>Elongation</td>
 +
<td>72&deg;C</td>
 +
<td>53 s</td>
 +
</tr>
 +
<tr>
 +
<td>End of cycle</td>
 +
<t></td>
 +
<td></td>
 +
</tr>
 +
<tr>
 +
<td>Final elongation</td>
 +
<td>72&deg;C</td>
 +
<td>10 min</td>
 +
</tr>
 +
<tr>
 +
<td>Hold</td>
 +
<td>4&deg;C</td>
 +
<td>&infin;</td>
 +
</tr>
 +
</table>
 +
<br>
-
{|border="1"
+
Gel picture of the PCR products:<br>
-
!Program step
+
-
!Temperature
+
-
!Duration
+
-
|-
+
-
|Heated lid
+
-
|103&deg;C
+
-
| -
+
-
|-
+
-
|Initial denaturation
+
-
|98&deg;C
+
-
|30 s
+
-
|-
+
-
|Cycle 30x
+
-
|
+
-
|
+
-
|-
+
-
|Denaturation
+
-
|98&deg;C
+
-
|15 s
+
-
|-
+
-
|Annealing
+
-
|64&deg;C
+
-
|15 s
+
-
|-
+
-
|Elongation
+
-
|72&deg;C
+
-
|53 s
+
-
|-
+
-
|End of cycle
+
-
|
+
-
|
+
-
|-
+
-
|Final elongation
+
-
|72&deg;C
+
-
|10 min
+
-
|-
+
-
|Hold
+
-
|4&deg;C
+
-
|&infin;
+
-
|-
+
-
|}
+
-
Gel picture of the PCR products:
+
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/3/3f/Pm_XylS_BB.png"> <img src="https://static.igem.org/mediawiki/2013/3/3f/Pm_XylS_BB.png" width="303">
-
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg"> <img src="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg" width="303">
+
  <p style="text-align:center; color:black; "></p> </div>
-
  <p style="text-align:center; color:black; "> Figure 1.</p> </div>
+
<div class ="row-end"> </div>
<div class ="row-end"> </div>
</div>
</div>
-
<center>[[file:Pm_XylS_BB.png|400px]]</center>
 
-
The PCR products were rinsed using the QIAgen PCR Purification kit. The two parallel samples using the same template were eluted in the same eppendorf tube. The following concentrations were measured:
+
<div class="row">
 +
<div class="col12-3" align = "justify">
 +
<p>The PCR products were rinsed using the QIAgen PCR Purification kit. The two parallel samples using the same template were eluted in the same eppendorf tube. The following concentrations were measured:<br>
-
{|border="1"
+
<table style="border:1px solid black;">
-
!BioBrick
+
<tr>
-
!Concentration
+
<th>BioBrick</th>
-
|-
+
<th>Concentration</th>
-
|Pm XylS from BB template
+
</tr>
-
|98.3 ng/&mu;l
+
<t>
-
|-
+
<td>Pm XylS from BB template</td>
-
|Pm XylS with XbaI site
+
<td>98.3 ng/&mu;l</td>
-
|171.9 ng/&mu;l
+
</tr>
-
|-
+
<tr>
-
|}
+
<td>Pm XylS with XbaI site</td>
 +
<td>171.9 ng/&mu;l</td>
 +
</tr>
 +
</table>
 +
<br>
 +
<div class ="row-end"> </div>
 +
</div>
<div class="row">
<div class="row">
Line 275: Line 334:
<p><a href="http://parts.igem.org/BBa_E0240">BBa_E0240</a> and <a href="http://parts.igem.org/pSB3K3">pSB3K3</a> were isolated using the Wizard <i>Plus</i> SV Minipreps DNA Purification System kit. The following concentrations were measured after the isolation:
<p><a href="http://parts.igem.org/BBa_E0240">BBa_E0240</a> and <a href="http://parts.igem.org/pSB3K3">pSB3K3</a> were isolated using the Wizard <i>Plus</i> SV Minipreps DNA Purification System kit. The following concentrations were measured after the isolation:
-
{|border="1"
+
<table style="border:1px solid black;">
-
!Part
+
<tr>
-
!Concentration
+
<th>Part</th>
-
|-
+
<th>Concentration</th>
-
|<partinfo>BBa_E0240</partinfo>
+
</tr>
-
|79.8 ng/&mu;l
+
<tr>
-
|-
+
<td><a href="http://parts.igem.org/BBa_E0240">BBa_E0240</a></td>
-
|<partinfo>pSB3K3</partinfo>
+
<td>79.8 ng/&mu;l</td>
-
|42.8 ng/&mu;l
+
</tr>
-
|-
+
<tr>
-
|}
+
<td><a href="http://parts.igem.org/pSB3K3">pSB3K3</a></td>
 +
<td>42.8 ng/&mu;l</td>
 +
</tr>
 +
</table>
<br></p>
<br></p>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
Line 318: Line 380:
</div>
</div>
 +
<div class="row">
 +
<div class="col12-2" align = "justify">
 +
<div class="col12-3" align = "center" style="background-color:white;>
 +
<p style="text-align:center; color:black; ">3A Assembly</p> </div>
 +
<br><br>
 +
<p>3A Assembly was done on the Pm/Xyls promoter to attach it to the GFP and backbone. This was done according to the official iGEM <a href="http://parts.igem.org/Help:Assembly/3A_Assembly"> protocol</a>.
 +
<br></p>
 +
<div class ="row-end"> </div>
 +
</div>
<div class="row">
<div class="row">
Line 331: Line 402:
<p style="text-align:center; color:black; ">Restriction digest</p> </div>
<p style="text-align:center; color:black; ">Restriction digest</p> </div>
<br><br>
<br><br>
-
<p>Linearized pSB1C3 and the two versions of Pm XylS (modified and unmodified, one of them containing an XbaI restriction site) were cut with EcoRI and PstI in order to put the promoter system in the shipping plasmid. The following volumes of DNA and water were used in the digestions:
+
<p>Linearized pSB1C3 and the two versions of Pm XylS (modified and unmodified, one of them containing an XbaI restriction site) were cut with EcoRI and PstI in order to put the promoter system in the shipping plasmid. The following volumes of DNA and water were used in the digestions:<br>
-
 
+
-
{|border="1"
+
-
!DNA part
+
-
!Concentration of DNA
+
-
!Calculated volume of DNA used in digestion
+
-
!Volume of dH<sub>2</sub>O used in digestion
+
-
|-
+
-
|Linearized pSB1C3
+
-
|25 ng/&mu;l
+
-
|10 &mu;l
+
-
|6 &mu;l
+
-
|-
+
-
|Pm XylS BB
+
-
|98.3 ng/&mu;l
+
-
|2.5 &mu;l
+
-
|13.5 &mu;l
+
-
|-
+
-
|Pm XylS XbaI
+
-
|171.9 ng/&mu;l
+
-
|1.5 &mu;l
+
-
|14.5 &mu;l
+
-
|-
+
-
|}
+
-
 
+
-
 
+
-
Buffer 3 were used in all restriction digests. In the table above, Pm XylS BB refers to the biobrick that has been modified compared to the original Pm XylS promoter, which contains an illegal XbaI restriction site. Pm XylS XbaI is the original promoter, that contains the XbaI site.
+
-
After the restriction digest, the products were purified using the QIAquick PCR Purification Kit, which has a filter size that allows the short ends of the prefix and suffix of the linearized plasmids and biobricks that should be present after the restriction digest, to pass through the filter. The following concentrations were measured after the purification:
+
-
 
