Team:Manchester/LabBook
From 2013.igem.org
(Difference between revisions)
(19 intermediate revisions not shown) | |||
Line 433: | Line 433: | ||
} | } | ||
- | .menu li | + | .menu li #mlink |
{ | { | ||
display:block; | display:block; | ||
Line 466: | Line 466: | ||
#text, #text1, #text2, #text3,#text4,#text5,#text6,#text7,#text8,#text9,#text10,#text11,#text12,#text13,#text14,#text15, | #text, #text1, #text2, #text3,#text4,#text5,#text6,#text7,#text8,#text9,#text10,#text11,#text12,#text13,#text14,#text15, | ||
- | #text16, #text17, #text18, #text19,#text20,#text21,#text22,#text23,#text24,#text25,#text26,#text27,#text28,#text29,#text30,#text31,#text32, #text33, #text34, #text35,#text36,#text37,#text38,#text39,#text40,#text41,#text42,#text43,#text44 | + | #text16, #text17, #text18, #text19,#text20,#text21,#text22,#text23,#text24,#text25,#text26,#text27,#text28,#text29,#text30,#text31,#text32, #text33, #text34, #text35,#text36,#text37,#text38,#text39,#text40,#text41,#text42,#text43,#text44,#text45 |
{ | { | ||
margin:0 auto; | margin:0 auto; | ||
Line 585: | Line 585: | ||
margin-top:1px; | margin-top:1px; | ||
padding:5px; | padding:5px; | ||
+ | } | ||
+ | |||
+ | .menu li #mlink2 | ||
+ | { | ||
+ | display:block; | ||
+ | width:900px; | ||
+ | text-decoration:none; | ||
+ | margin-bottom:5px; | ||
+ | font-family:Trebuchet MS; | ||
+ | font-weight:bold; | ||
+ | font-size:20px; | ||
+ | color:white; | ||
+ | background-color:#660099; | ||
+ | padding:7px 5px 5px 5px; | ||
+ | |||
+ | -webkit-border-radius: 10px; | ||
+ | border-radius: 10px; | ||
+ | |||
+ | -webkit-box-shadow: 0px 0px 5px 0px rgba(0,0,0,0.75); | ||
+ | -moz-box-shadow: 0px 0px 5px 0px rgba(0,0,0,0.75); | ||
+ | box-shadow: 0px 0px 5px 0px rgba(0,0,0,0.75); | ||
} | } | ||
Line 590: | Line 611: | ||
</head> | </head> | ||
- | <body onLoad="showImage(); blocking('text'); blocking('text1'); blocking('text2');blocking('text4'); blocking('text5'); blocking('text6'); blocking('text7'); blocking('text8'); blocking('text9'); blocking('text10'); blocking('text11'); blocking('text12'); blocking('text13'); blocking('text14');blocking('text15'); blocking('text16'); blocking('text17'); blocking('text18'); blocking('text19'); blocking('text20');blocking('text21'); blocking('text22'); blocking('text23');blocking('text24'); blocking('text25'); blocking('text26'); blocking('text27'); blocking('text28'); blocking('text29'); blocking('text30');blocking('text31'); blocking('text32');blocking('text33'); blocking('text34'); blocking('text35'); blocking('text36'); blocking('text37'); blocking('text38'); blocking('text39'); blocking('text40');blocking('text41'); blocking('text42');blocking('text43');blocking('text44'); | + | <body onLoad="showImage(); blocking('text'); blocking('text1'); blocking('text2');blocking('text4'); blocking('text5'); blocking('text6'); blocking('text7'); blocking('text8'); blocking('text9'); blocking('text10'); blocking('text11'); blocking('text12'); blocking('text13'); blocking('text14');blocking('text15'); blocking('text16'); blocking('text17'); blocking('text18'); blocking('text19'); blocking('text20');blocking('text21'); blocking('text22'); blocking('text23');blocking('text24'); blocking('text25'); blocking('text26'); blocking('text27'); blocking('text28'); blocking('text29'); blocking('text30');blocking('text31'); blocking('text32');blocking('text33'); blocking('text34'); blocking('text35'); blocking('text36'); blocking('text37'); blocking('text38'); blocking('text39'); blocking('text40');blocking('text41'); blocking('text42');blocking('text43');blocking('text44');blocking('text45'); |
hover1(); hover2(); hover3(); hover4(); hover5(); hover6(); hover7(); highlight(); "> | hover1(); hover2(); hover3(); hover4(); hover5(); hover6(); hover7(); highlight(); "> | ||
Line 656: | Line 677: | ||
<li><a href="https://2013.igem.org/Team:Manchester/Modelling" id="link6">Modelling</a> | <li><a href="https://2013.igem.org/Team:Manchester/Modelling" id="link6">Modelling</a> | ||
<ul class="submenu"> | <ul class="submenu"> | ||
- | <li><a href="https://2013.igem.org/Team:Manchester/Enzyme" id="link6"> | + | <li><a href="https://2013.igem.org/Team:Manchester/Enzyme" id="link6">Uncertainty Analysis</a></li> |
<li><a href="https://2013.igem.org/Team:Manchester/FabProteinModel" id="link6">FabA Dynamics Model</a></li> | <li><a href="https://2013.igem.org/Team:Manchester/FabProteinModel" id="link6">FabA Dynamics Model</a></li> | ||