+
-
{|border="1"
+
-
!DNA part
+
-
!Concentration
+
-
|-
+
-
|pSB1C3
+
-
|4.2 ng/&mu;l
+
-
|-
+
-
|Pm XylS BB
+
-
|6.8 ng/&mu;l
+
-
|-
+
-
|Pm XylS XbaI
+
-
|7.6 ng/&mu;l
+
-
|-
+
-
|}
+
 +
<table style="border:1px solid black;">
 +
<tr>
 +
<th>DNA part</th>
 +
<th>Concentration of DNA</th>
 +
<th>Calculated volume of DNA used in digestion</th>
 +
<th>Volume of dH<sub>2</sub>O used in digestion</th>
 +
</tr>
 +
<tr>
 +
<td>Linearized pSB1C3</td>
 +
<td>25 ng/&mu;l</td>
 +
<td>10 &mu;l</td>
 +
<td>6 &mu;l</td>
 +
</tr>
 +
<tr>
 +
<td>Pm XylS BB</td>
 +
<td>98.3 ng/&mu;l</td>
 +
<td>2.5 &mu;l</td>
 +
<td>13.5 &mu;l</td>
 +
</tr>
 +
<tr>
 +
<td>Pm XylS XbaI</td>
 +
<td>171.9 ng/&mu;l</td>
 +
<td>1.5 &mu;l</td>
 +
<td>14.5 &mu;l</td>
 +
</tr>
 +
</table>
 +
<br>
 +
Buffer 3 were used in all restriction digests. In the table above, Pm XylS BB refers to the biobrick that has been modified compared to the original Pm XylS promoter, which contains an illegal XbaI restriction site. Pm XylS XbaI is the original promoter, that contains the XbaI site.<br>
 +
After the restriction digest, the products were purified using the QIAquick PCR Purification Kit, which has a filter size that allows the short ends of the prefix and suffix of the linearized plasmids and biobricks that should be present after the restriction digest, to pass through the filter. The following concentrations were measured after the purification:<br>
 +
<table style="border:1px solid black;">
 +
<tr>
 +
<th>DNA part</th>
 +
<th>Concentration</th>
 +
</tr>
 +
<tr>
 +
<td>pSB1C3</td>
 +
<td>4.2 ng/&mu;l</td>
 +
</tr>
 +
<tr>
 +
<td>Pm XylS BB</td>
 +
<td>6.8 ng/&mu;l</td>
 +
</tr>
 +
<tr>
 +
<td>Pm XylS XbaI</td>
 +
<td>7.6 ng/&mu;l</td>
 +
</tr>
 +
</table>
 +
<br></p>
 +
<div class ="row-end"> </div>
 +
</div>
<div class="row">
<div class="row">
Line 383: Line 462:
<p style="text-align:center; color:black; ">Gel electrophoresis</p> </div>
<p style="text-align:center; color:black; ">Gel electrophoresis</p> </div>
<br><br>
<br><br>
-
<p>Gel electrophoresis were performed to ensure that the right DNA fragments are present after the restriction digest.
+
<p>Gel electrophoresis were performed to ensure that the right DNA fragments are present after the restriction digest.<br>
-
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg"> <img src="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg" width="303">
+
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/7/7a/PSB1C3%2BPm_XylS_restriction_digest.png"> <img src="https://static.igem.org/mediawiki/2013/7/7a/PSB1C3%2BPm_XylS_restriction_digest.png" width="303">
-
  <p style="text-align:center; color:black; "> Figure 1.</p> </div>
+
  <p style="text-align:center; color:black; "> </p> </div>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
</div>
</div>
-
<center>[[file:PSB1C3+Pm_XylS_restriction_digest.png|400px]]</center>
 
 +
<div class="row">
 +
<div class="col12-2" align = "justify">
In this picture, the first band is pSB1C3, which linearized should be 2070 bp long. The Pm XylS promoter system has a length of 1759 bp, and the modified and unmodified version of the promoter system corresponds to band 2 and 3.<br></p>
In this picture, the first band is pSB1C3, which linearized should be 2070 bp long. The Pm XylS promoter system has a length of 1759 bp, and the modified and unmodified version of the promoter system corresponds to band 2 and 3.<br></p>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
Line 403: Line 483:
<p>pSB1C3 was ligated to Pm XylS BB and Pm XylS XbaI, respectively. The following ligation mix was set up. The same mix were used for both promoter systems, since the concentrations were almost the same. The volume of backbone used corresponds to 25 ng of DNA, which is the recommended amount of backbone suggested on the partsregistry website.
<p>pSB1C3 was ligated to Pm XylS BB and Pm XylS XbaI, respectively. The following ligation mix was set up. The same mix were used for both promoter systems, since the concentrations were almost the same. The volume of backbone used corresponds to 25 ng of DNA, which is the recommended amount of backbone suggested on the partsregistry website.
-
{|border="1"
+
<table style="border:1px solid black;">
-
!Component
+
<tr>
-
!Volume
+
<th>Component</th>
-
|-
+
<th>Volume</th>
-
|pSB1C3
+
</tr>
-
|6 &mu;l
+
<tr>
-
|-
+
<td>pSB1C3</td>
-
|Pm XylS BB / Pm XylS XbaI
+
<td>6 &mu;l</td>
-
|7 &mu;l
+
</tr>
-
|-
+
<tr>
-
|T4 DNA ligase buffer
+
<td>Pm XylS BB / Pm XylS XbaI</td>
-
|1.5 &mu;l
+
<td>7 &mu;l</td>
-
|-
+
</tr>
-
|T4 DNA ligase
+
<tr>
-
|0.5 &mu;l
+
<td>T4 DNA ligase buffer</td>
-
|-
+
<td>1.5 &mu;l</td>
-
|}
+
</tr>
-
 
+
<tr>
 +
<td>T4 DNA ligase</td>
 +
<td>0.5 &mu;l</td>
 +
</tr>
 +
</table>
 +
<br>
The ligation mix was put in the fridge for overnight ligation.<br></p>
The ligation mix was put in the fridge for overnight ligation.<br></p>
Line 438: Line 523:
<p style="text-align:center; color:black; "> Transformation</p> </div>
<p style="text-align:center; color:black; "> Transformation</p> </div>
<br><br>
<br><br>
-
<p>The Pm XylS BB in pSB1C3 and PmXylS XbaI in pSB1C3 systems that were ligated overnight were transformed to competent ''E. coli'' DH5&alpha; cells and plated out on agar plates having chloramphenicol resistance.
+
<p>The Pm XylS BB in pSB1C3 and PmXylS XbaI in pSB1C3 systems that were ligated overnight were transformed to competent ''E. coli'' DH5&alpha; cells and plated out on agar plates having chloramphenicol resistance.<br></p>
-
 
+
<div class ="row-end"> </div>
-
====Thursday 12.09.13====
+
</div
-
 
+
-
=====Transfer of cells from agar plates to liquid medium=====
+
<div class="row">
<div class="row">
Line 467: Line 550:
<div class ="row-end"> </div>
<div class ="row-end"> </div>
</div>
</div>
 +
 +
<div class="row">
 +
<div class="col12-2" align = "justify">
 +
<div class="col12-3" align = "center" style="background-color:white;>
 +
<p style="text-align:center; color:black; ">Testing of BioBrick promoter</p> </div>
 +
<br><br>
 +
<p>We tested the promoter as done in <a href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Kelly%2C%20Jason%20R%5BAuthor%5D)%20AND%20Rubin%2C%20Adam%20J%5BAuthor%5D)%20AND%20Davis%2C%20Joseph%5BAuthor%5D"> this article</a>. Measured the absorbance at 600 nm, excitation at 485 nm and emission at 525 nm. Backgroud fluorescence was determined by measuring only media. For the reference promoter, we measured every 30 min for five hours. The Pm/XylS was added inducer in different concentrations (0nM, 10nM, 100nM, 1&micro;M, 10&micro;M, 100&micro;M, 1mM and 2mM) to see the effect. <br></p>
 +
<div class ="row-end"> </div>
 +
</div
<div class="row">
<div class="row">
Line 482: Line 574:
<p>Pm XylS BB in pSB1C3 and Pm XylS XbaI in pSB1C3 was miniprepped using the Promega Wizard Plus SV Minipreps DNA Purification kit. The following concentrations were measured:
<p>Pm XylS BB in pSB1C3 and Pm XylS XbaI in pSB1C3 was miniprepped using the Promega Wizard Plus SV Minipreps DNA Purification kit. The following concentrations were measured:
-
 
+
<table style="border:1px solid black;">
-
{|border="1"
+
<tr>
-
!BioBrick
+
<th>BioBrick</th>
-
!Concentration
+
<th>Concentration</th>
-
|-
+
</tr>
-
|Pm XylS BB + pSB1C3
+
<tr>
-
|44.3 ng/&mu;l
+
<td>Pm XylS BB + pSB1C3</td>
-
|-
+
<td>44.3 ng/&mu;l</td>
-
|Pm XylS XbaI + pSB1C3
+
</tr>
-
|67.0 ng/&mu;l
+
<tr>
-
|-
+
<td>Pm XylS XbaI + pSB1C3</td>
-
|}
+
<td>67.0 ng/&mu;l</td>
-
 
+
</tr>
 +
</table>
 +
<br></p>
 +
<div class ="row-end"> </div>
 +
</div
<div class="row">
<div class="row">
Line 505: Line 601:
The cell cultures and cell pallets were not red or pink when they were taken out of the incubator and centrifuge. The pallet did, however, start to get a red color after a while.<br>
The cell cultures and cell pallets were not red or pink when they were taken out of the incubator and centrifuge. The pallet did, however, start to get a red color after a while.<br>
Samples for SDS-PAGE (one undiluted and one diluted 1:2) was prepared in step 12 and stored in the fridge.<br>
Samples for SDS-PAGE (one undiluted and one diluted 1:2) was prepared in step 12 and stored in the fridge.<br>
-
RFU was measured as described in step 12 of the <a href="https://2013.igem.org/Team:NTNU-Trondheim/Protocols"> small-scale vesicle preparation<(/a> protcol. The blank sample had a value of 153 while the vesicle containing sample had the value of 2128. <br>
+
RFU was measured as described in step 12 of the <a href="https://2013.igem.org/Team:NTNU-Trondheim/Protocols"> small-scale vesicle preparation</a> protcol. The blank sample had a value of 153 while the vesicle containing sample had the value of 2128. <br>
There was also conducted a fluorecense scan of a undiluted sample without FM4-64. This will be desribed on "Sunday 15.09.2013".<br></p>
There was also conducted a fluorecense scan of a undiluted sample without FM4-64. This will be desribed on "Sunday 15.09.2013".<br></p>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
Line 531: Line 627:
<p style="text-align:center; color:black; ">Transformation</p> </div>
<p style="text-align:center; color:black; ">Transformation</p> </div>
<br><br>
<br><br>
-
<p>All of the tat_ProteinG plasmids that where sent for sequencing (see monday 09.09.2013) where applied in a transformation of ''E.coli'' strain ER2566 by the [https://2013.igem.org/Team:NTNU-Trondheim/Protocols#Transformation transformation protocol].<br></p>
+
<p>All of the tat_ProteinG plasmids that where sent for sequencing (see monday 09.09.2013) where applied in a transformation of ''E.coli'' strain ER2566 by the <a href="https://2013.igem.org/Team:NTNU-Trondheim/Protocols#Transformation"> transformation protocol</a>.<br></p>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
</div>
</div>
Line 551: Line 647:
Samples for SDS-PAGE (one undiluted and one diluted 1:2) was prepared in step 12 and was run with the SDS-PAGE from friday 13.09.2013. See figure below.<br>
Samples for SDS-PAGE (one undiluted and one diluted 1:2) was prepared in step 12 and was run with the SDS-PAGE from friday 13.09.2013. See figure below.<br>
-
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg"> <img src="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg" width="303">
+
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/8/87/Vesicles_WT_and_ER1.jpg"> <img src="https://static.igem.org/mediawiki/2013/8/87/Vesicles_WT_and_ER1.jpg" width="303">
-
  <p style="text-align:center; color:black; "> Figure 1.</p> </div>
+
  <p style="text-align:center; color:black; "> Figure: Ladder applied is Precision Plus Protein<sup>TM</sup> Unstained Standards. WT stands for wildtype and is the unstransformed ER2566 samples.</p> </div>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
</div>
</div>
-
<center>[[file:vesicles WT_and_ER1.jpg|400px]]</center>
 
-
 
-
<center>Figure: Ladder applied is Precision Plus Protein<sup>TM</sup> Unstained Standards. WT stands for wildtype and is the unstransformed ER2566 samples.</center>
 
-
 
<div class="row">
<div class="row">
Line 564: Line 656:
<p>There are noe additional bands in the ER1 samples compared to the unstransformed ER2566 sample, indicating that there are no GFP-RFP in the vesicles.<br>
<p>There are noe additional bands in the ER1 samples compared to the unstransformed ER2566 sample, indicating that there are no GFP-RFP in the vesicles.<br>
RFU was measured as decribed in step 12 of the <a href="https://2013.igem.org/Team:NTNU-Trondheim/Protocols"> small-scale vesicle preparation</a> protocol. The blank sample had a value of 150 while the vesicle containing sample had the value of 8708.<br>
RFU was measured as decribed in step 12 of the <a href="https://2013.igem.org/Team:NTNU-Trondheim/Protocols"> small-scale vesicle preparation</a> protocol. The blank sample had a value of 150 while the vesicle containing sample had the value of 8708.<br>
-
There was run a excitation scan of the undiluted unstransformed ER2566 sample that was compared to the similar scan done on friday 13.09.2013. The results were as shown in the two figures below.<br></p>
+
There was run a excitation scan of the undiluted unstransformed ER2566 sample that was compared to the similar scan done on friday 13.09.2013. The results were as shown in the two figures below.<br>
 +
 
 +
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/e/e2/Fluor_ER1.jpg"> <img src="https://static.igem.org/mediawiki/2013/e/e2/Fluor_ER1.jpg" width="303">
 +
<p style="text-align:center; color:black; "> </p> </div>
 +
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/c/ca/Fluor_WT.jpg"> <img src="https://static.igem.org/mediawiki/2013/c/ca/Fluor_WT.jpg" width="303">
 +
<p style="text-align:center; color:black; "></p> </div>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
</div>
</div>
-
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg"> <img src="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg" width="303">
+
<div class="row">
-
<p style="text-align:center; color:black; "> Figure 1.</p> </div>
+
<div class="col12-3" align = "justify">
 +
<p>Figures: Fluorescence excitation scan of vesicles from the ER1 cells (left) and wildtype ER2566 (right).<br>
 +
There are no real differance between the samples other then strength of the signals. Both samples have peaks at 504, 540 and 582 nm. It is likely that there are no tGR construct in the vesicles.<br></p>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
</div>
</div>
-
<center>[[file:fluor_ER1.jpg|400px]]    [[file:fluor_WT.jpg|400px]]</center>
 
-
 
-
<center>Figures: Fluorescence excitation scan of vesicles from the ER1 cells (left) and wildtype ER2566 (right). </center>
 
-
 
-
 
-
There are no real differance between the samples other then strength of the signals. Both samples have peaks at 504, 540 and 582 nm. It is likely that there are no tGR construct in the vesicles.
 
<div class="row">
<div class="row">
Line 587: Line 680:
The PCR product and the digested PCR product were run on a agarose gel, giving the result as indicated in the figure below.<br>
The PCR product and the digested PCR product were run on a agarose gel, giving the result as indicated in the figure below.<br>
-
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg"> <img src="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg" width="303">
+
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/0/0e/PCR_digestion.jpg"> <img src="https://static.igem.org/mediawiki/2013/0/0e/PCR_digestion.jpg" width="303">
-
  <p style="text-align:center; color:black; "> Figure 1.</p> </div>
+
  <p style="text-align:center; color:black; "> Ladder applied is GeneRuler<sup>TM</sup> 100 bp plus DNA ladder. The ladder is for some reason not completly functional.</p> </div>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
</div>
</div>
-
<center>[[file:PCR_digestion.jpg|550px]]</center>
 
-
 
-
<center>Figure 10: Ladder applied is GeneRuler<sup>TM</sup> 100 bp plus DNA ladder. The ladder is for some reason not completly functional.</center>
 
<div class="row">
<div class="row">
Line 605: Line 695:
<div class="col12-3" align = "justify">
<div class="col12-3" align = "justify">
<div class="col12-3" align = "center" style="background-color:white;>
<div class="col12-3" align = "center" style="background-color:white;>
-
<p style="text-align:center; color:black; "> Thursday 26.09.2013</p> </div>
+
<p style="text-align:center; color:black; "> Sunday 22.09.2013</p> </div>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
</div
</div
Line 612: Line 702:
<div class="col12-3" align = "justify">
<div class="col12-3" align = "justify">
<div class="col12-3" align = "center" style="background-color:white;>
<div class="col12-3" align = "center" style="background-color:white;>
-
<p style="text-align:center; color:black; "> PCR and digestion for creating a briobrick of tat_GFP_RF</p> </div>
+
<p style="text-align:center; color:black; "> Analysing DNA sequencing results</p> </div>
<br><br>
<br><br>
-
<p>PCR was run on the tat_GFP_RFP PCR-product from sunday 16.09. This time the F_prefix_tat primer and a reverse primer that anneals to the suffix in plasmid was applied. The PCR-prduct was digested with EcoRI and PstI. The digested PCR-product was run on a gel and one gelband was cut out. The fragment was purified with the <a href="http://www.qiagen.com/Products/Catalog/Sample-Technologies/DNA-Sample-Technologies/DNA-Cleanup/QIAquick-PCR-Purification-Kit#productdetails"> QIAquick PCR Purification kit</a>.<br></p>
+
<p>The results from the last round of sequencing (see monday 09.09) was analysed with the prefered sequence. The alignments were as follows:<br>
 +
 