<li><a href="https://2013.igem.org/Team:Manchester/PopulationDynamics" id="link6">Population Dynamics</a></li> | <li><a href="https://2013.igem.org/Team:Manchester/PopulationDynamics" id="link6">Population Dynamics</a></li> | ||
Line 684: | Line 705: | ||
</ul> | </ul> | ||
</li> | </li> | ||
+ | <li><a href="https://2013.igem.org/Team:Manchester/businessplan" id="link4">Business Plan</a></li> | ||
<li><a href="https://2013.igem.org/Team:Manchester/Collaboration" id="link4">Modelling Collaboration</a></li> | <li><a href="https://2013.igem.org/Team:Manchester/Collaboration" id="link4">Modelling Collaboration</a></li> | ||
<li><a href="https://2013.igem.org/Team:Manchester/KnowledgeDeficit" id="link4">Knowledge Deficit Assumption</a></li> | <li><a href="https://2013.igem.org/Team:Manchester/KnowledgeDeficit" id="link4">Knowledge Deficit Assumption</a></li> | ||
Line 750: | Line 772: | ||
<ul class="menu"> | <ul class="menu"> | ||
- | <li id="one"><a href="" onclick="blocking('text'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">14/06/2013 </span> Making media</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">14/06/2013 </span> Making media</a> |
<div id="text"> | <div id="text"> | ||
<p> | <p> | ||
Line 761: | Line 783: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text1'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">19/06/2013</span> Preparation of Chemically competent Cells</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text1'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">19/06/2013</span> Preparation of Chemically competent Cells</a> |
<div id="text1"> | <div id="text1"> | ||
<p> | <p> | ||
Line 792: | Line 814: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text2'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">20/06/2013</span> FadD Knock Out Part 1 </a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text2'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">20/06/2013</span> FadD Knock Out Part 1 </a> |
<div id="text2"> | <div id="text2"> | ||
<p> | <p> | ||
Line 806: | Line 828: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text4'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">21/06/2013</span> Continued</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text4'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">21/06/2013</span> Continued</a> |
<div id="text4"> | <div id="text4"> | ||
<p> | <p> | ||
Line 818: | Line 840: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text5'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">24/06/2013</span> Growing Cells From 21/06/2013 </a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text5'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">24/06/2013</span> Growing Cells From 21/06/2013 </a> |
<div id="text5"> | <div id="text5"> | ||
<p> | <p> | ||
Line 828: | Line 850: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text6'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">25/06/2013</span> Electrically Competent Cells For Electroporation (E.Coli BL21 DE3) </a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text6'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">25/06/2013</span> Electrically Competent Cells For Electroporation (E.Coli BL21 DE3) </a> |
<div id="text6"> | <div id="text6"> | ||
<p> | <p> | ||
Line 840: | Line 862: | ||
<p><i>Preparation of cells</i></p> | <p><i>Preparation of cells</i></p> | ||
<p>At an OD of 0.6:</p> | <p>At an OD of 0.6:</p> | ||
- | <p>Centrifuge 1: transfer the cultures to ice-cold centrifuge bottles. Harvest the cells by centrifugation at 2000g for 20 minutes at 4 ⁰C. Decant the | + | <p>Centrifuge 1: transfer the cultures to ice-cold centrifuge bottles. Harvest the cells by centrifugation at 2000g for 20 minutes at 4 ⁰C. Decant the supernatant and resuspend the cell pellet in 50 ml of ice-cold sterilised water.</p> |
<p>Centrifuge 2: harvest the cells by centrifuge at 2000g for 20 minutes at 4⁰C. Decant the supernatant and resuspend the cell pellet in 20 ml ice-cold sterilised water</p> | <p>Centrifuge 2: harvest the cells by centrifuge at 2000g for 20 minutes at 4⁰C. Decant the supernatant and resuspend the cell pellet in 20 ml ice-cold sterilised water</p> | ||
<p>Centrifuge 3: harvest the cells by centrifuge at 2000g for 20 minutes at 4⁰C . Decant the supernatant and resuspend the cell pellet in 1-2 ml ice-cold 10% glycerol. | <p>Centrifuge 3: harvest the cells by centrifuge at 2000g for 20 minutes at 4⁰C . Decant the supernatant and resuspend the cell pellet in 1-2 ml ice-cold 10% glycerol. | ||