 +
<div class="col2-2" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/9/96/PrG_D8-1A.jpg"> <img src="https://static.igem.org/mediawiki/2013/9/96/PrG_D8-1A.jpg" width="180">
 +
<p style="text-align:center; color:black; "> .</p> </div>
 +
 
 +
<div class="col2-2" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/7/75/PrG_D8-1B.jpg"> <img src="https://static.igem.org/mediawiki/2013/7/75/PrG_D8-1B.jpg" width="180">
 +
<p style="text-align:center; color:black; "></p> </div>
 +
 
 +
<div class="col2-2" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/b/b0/PrG_D8-2A.jpg"> <img src="https://static.igem.org/mediawiki/2013/b/b0/PrG_D8-2A.jpg" width="180">
 +
<p style="text-align:center; color:black; "> .</p> </div>
 +
 
 +
<div class="col2-2" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/8/84/PrG_D8-2B.jpg"> <img src="https://static.igem.org/mediawiki/2013/8/84/PrG_D8-2B.jpg" width="180">
 +
<p style="text-align:center; color:black; "> </p> </div>
 +
 
 +
<div class="col2-2" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/c/c4/S3-2A.jpg"> <img src="https://static.igem.org/mediawiki/2013/c/c4/S3-2A.jpg" width="180">
 +
<p style="text-align:center; color:black; "> </p> </div>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
-
</div
+
</div>
<div class="row">
<div class="row">
-
<div class="col12-2" align = "justify">
+
<div class="col12-3" align = "justify">
-
<div class="col12-3" align = "center" style="background-color:white;>
+
<p>Figures: Alignment of tat_ProteinG D8-1A, tat_ProteinG D8-1B, tat_ProteinG D8-2A, tat_ProteinG D-2B and tat_ProteinG  S3-2A. These sequences either makes no sense or does not have the exact sequence we are looking for. These constructs will not be applied for later.<br>
-
<p style="text-align:center; color:black; ">Ligation</p> </div>
+
 
-
<br><br>
+
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/e/e9/PrG_S3-2B.jpg"> <img src="https://static.igem.org/mediawiki/2013/e/e9/PrG_S3-2B.jpg" width="303">
-
<p>The purified and digested (see above) tat_GFP_RFP with prefix was added into a ligation mix with the digested pSB1C3 backbone according to the <a href="http://parts.igem.org/Help:Protocols/Linearized_Plasmid_Backbones"> iGEM protocole</a>. The ligation product was transformed into DH5&alpha; cells.<br></p>
+
<p style="text-align:center; color:black; "> Figure: Alignment of tat_ProteinG S3-2B. This sequence is just how its supposed to be and will be used later in a vesicle isolation.</p> </div>
 +
<div class ="row-end"> </div>
 +
</div>
 +
 
 +
<div class="row">
 +
<div class="col12-3" align = "justify">
 +
<p>The alignments of the tat_GFPmut3 samples did not give any sense at all in will therefore not be included here as figures.<br></p>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
</div
</div
Line 631: Line 742:
<div class="col12-3" align = "justify">
<div class="col12-3" align = "justify">
<div class="col12-3" align = "center" style="background-color:white;>
<div class="col12-3" align = "center" style="background-color:white;>
-
<p style="text-align:center; color:black; "> Friday 27.09.2013</p> </div>
+
<p style="text-align:center; color:black; ">Monday 23.09.2013</p> </div>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
</div
</div
Line 638: Line 749:
<div class="col12-3" align = "justify">
<div class="col12-3" align = "justify">
<div class="col12-3" align = "center" style="background-color:white;>
<div class="col12-3" align = "center" style="background-color:white;>
-
<p style="text-align:center; color:black; "> PCR on fluorescent proteins</p> </div>
+
<p style="text-align:center; color:black; "> Sending Biobricks</p> </div>
<br><br>
<br><br>
-
<p>PCR was run on YFP (<a href="http://parts.igem.org/BBa_E0030">BBa_E0030</a>), CFP (<a href="http://parts.igem.org/BBa_E0020">BBa_E0020</a>), GFP (<a href="http://parts.igem.org/BBa_E0040">BBa_E0040</a>), BFP (<a href="http://parts.igem.org/BBa_K592100">BBa_K5921000</a>) and SYFP (<a href="http://parts.igem.org/BBa_K864100">BBa_K864100</a>) by using F_seq and R_seq as primers. These primers anneal to VF2 (<a href="http://parts.igem.org/BBa_G00100">BBa_G00100</a>) and VR (<a href="http://parts.igem.org/BBa_G00101">BBa_G00101</a>). The products were run on a gel and all samples had the expected size of about 1000 bp (see figure below).<br>
+
<p>The biobricks tat_GFP_RFP (BBa_K1082001) and the Pm/XylS promoter system (BBa_K1082002) was sent in to the registery.<br>
-
 
+
-
<center>[[file:FP_Anderson.jpg|550px]]</center>
+
-
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg"> <img src="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg" width="303">
+
-
<p style="text-align:center; color:black; "> Figure 1.</p> </div>
+
-
<div class ="row-end"> </div>
+
-
</div>
+
-
<center>Figure 10: Ladder applied is GeneRuler<sup>TM</sup> 1 kb DNA ladder.</center>
+
Line 653: Line 757:
<div class="col12-2" align = "justify">
<div class="col12-2" align = "justify">
<div class="col12-3" align = "center" style="background-color:white;>
<div class="col12-3" align = "center" style="background-color:white;>
-
<p style="text-align:center; color:black; ">Saturday 21.09.2013</p> </div>
+
<p style="text-align:center; color:black; ">DNA samples sendt in for sequencing</p> </div>
<br><br>
<br><br>
-
<p>LOTS of stuff<br></p>
+
<p>The rest of the biobrick tat_GFP_RFP (BBa_K1082001) was sent in for sequencing with the F_seq and R_seq primers. The tat_ProteinG S3-2B (see sunday 22.09.2013) was also sent in for sequencing with the R_seq primer<br></p>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
</div>
</div>
-
 
<div class="row">
<div class="row">
-
<div class="col12-3" align = "justify">
+
<div class="col12-2" align = "justify">
<div class="col12-3" align = "center" style="background-color:white;>
<div class="col12-3" align = "center" style="background-color:white;>
-
<p style="text-align:center; color:black; "> Sunday 22.09.2013</p> </div>
+
<p style="text-align:center; color:black; ">Wednesday 25.09.2013</p> </div>
 +
<br><br>
 +
<p>Step 1 and 2 of the [https://2013.igem.org/Team:NTNU-Trondheim/Protocols small-scale vesicle preparation] were performed with ER2566 transformed with the tat_ProteinG S3-2B (see sequencing results for sunday 22.09.2013) that had a postive sequencing result. One colony were selected from the recently transformed bacteria plate and incubated for 16 hours in step 2 in a total of 1L LB. The cultures were incubated aerobically in LB media with ampenicillin (100 &micro;L/mL) in step 1 and aerobically in plain LB in step 2.<br></p>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
-
</div
+
</div>
<div class="row">
<div class="row">
-
<div class="col12-3" align = "justify">
+
<div class="col12-2" align = "justify">
<div class="col12-3" align = "center" style="background-color:white;>
<div class="col12-3" align = "center" style="background-color:white;>
-
<p style="text-align:center; color:black; "> Analysing DNA sequencing results</p> </div>
+
<p style="text-align:center; color:black; ">Testing of BioBrick promoter</p> </div>
<br><br>
<br><br>
-
<p>The results from the last round of sequencing (see monday 09.09) was analysed with the prefered sequence. The alignments were as follows:<br>
+
<p>Because non-satisfying result from the last test, we did another test. This was similar to the one done on thursday 12.09.13 with the same time-series and inducer concentrations. <br></p>
-
 
+
-
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg"> <img src="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg" width="303">
+
-
<p style="text-align:center; color:black; "> Figure 1.</p> </div>
+
-
<div class ="row-end"> </div>
+
-
</div>
+
-
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg"> <img src="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg" width="303">
+
-
<p style="text-align:center; color:black; "> Figure 1.</p> </div>
+
-
<div class ="row-end"> </div>
+
-
</div>
+
-
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg"> <img src="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg" width="303">
+
-
<p style="text-align:center; color:black; "> Figure 1.</p> </div>
+
-
<div class ="row-end"> </div>
+
-
</div>
+
-
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg"> <img src="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg" width="303">
+
-
<p style="text-align:center; color:black; "> Figure 1.</p> </div>
+
-
<div class ="row-end"> </div>
+
-
</div>
+
-
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg"> <img src="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg" width="303">
+
-
<p style="text-align:center; color:black; "> Figure 1.</p> </div>
+
-
<div class ="row-end"> </div>
+
-
</div>
+
-
<center>[[file:PrG D8-1A.jpg|230px]][[file:PrG D8-1B.jpg|230px]][[file:PrG D8-2A.jpg|230px]][[file:PrG D8-2B.jpg|230px]][[file:S3-2A.jpg|230px]] </center>
+
-
 
+
-
<center>figures: Alignment of tat_ProteinG D8-1A, tat_ProteinG D8-1B, tat_ProteinG D8-2A, tat_ProteinG D-2B and tat_ProteinG  S3-2A. These sequences either makes no sense or does not have the exact sequence we are looking for. These constructs will not be applied for later.</center>
+
-
 
+
-
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg"> <img src="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg" width="303">
+
-
<p style="text-align:center; color:black; "> Figure 1.</p> </div>
+
-
<div class ="row-end"> </div>
+
-
</div>
+
-
<center>[[file:PrG S3-2B.jpg|600px]]</center>
+
-
 
+
-
<center>figure: Alignment of tat_ProteinG S3-2B. This sequence is just how its supposed to be and will be used later in a vesicle isolation.</center>
+
-
 
+
-
The alignments of the tat_GFPmut3 samples did not give any sense at all in will therefor not be included here as figures.<br></p>
+
<div class ="row-end"> </div>
<div class ="row-end"> </div>
</div
</div
-
 
<div class="row">
<div class="row">
<div class="col12-3" align = "justify">
<div class="col12-3" align = "justify">
<div class="col12-3" align = "center" style="background-color:white;>
<div class="col12-3" align = "center" style="background-color:white;>
-
<p style="text-align:center; color:black; ">Monday 23.09.2013</p> </div>
+
<p style="text-align:center; color:black; "> Thursday 26.09.2013</p> </div>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
</div
</div
Line 721: Line 791:
<div class="col12-3" align = "justify">
<div class="col12-3" align = "justify">
<div class="col12-3" align = "center" style="background-color:white;>
<div class="col12-3" align = "center" style="background-color:white;>
-
<p style="text-align:center; color:black; "> Sending Biobricks</p> </div>
+
<p style="text-align:center; color:black; "> PCR and digestion for creating a briobrick of tat_GFP_RF</p> </div>
<br><br>
<br><br>
-
<p>The biobricks tat_GFP_RFP (BBa_K1082001) and the Pm/XylS promoter system (BBa_K1082002) was sent in to the registery.<br>
+
<p>PCR was run on the tat_GFP_RFP PCR-product from sunday 16.09. This time the F_prefix_tat primer and a reverse primer that anneals to the suffix in plasmid was applied. The PCR-prduct was digested with EcoRI and PstI. The digested PCR-product was run on a gel and one gelband was cut out. The fragment was purified with the <a href="http://www.qiagen.com/Products/Catalog/Sample-Technologies/DNA-Sample-Technologies/DNA-Cleanup/QIAquick-PCR-Purification-Kit#productdetails"> QIAquick PCR Purification kit</a>.<br></p>
-
 
+
-
 
+
-
<div class="row">
+
-
<div class="col12-2" align = "justify">
+
-
<div class="col12-3" align = "center" style="background-color:white;>
+
-
<p style="text-align:center; color:black; ">DNA samples sendt in for sequencing</p> </div>
+
-
<br><br>
+
-
<p>The rest of the biobrick tat_GFP_RFP (BBa_K1082001) was sent in for sequencing with the F_seq and R_seq primers. The tat_ProteinG S3-2B (see sunday 22.09.2013) was also sent in for sequencing with the R_seq primer<br></p>
+
<div class ="row-end"> </div>
<div class ="row-end"> </div>
-
</div>
+
</div
<div class="row">
<div class="row">
<div class="col12-2" align = "justify">
<div class="col12-2" align = "justify">
<div class="col12-3" align = "center" style="background-color:white;>
<div class="col12-3" align = "center" style="background-color:white;>
-
<p style="text-align:center; color:black; ">Wednesday 25.09.2013</p> </div>
+
<p style="text-align:center; color:black; ">Ligation</p> </div>
<br><br>
<br><br>
-
<p>Step 1 and 2 of the [https://2013.igem.org/Team:NTNU-Trondheim/Protocols small-scale vesicle preparation] were performed with ER2566 transformed with the tat_ProteinG S3-2B (see sequencing results for sunday 22.09.2013) that had a postive sequencing result. One colony were selected from the recently transformed bacteria plate and incubated for 16 hours in step 2 in a total of 1L LB. The cultures were incubated aerobically in LB media with ampenicillin (100 &micro;L/mL) in step 1 and aerobically in plain LB in step 2.<br></p>
+
<p>The purified and digested (see above) tat_GFP_RFP with prefix was added into a ligation mix with the digested pSB1C3 backbone according to the <a href="http://parts.igem.org/Help:Protocols/Linearized_Plasmid_Backbones"> iGEM protocole</a>. The ligation product was transformed into DH5&alpha; cells.<br></p>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
-
</div>
+
</div
<div class="row">
<div class="row">
Line 756: Line 818:
<p style="text-align:center; color:black; "> Small-scale vesicle preparation</p> </div>
<p style="text-align:center; color:black; "> Small-scale vesicle preparation</p> </div>
<br><br>
<br><br>
-
<p>Step 4-12 of the [https://2013.igem.org/Team:NTNU-Trondheim/Protocols small-scale vesicle preparation] were performed with ER1. In addition a 10<sup>-6</sup> dilution of the sample were made and plating of 100&micro;L of 1 mL of the dilution on Amp-LA was performed in step 4. The plates were left in the incubator overnight. The plate had growth, indicating that the bacteria still had their plasmid.<br>
+
<p>Step 4-12 of the <a href="https://2013.igem.org/Team:NTNU-Trondheim/Protocols"> small-scale vesicle preparation</a> were performed with ER1. In addition a 10<sup>-6</sup> dilution of the sample were made and plating of 100&micro;L of 1 mL of the dilution on Amp-LA was performed in step 4. The plates were left in the incubator overnight. The plate had growth, indicating that the bacteria still had their plasmid.<br>
Optical denisty (OD) at 600 nm was mesured in step 4. The samples were diluted 1:10 with LB media and had a value of 0.165.<br>
Optical denisty (OD) at 600 nm was mesured in step 4. The samples were diluted 1:10 with LB media and had a value of 0.165.<br>
Samples for SDS-PAGE (one undiluted and one diluted 1:2) was prepared in step 12 and stored in the fridge.<br>
Samples for SDS-PAGE (one undiluted and one diluted 1:2) was prepared in step 12 and stored in the fridge.<br>
-
RFU was measured as decribed in step 12 of the [https://2013.igem.org/Team:NTNU-Trondheim/Protocols small-scale vesicle preparation] protcol. The blank sample had a value of 5531 while the vesicle containing sample had the value of 44 255.<br></p>
+
RFU was measured as decribed in step 12 of the <a href="https://2013.igem.org/Team:NTNU-Trondheim/Protocols"> small-scale vesicle preparation</a> protcol. The blank sample had a value of 5531 while the vesicle containing sample had the value of 44 255.<br></p>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
</div
</div
 +
Line 771: Line 834:
<p>SDS-PAGE were performed with the samples from the day before (see figure below):
<p>SDS-PAGE were performed with the samples from the day before (see figure below):
-
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg"> <img src="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg" width="303">
+
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/e/e0/Vesicles_PrG.jpg"> <img src="https://static.igem.org/mediawiki/2013/e/e0/Vesicles_PrG.jpg" width="303">
-
  <p style="text-align:center; color:black; "> Figure 1.</p> </div>
+
  <p style="text-align:center; color:black; "> Figure: Ladder applied is Precision Plus Protein<sup>TM</sup> Unstained Standards. The bands are not as visible as with the naked eye.</p> </div>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
</div>
</div>
-
<center>[[file:vesicles_PrG.jpg|400px]]</center>
 