Line 848: | Line 870: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text7'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">26/06/2013 </span> Electroporation of PKD46 in E.Coli BL21 DE3 from 25/06/2013</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text7'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">26/06/2013 </span> Electroporation of PKD46 in E.Coli BL21 DE3 from 25/06/2013</a> |
<div id="text7"> | <div id="text7"> | ||
<p> | <p> | ||
Line 862: | Line 884: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text8'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">27/06/2013</span> Transformation Results </a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text8'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">27/06/2013</span> Transformation Results </a> |
<div id="text8"> | <div id="text8"> | ||
<p> | <p> | ||
Line 896: | Line 918: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text9'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">28/06/2013</span> Further selection of Transformed cells and verification </a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text9'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">28/06/2013</span> Further selection of Transformed cells and verification </a> |
<div id="text9"> | <div id="text9"> | ||
<p> | <p> | ||
Line 904: | Line 926: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text10'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">01/07/2013</span> Continued </a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text10'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">01/07/2013</span> Continued </a> |
- | <div id="text10"> | + | <div id="text10"> |
<p> | <p> | ||
- | <p> | + | <p>Overnight colonies of plated electroporated cells created. Incubated overnight at 30 C |
- | + | ||
</div> | </div> | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text11'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">02/07/2013</span> Primer ordering </a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text11'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">02/07/2013</span> Primer ordering </a> |
<div id="text11"> | <div id="text11"> | ||
<p> | <p> | ||
<p> Order for primers put in today. They were as follows:</p> | <p> Order for primers put in today. They were as follows:</p> | ||
<p><i>H1catF</i></p> | <p><i>H1catF</i></p> | ||
- | <p>5’<u>CCGTACATATAGTAAACCCCAACGCTACTGCTGCTTGTGCGTAAAATCTCCACTTCTT</u><i> | + | <p>5’<u>CCGTACATATAGTAAACCCCAACGCTACTGCTGCTTGTGCGTAAAATCTCCACTTCTT</u><i>TACCTCTTTTTTTAGT<br>GACC</i> 3’</p> |
<p><i>H1catR</i></p> | <p><i>H1catR</i></p> | ||
- | <p>5’<u>CTCTTTAGTGGGCGTCAAAAAAAACGCCGGATTAACCGGCGTCTGACGACTGACTTAACACT</u><i> | + | <p>5’<u>CTCTTTAGTGGGCGTCAAAAAAAACGCCGGATTAACCGGCGTCTGACGACTGACTTAACACT</u><i>TTACGCCCCGCCCT<br>GCC</i> 3’</p> |
<p><i>VerF1</i></p> | <p><i>VerF1</i></p> | ||
<p>5’ GGGTCGTCCACTAATACGGC 3’</p> | <p>5’ GGGTCGTCCACTAATACGGC 3’</p> | ||
Line 933: | Line 954: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text12'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">04/07/2013</span> Induction of Lambda Red Recombinase & Electro-Competency of transformed cells</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text12'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">04/07/2013</span> Induction of Lambda Red Recombinase & Electro-Competency of transformed cells</a> |
<div id="text12"> | <div id="text12"> | ||
<p> | <p> | ||
Line 947: | Line 968: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text13'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">09/07/2013</span> PCR of Chloramphenicol and Homologous regions </a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text13'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">09/07/2013</span> PCR of Chloramphenicol and Homologous regions </a> |
<div id="text13"> | <div id="text13"> | ||
<p> | <p> | ||
Line 1,049: | Line 1,070: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text14'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">10/07/2013</span> Agarose Gel Electrophoresis of PCR product from 09/07</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text14'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">10/07/2013</span> Agarose Gel Electrophoresis of PCR product from 09/07</a> |
<div id="text14"> | <div id="text14"> | ||
<p> | <p> | ||