-
<center>Figure: Ladder applied is Precision Plus Protein<sup>TM</sup> Unstained Standards. The bands are not as visible as with the naked eye.</center>
 
<div class="row">
<div class="row">
<div class="col12-2" align = "justify">
<div class="col12-2" align = "justify">
Line 797: Line 858:
<br><br>
<br><br>
<p>Results of DNA samples that were sent in for sequencing on monday 23.09 ware analysed.
<p>Results of DNA samples that were sent in for sequencing on monday 23.09 ware analysed.
-
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg"> <img src="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg" width="303">
+
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/2/27/TGR_F.jpg"> <img src="https://static.igem.org/mediawiki/2013/2/27/TGR_F.jpg" width="303">
  <p style="text-align:center; color:black; "> Figure 1.</p> </div>
  <p style="text-align:center; color:black; "> Figure 1.</p> </div>
-
<div class ="row-end"> </div>
+
 
-
</div>
+
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/2/21/TGR_R.jpg"> <img src="https://static.igem.org/mediawiki/2013/2/21/TGR_R.jpg" width="303">
-
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg"> <img src="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg" width="303">
+
  <p style="text-align:center; color:black; "> Figure 1.</p> </div>
  <p style="text-align:center; color:black; "> Figure 1.</p> </div>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
</div>
</div>
-
<center>[[file:tGR_F.jpg|400px]]    [[file:tGR_R.jpg|400px]]</center>
+
<div class="row">
-
 
+
<div class="col12-3" align = "justify">
-
<center>Figures: Sequencing results of the tat_GFP_RFP construct with the F_seq (left) and R_seq (right) primer. </center>
+
<p>Figures: Sequencing results of the tat_GFP_RFP construct with the F_seq (left) and R_seq (right) primer. <br></p><div class ="row-end"> </div>
 +
</div>
<div class="row">
<div class="row">
Line 813: Line 874:
<p>The new sequencing results from the ER1 sample that is supposed to have the tat_GFP_RFP construct does not make sense. It is indeed very unclear why our construct suddenly is lost.
<p>The new sequencing results from the ER1 sample that is supposed to have the tat_GFP_RFP construct does not make sense. It is indeed very unclear why our construct suddenly is lost.
-
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg"> <img src="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg" width="303">
+
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/f/f8/PrG_RR.jpg"> <img src="https://static.igem.org/mediawiki/2013/f/f8/PrG_RR.jpg" width="303">
-
  <p style="text-align:center; color:black; "> Figure 1.</p> </div>
+
  <p style="text-align:center; color:black; "> Figure: Sequencing results of the tat_ProteinG S3_2B construct with the R_seq primer..</p> </div>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
</div>
</div>
-
<center>[[file:PrG_RR.jpg|400px]]</center>
 
-
 
-
<center>Figure: Sequencing results of the tat_ProteinG S3_2B construct with the R_seq primer. </center>
 
<div class="row">
<div class="row">
Line 825: Line 883:
<p>Putting this tat_ProteinG results together with the results from sunday 22.09 with the forward (F_seq) primer gives the alignment as follows:<br>
<p>Putting this tat_ProteinG results together with the results from sunday 22.09 with the forward (F_seq) primer gives the alignment as follows:<br>
-
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg"> <img src="https://static.igem.org/mediawiki/2013/f/f9/Vesicles_trial_1.jpg" width="303">
+
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/f/ff/PrG_R.jpg"> <img src="https://static.igem.org/mediawiki/2013/f/ff/PrG_R.jpg" width="303">
-
  <p style="text-align:center; color:black; "> Figure 1.</p> </div>
+
  <p style="text-align:center; color:black; "> Figure: Alignment of the full tat_ProteinG construct.</p> </div>
<div class ="row-end"> </div>
<div class ="row-end"> </div>
</div>
</div>
-
<center>[[file:PrG_R.jpg|400px]]</center>
 
-
<center>Figure: Alignment of the full tat_ProteinG construct. </center>
+
<div class="row">
 +
<div class="col12-3" align = "justify">
 +
<p>The Protein G gene from the ''Streptococcus dysgalactiae ssp equisimilis'' sample we collected from the hospital are clearly missing two bigger segments compared to the <a href="http://www.ncbi.nlm.nih.gov/nuccore/X06173"> known gene sequence</a>. We conclude that this is Protein G as the rest of the sequence aligns well.<br></p>
 +
<div class ="row-end">
 +
</div>
 +
<div class="row">
 +
<div class="col12-3" align = "justify">
 +
<div class="col12-3" align = "center" style="background-color:white;>
 +
<p style="text-align:center; color:black; "> PCR on fluorescent proteins</p> </div>
 +
<br><br>
 +
<p>PCR was run on YFP (<a href="http://parts.igem.org/BBa_E0030">BBa_E0030</a>), CFP (<a href="http://parts.igem.org/BBa_E0020">BBa_E0020</a>), GFP (<a href="http://parts.igem.org/BBa_E0040">BBa_E0040</a>), BFP (<a href="http://parts.igem.org/BBa_K592100">BBa_K5921000</a>) and SYFP (<a href="http://parts.igem.org/BBa_K864100">BBa_K864100</a>) by using F_seq and R_seq as primers. These primers anneal to VF2 (<a href="http://parts.igem.org/BBa_G00100">BBa_G00100</a>) and VR (<a href="http://parts.igem.org/BBa_G00101">BBa_G00101</a>). The products were run on a gel and all samples had the expected size of about 1000 bp (see figure below).<br>
 +
<div class="col4" style="background-color:white;><a href="https://static.igem.org/mediawiki/2013/0/08/FP_Anderson.jpg"> <img src="https://static.igem.org/mediawiki/2013/0/08/FP_Anderson.jpg" width="303">
 +
<p style="text-align:center; color:black; "> Ladder applied is GeneRuler<sup>TM</sup> 1 kb DNA ladder..</p> </div>
 +
<div class ="row-end"> </div>
 +
</div>
-
The Protein G gene from the ''Streptococcus dysgalactiae ssp equisimilis'' sample we collected from the hospital are clearly missing two bigger segments compared to the [http://www.ncbi.nlm.nih.gov/nuccore/X06173 known gene sequence]. We conclude that this is Protein G as the rest of the sequence aligns well.<br></p>
+
<div class="row">
-
<div class ="row-end">
+
<div class="col12-3" align = "justify">
 +
<div class="col12-3" align = "center" style="background-color:white;>
 +
<p style="text-align:center; color:black; "> Analysis of sequencing results</p> </div>
 +
<br><br>
 +
<p>Another 3A assembly was done with the PmXyls promoter, GFP and backbone. The result from the test showed no fluorescence, so the GFP was not expressed as it should. <br></p>
 +
<div class ="row-end"> </div>
</div>
</div>

Latest revision as of 20:57, 4 October 2013

Trondheim iGEM 2013

header
Mercury
September

Tuesday 03.09.2013

Analysis of sequencing results



Today we got back the sequencing results from last week (see Thursday 29.08.2013). The figures below show the alignments of the samples (always first line) and the expected sequences (always second line). Red indicates proper alignment, blue indicates mismatches.

Figure: Alignment of tat_ProteinG S2. As the last time there seems to be a deletion on a guanine residue that shifting the reading frame. In addition the last part of the sequence does not seem to match like S3 and D8 did.

C4

C5

DT2

DT7

DT10

DT5

DT6

DT9

Figures: Alignment of tat_ProteinG C4, tat_ProteinG C5, tat_ProteinG DT2, tat_ProteinG DT7 and tat_ProteinG DT10. None of these sequences makes any sense. It is safe to conclude that ProteinG is not in these sequences.

TCY1

TCY2

TCY3

TCY4

Figures: Alignment of Gibson tCY 1, Gibson tCY 2, Gibson tCY 3 and SLIC tCY. tat and YFP is present, but CFP is absent in all of these sequences.

Fluorescence of ER1 and ER2



After the positive sequence results we had (see tuesday 27.08.2013), we decided to check weather there where any GFP in the ER1 and ER2 bacteria (see figure 8).
LB media samples with ER1, ER2 (see figure 8) and E.coli cells transformed with standard RFP, which served as a referance, were centrifuged. The pellets were resuspended in DPBSS buffer. These solutions were then studied in a fluorometer by doing a excitation and emission scan (see figures below):

Excitation

Emission.

Figures: Excitation and emission scan of ER1, ER2 and the referance sample with RFP.

There are no significant differance between the referance sample and the ER samples. It seems that GFP is not present or doesent fold properly.

Wednesday 04.09.13



Transformed the parts needed for testing the promoter: GFP generator (BBa_E0240), backbone ( pSB3K3 and the reference promoter ( BBa_I20260).

Thursday 05.09.13



We wanted to try to fix the addition and deletion in tat-ProteinG DT and S3 (respectively) by using the forward primer for tat (F_pl.b_tat) that has the right sequence. PCR-reactions for amplifying the backbones (BB) and the tat_ProteinG of both DT8 and S3 were run. These 4 samples were then run on a gel to confirm the results (figure below).

Figure: PCR products of tat_ProteinG and BB from DT8 (well 1 and 2) and S3 (well 3 and 4). Ladder applied is 1 kb DNA ladder. The fragments nicely matches the expected sizes of 2800 bp for backbone and 1300-1400 for tat_proteinG.

The PCR products were also incubated at 37 °C with Dpn1 to remove all old plasmids. The PCR products where then used in direct transformation of ''E.coli'' DH5α. The fragments that originated from the same plasmid where used together (BB from DT8 with tat_PrG from DT8 and so on). There was also performed a direct transformation tat_GFPmut3 with BB from S3. There were made two parallels of all combinations yielding 6 direct transformation. Controls with all the 5 fragments used was also prepared.
The transformed cells from yesterday was transfered to liquid media and incubated at 37°C overnight.

Friday 06.09.13

PCR



Turned the Pm XylS promoter system into a biobrick using PCR. The following recipe was used:
* 31.5 μl dH2O
* 10 μl 10x phusion buffer
* 1 μl dNTPs
* 2.5 μl fwd primer diluted 1:10 compared to stock solution (primer sequence: GAATTCGCGGCCGCTTCTAGTCAAGCCACTTCCTTTTTGC)
* 2.5 μl rev primer diluted 1:10 compared to stock solution (primer sequence: TACTAGTAGCGGCCGCTGCAGTGCATAAAGCCTAAGGGGTAGG)
* 1 μl template DNA
* 1 μl DMSO
* 0.5 μl Phusion DNA polymerase
Two different templates were used, and two samples were made for each template, giving in total four PCR batches. The first template was the Pm XylS plasmid, while the second was a PCR product of the Pm XylS promoter, modified in order to eliminate an XbaI restriction site.
The following PCR program was used:

Program step Temperature Duration
Heated lid 103°C -
Initial denaturation 98°C 30 s
Cycle 30x
Denaturation 98°C 15 s
Annealing 64°C 15 s
Elongation 72°C 53 s
End of cycle
Final elongation 72°C 10 min
Hold 4°C

Gel picture of the PCR products:

The PCR products were rinsed using the QIAgen PCR Purification kit. The two parallel samples using the same template were eluted in the same eppendorf tube. The following concentrations were measured:

BioBrick Concentration
Pm XylS from BB template 98.3 ng/μl
Pm XylS with XbaI site 171.9 ng/μl

Miniprep



BBa_E0240 and pSB3K3 were isolated using the Wizard Plus SV Minipreps DNA Purification System kit. The following concentrations were measured after the isolation:

Part Concentration
BBa_E0240 79.8 ng/μl
pSB3K3 42.8 ng/μl

Checking plates from Thursday 05.09.2013



All of the plates that should have colonies had colonies. The S3-1 plate had to be disregarded because the agar had detatched from the plastic plate. 4 of the 5 controls also had colonies, indicating that there where still colonies in the sample.

Sunday 08.09.2013



Two colonies from each of the usable plates (D8-1, D8-2, S3-1, tatGFPmut3-1 and tatGFPmut3-2) that where checked on friday 06.09 where transfered to LB media with ampenicillin.

Monday 09.09.2013



The bacterial culture from the day before where minipreped and the reminding plasmid samples where prepared for DNA-sequencing with the standard iGEM forward sequencing primer VF2. The samples where labled tatPrG D8-1A, tatPrG D8-1B, tatPrG D8-2A, tatPrG D8-2B, tatPrG S3-2A, tatPrG S3-2B, tatGFPmut3-1A, tatGFPmut3-1B, tatGFPmut3-2A and tatGFPmut3-2B. The samples where sent for DNA-sequencing the next day.

3A Assembly



3A Assembly was done on the Pm/Xyls promoter to attach it to the GFP and backbone. This was done according to the official iGEM protocol.

Tuesday 10.09.13

Restriction digest



Linearized pSB1C3 and the two versions of Pm XylS (modified and unmodified, one of them containing an XbaI restriction site) were cut with EcoRI and PstI in order to put the promoter system in the shipping plasmid. The following volumes of DNA and water were used in the digestions:

DNA part Concentration of DNA Calculated volume of DNA used in digestion Volume of dH2O used in digestion
Linearized pSB1C3 25 ng/μl 10 μl 6 μl
Pm XylS BB 98.3 ng/μl 2.5 μl 13.5 μl
Pm XylS XbaI 171.9 ng/μl 1.5 μl 14.5 μl

Buffer 3 were used in all restriction digests. In the table above, Pm XylS BB refers to the biobrick that has been modified compared to the original Pm XylS promoter, which contains an illegal XbaI restriction site. Pm XylS XbaI is the original promoter, that contains the XbaI site.
After the restriction digest, the products were purified using the QIAquick PCR Purification Kit, which has a filter size that allows the short ends of the prefix and suffix of the linearized plasmids and biobricks that should be present after the restriction digest, to pass through the filter. The following concentrations were measured after the purification:
DNA part Concentration
pSB1C3 4.2 ng/μl
Pm XylS BB 6.8 ng/μl
Pm XylS XbaI 7.6 ng/μl

Gel electrophoresis



Gel electrophoresis were performed to ensure that the right DNA fragments are present after the restriction digest.

In this picture, the first band is pSB1C3, which linearized should be 2070 bp long. The Pm XylS promoter system has a length of 1759 bp, and the modified and unmodified version of the promoter system corresponds to band 2 and 3.

Ligation



pSB1C3 was ligated to Pm XylS BB and Pm XylS XbaI, respectively. The following ligation mix was set up. The same mix were used for both promoter systems, since the concentrations were almost the same. The volume of backbone used corresponds to 25 ng of DNA, which is the recommended amount of backbone suggested on the partsregistry website.

Component Volume
pSB1C3 6 μl
Pm XylS BB / Pm XylS XbaI 7 μl
T4 DNA ligase buffer 1.5 μl
T4 DNA ligase 0.5 μl

The ligation mix was put in the fridge for overnight ligation.

Wednesday 11.09.13

Transformation



The Pm XylS BB in pSB1C3 and PmXylS XbaI in pSB1C3 systems that were ligated overnight were transformed to competent ''E. coli'' DH5α cells and plated out on agar plates having chloramphenicol resistance.

Thursday 12.09.13

Transfer of cells from agar plates to liquid medium



The cells transformed yesterday were transferred to liquid medium containing 1 μg/ml chloramphenicol.

Another round of small-scale vesicle preparation



Step 1 and 2 of the small-scale vesicle preparation were performed with ER2566 transformed with the ER1 construct from the second Gibson assembly attempt that had a postive sequencing results. One colony were selected from the recently transformed bacteria plate and incubated for 16 hours in step 2 in a total of 1L LB. The cultures were incubated aerobically in LB media with ampenicillin (100 µL/mL) in step 1 and areobically in plain LB in step 2.

Testing of BioBrick promoter



We tested the promoter as done in this article. Measured the absorbance at 600 nm, excitation at 485 nm and emission at 525 nm. Backgroud fluorescence was determined by measuring only media. For the reference promoter, we measured every 30 min for five hours. The Pm/XylS was added inducer in different concentrations (0nM, 10nM, 100nM, 1µM, 10µM, 100µM, 1mM and 2mM) to see the effect.