Line 1,067: | Line 1,088: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text15'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">11/07/2013 </span> Received FAS Module - Plating up</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text15'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">11/07/2013 </span> Received FAS Module - Plating up</a> |
<div id="text15"> | <div id="text15"> | ||
<p> | <p> | ||
Line 1,079: | Line 1,100: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text16'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">15/07/2013 </span> Stock of FAS cells for freezer</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text16'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">15/07/2013 </span> Stock of FAS cells for freezer</a> |
<div id="text16"> | <div id="text16"> | ||
<p> | <p> | ||
Line 1,106: | Line 1,127: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text17'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">24/07/2013 </span> Knockout Take II PCR of Chloramphenicol (New primers)</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text17'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">24/07/2013 </span> Knockout Take II PCR of Chloramphenicol (New primers)</a> |
<div id="text17"> | <div id="text17"> | ||
<p> | <p> | ||
Line 1,113: | Line 1,134: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text18'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">25/07/2013 </span> Knockout Take II PCR of Chloramphenicol (New primers)</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text18'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">25/07/2013 </span> Knockout Take II PCR of Chloramphenicol (New primers)</a> |
<div id="text18"> | <div id="text18"> | ||
<p><b>25/7/2013 - Results of PCR</b></p> | <p><b>25/7/2013 - Results of PCR</b></p> | ||
Line 1,166: | Line 1,187: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text19'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">26/07/2013 </span> Chloramphenicol resistance gene extraction</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text19'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">26/07/2013 </span> Chloramphenicol resistance gene extraction</a> |
<div id="text19"> | <div id="text19"> | ||
<p> | <p> | ||
Line 1,175: | Line 1,196: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text20'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">29/07/2013 </span> Knockout Take II PCR of Chloramphenicol (New primers)</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text20'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">29/07/2013 </span> Knockout Take II PCR of Chloramphenicol (New primers)</a> |
<div id="text20"> | <div id="text20"> | ||
<p>Want a 34 mg/ml stock in 100% ethanol: 0.34 g in 10 ml of ethanol</p> | <p>Want a 34 mg/ml stock in 100% ethanol: 0.34 g in 10 ml of ethanol</p> | ||
Line 1,186: | Line 1,207: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text21'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">01/08/2013 </span> Making FAS module media</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text21'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">01/08/2013 </span> Making FAS module media</a> |
<div id="text21"> | <div id="text21"> | ||
<p>Due to the high levels of fatty acid production in bacteria containing the FAS module, a new media is required to keep the cells alive:</p> | <p>Due to the high levels of fatty acid production in bacteria containing the FAS module, a new media is required to keep the cells alive:</p> | ||
Line 1,219: | Line 1,240: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text22'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">02/08/2013-05/08/2013 </span> Chloramphenicol PCRs</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text22'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">02/08/2013-05/08/2013 </span> Chloramphenicol PCRs</a> |
<div id="text22"> | <div id="text22"> | ||
<p> Repeated PCR described previously another two times, both failed. Discovered incorrect PCR settings. Repeated and got successful band:</p> | <p> Repeated PCR described previously another two times, both failed. Discovered incorrect PCR settings. Repeated and got successful band:</p> | ||
Line 1,227: | Line 1,248: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text23'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">08/08/2013 </span> Cell growth curve | + | <li id="one"><a id="mlink" href="" onclick="blocking('text23'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">08/08/2013 </span> Cell growth curve</a> |