Friday 13.09.13

Miniprep



Pm XylS BB in pSB1C3 and Pm XylS XbaI in pSB1C3 was miniprepped using the Promega Wizard Plus SV Minipreps DNA Purification kit. The following concentrations were measured:

BioBrick Concentration
Pm XylS BB + pSB1C3 44.3 ng/μl
Pm XylS XbaI + pSB1C3 67.0 ng/μl

Small-scale vesicle preparation



Step 4-12 of the small-scale vesicle preparation were performed with ER1. In addition a 10-6 dilution of the sample were made and plating of 100µL of 1 mL of the dilution on Amp-LA was performed in step 4. The plates were left in the incubator overnight. The plate had growth, indicating that the bacteria still had their plasmid.
Optical denisty (OD) at 600 nm was mesured in step 4. The samples were diluted 1:10 with LB media and had a value of 0.436.
The cell cultures and cell pallets were not red or pink when they were taken out of the incubator and centrifuge. The pallet did, however, start to get a red color after a while.
Samples for SDS-PAGE (one undiluted and one diluted 1:2) was prepared in step 12 and stored in the fridge.
RFU was measured as described in step 12 of the small-scale vesicle preparation protcol. The blank sample had a value of 153 while the vesicle containing sample had the value of 2128.
There was also conducted a fluorecense scan of a undiluted sample without FM4-64. This will be desribed on "Sunday 15.09.2013".

Saturday 14.09.2013

Another round of small-scale vesicle preparation



A new round of vesicle isolation was started to create a referance to the ER1 from friday. Step 1 and 2 of the small-scale vesicle preparation were performed with unstransformed ER2566. In step 2 the bacteria was incubated for 16 hours in a total of one liter LB.

Transformation



All of the tat_ProteinG plasmids that where sent for sequencing (see monday 09.09.2013) where applied in a transformation of ''E.coli'' strain ER2566 by the transformation protocol.

Sunday 15.09.2013

Small-scale vesicle preparation



Step 4-12 of the small-scale vesicle preparation were performed with unstransformed ER2566.
Optical denisty (OD) at 600 nm was mesured in step 4. The samples were diluted 1:10 with LB media and had a value of 0.351.
Samples for SDS-PAGE (one undiluted and one diluted 1:2) was prepared in step 12 and was run with the SDS-PAGE from friday 13.09.2013. See figure below.

Figure: Ladder applied is Precision Plus ProteinTM Unstained Standards. WT stands for wildtype and is the unstransformed ER2566 samples.

There are noe additional bands in the ER1 samples compared to the unstransformed ER2566 sample, indicating that there are no GFP-RFP in the vesicles.
RFU was measured as decribed in step 12 of the small-scale vesicle preparation protocol. The blank sample had a value of 150 while the vesicle containing sample had the value of 8708.
There was run a excitation scan of the undiluted unstransformed ER2566 sample that was compared to the similar scan done on friday 13.09.2013. The results were as shown in the two figures below.

Figures: Fluorescence excitation scan of vesicles from the ER1 cells (left) and wildtype ER2566 (right).
There are no real differance between the samples other then strength of the signals. Both samples have peaks at 504, 540 and 582 nm. It is likely that there are no tGR construct in the vesicles.

PCR and digestion for putting on a prefix on the tat-GFP-RFP construct



A PCR were run on the plasmid containing tat_GFP_RFP construct with the F_prefix_tat and R_pl.b primers. This would in theory give us a PCR product that is the same size as the original plasmid. 15 µL of the PCR-product and 4 µL of the linerized pSB1C3 backbone where digested with the Enzyme Master Mix for Plasmid Backbone according to the recomended protocole.
The PCR product and the digested PCR product were run on a agarose gel, giving the result as indicated in the figure below.

Ladder applied is GeneRulerTM 100 bp plus DNA ladder. The ladder is for some reason not completly functional.

As there were not just one band and the ladder was unreliable, no fragment was cut out of the gel.

Sunday 22.09.2013

Analysing DNA sequencing results



The results from the last round of sequencing (see monday 09.09) was analysed with the prefered sequence. The alignments were as follows:

.

.

Figures: Alignment of tat_ProteinG D8-1A, tat_ProteinG D8-1B, tat_ProteinG D8-2A, tat_ProteinG D-2B and tat_ProteinG S3-2A. These sequences either makes no sense or does not have the exact sequence we are looking for. These constructs will not be applied for later.

Figure: Alignment of tat_ProteinG S3-2B. This sequence is just how its supposed to be and will be used later in a vesicle isolation.

The alignments of the tat_GFPmut3 samples did not give any sense at all in will therefore not be included here as figures.

Monday 23.09.2013

Sending Biobricks



The biobricks tat_GFP_RFP (BBa_K1082001) and the Pm/XylS promoter system (BBa_K1082002) was sent in to the registery.

DNA samples sendt in for sequencing



The rest of the biobrick tat_GFP_RFP (BBa_K1082001) was sent in for sequencing with the F_seq and R_seq primers. The tat_ProteinG S3-2B (see sunday 22.09.2013) was also sent in for sequencing with the R_seq primer

Wednesday 25.09.2013



Step 1 and 2 of the [https://2013.igem.org/Team:NTNU-Trondheim/Protocols small-scale vesicle preparation] were performed with ER2566 transformed with the tat_ProteinG S3-2B (see sequencing results for sunday 22.09.2013) that had a postive sequencing result. One colony were selected from the recently transformed bacteria plate and incubated for 16 hours in step 2 in a total of 1L LB. The cultures were incubated aerobically in LB media with ampenicillin (100 µL/mL) in step 1 and aerobically in plain LB in step 2.

Testing of BioBrick promoter



Because non-satisfying result from the last test, we did another test. This was similar to the one done on thursday 12.09.13 with the same time-series and inducer concentrations.

Thursday 26.09.2013

PCR and digestion for creating a briobrick of tat_GFP_RF



PCR was run on the tat_GFP_RFP PCR-product from sunday 16.09. This time the F_prefix_tat primer and a reverse primer that anneals to the suffix in plasmid was applied. The PCR-prduct was digested with EcoRI and PstI. The digested PCR-product was run on a gel and one gelband was cut out. The fragment was purified with the QIAquick PCR Purification kit.

Ligation



The purified and digested (see above) tat_GFP_RFP with prefix was added into a ligation mix with the digested pSB1C3 backbone according to the iGEM protocole. The ligation product was transformed into DH5α cells.

Thursday 26.09.2013

Small-scale vesicle preparation



Step 4-12 of the small-scale vesicle preparation were performed with ER1. In addition a 10-6 dilution of the sample were made and plating of 100µL of 1 mL of the dilution on Amp-LA was performed in step 4. The plates were left in the incubator overnight. The plate had growth, indicating that the bacteria still had their plasmid.
Optical denisty (OD) at 600 nm was mesured in step 4. The samples were diluted 1:10 with LB media and had a value of 0.165.
Samples for SDS-PAGE (one undiluted and one diluted 1:2) was prepared in step 12 and stored in the fridge.
RFU was measured as decribed in step 12 of the small-scale vesicle preparation protcol. The blank sample had a value of 5531 while the vesicle containing sample had the value of 44 255.

Friday 27.09.2013



SDS-PAGE were performed with the samples from the day before (see figure below):

Figure: Ladder applied is Precision Plus ProteinTM Unstained Standards. The bands are not as visible as with the naked eye.

There are no additional bands compared with the wildtype ER2566 vesicles (see sunday 15.09) and therefore no indication that Protein G are in the vesicles.

Sunday 29.09.2013

Analysis of sequencing results



Results of DNA samples that were sent in for sequencing on monday 23.09 ware analysed.

Figure 1.

Figure 1.

Figures: Sequencing results of the tat_GFP_RFP construct with the F_seq (left) and R_seq (right) primer.

The new sequencing results from the ER1 sample that is supposed to have the tat_GFP_RFP construct does not make sense. It is indeed very unclear why our construct suddenly is lost.

Figure: Sequencing results of the tat_ProteinG S3_2B construct with the R_seq primer..

Putting this tat_ProteinG results together with the results from sunday 22.09 with the forward (F_seq) primer gives the alignment as follows:

Figure: Alignment of the full tat_ProteinG construct.

The Protein G gene from the ''Streptococcus dysgalactiae ssp equisimilis'' sample we collected from the hospital are clearly missing two bigger segments compared to the known gene sequence. We conclude that this is Protein G as the rest of the sequence aligns well.

PCR on fluorescent proteins



PCR was run on YFP (BBa_E0030), CFP (BBa_E0020), GFP (BBa_E0040), BFP (BBa_K5921000) and SYFP (BBa_K864100) by using F_seq and R_seq as primers. These primers anneal to VF2 (BBa_G00100) and VR (BBa_G00101). The products were run on a gel and all samples had the expected size of about 1000 bp (see figure below).

Ladder applied is GeneRulerTM 1 kb DNA ladder..

Analysis of sequencing results



Another 3A assembly was done with the PmXyls promoter, GFP and backbone. The result from the test showed no fluorescence, so the GFP was not expressed as it should.