<div id="text23"> | <div id="text23"> | ||
- | <p><b> | + | <p><b>A cell growth curve was created in order to determine if FAS media gives better growth than normal LB media. It appeared to do so, but not significantly. Will repeat at a later date </b></p> |
<br> | <br> | ||
</div> | </div> | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text24'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">12/08/2013 </span> RBS Biobrick Hydration</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text24'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">12/08/2013 </span> RBS Biobrick Hydration</a> |
<div id="text24"> | <div id="text24"> | ||
<p>Hydrated 3 ribosomal binding site biobricks: BBa_B0034, BBa_B0034, BBa_B0032, and transformed into chemically competent NovaBlue cells. They were plated on LB-AMP plates</p> | <p>Hydrated 3 ribosomal binding site biobricks: BBa_B0034, BBa_B0034, BBa_B0032, and transformed into chemically competent NovaBlue cells. They were plated on LB-AMP plates</p> | ||
Line 1,240: | Line 1,261: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text25'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">09/08/2013 </span> Primers recieved for FabA</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text25'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">09/08/2013 </span> Primers recieved for FabA</a> |
<div id="text25"> | <div id="text25"> | ||
<p><b>9/08/13 Primers recieved for FabA</b></p> | <p><b>9/08/13 Primers recieved for FabA</b></p> | ||
Line 1,258: | Line 1,279: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text26'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">13/08/2013 </span> Finding the failure for the FadD knockout</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text26'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">13/08/2013 </span> Finding the failure for the FadD knockout</a> |
<div id="text26"> | <div id="text26"> | ||
<p>Agarose Gel for confirmation the presence of DNA in pKD46</p> | <p>Agarose Gel for confirmation the presence of DNA in pKD46</p> | ||
<p>RESULT: Success</p> | <p>RESULT: Success</p> | ||
+ | <center><img src="https://static.igem.org/mediawiki/2013/7/73/GEL1308.JPG" width="500" height="365" /></center> | ||
<p>Conclusion: Electrocompetent cells are no longer competent</p> | <p>Conclusion: Electrocompetent cells are no longer competent</p> | ||
<p><b>FadD knockout all over again</b></p> | <p><b>FadD knockout all over again</b></p> | ||
<p>Result PCR of Chloramphenicol DNA</p><p>RESULT: Obtained the desired band. Non-template control was contaminated, showing a band same the chloramphenicol gene</p> | <p>Result PCR of Chloramphenicol DNA</p><p>RESULT: Obtained the desired band. Non-template control was contaminated, showing a band same the chloramphenicol gene</p> | ||
+ | <center><img src="https://static.igem.org/mediawiki/2013/d/df/GEL1308B.JPG" width="500" height="365" /></center> | ||
+ | |||
</div> | </div> | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text27'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">14/08/2013 </span> Primers received</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text27'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">14/08/2013 </span> Primers received</a> |
<div id="text27"> | <div id="text27"> | ||
<p>Delta9_Rev</p> | <p>Delta9_Rev</p> | ||
Line 1,350: | Line 1,374: | ||
<p>The samples were run on 2% gel</p> | <p>The samples were run on 2% gel</p> | ||
<p> RESULT: Success</p> | <p> RESULT: Success</p> | ||
+ | <center><img src="https://static.igem.org/mediawiki/2013/6/66/GEL1408.JPG" width="500" height="365" /></center> | ||
+ | |||
</div> | </div> | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text28'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">15/08/2013 </span> Result of FabA PCR of 14/8/13</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text28'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">15/08/2013 </span> Result of FabA PCR of 14/8/13</a> |
<div id="text28"> | <div id="text28"> | ||
- | |||
<p>RESULT: Successful. Band size 600bp</p> | <p>RESULT: Successful. Band size 600bp</p> | ||
Line 1,363: | Line 1,388: | ||
<p>The restriction digest was performed at 50°C for an hour</p> | <p>The restriction digest was performed at 50°C for an hour</p> | ||
<p>RESULT: Successful. Bands size were 400 and 200 bp respectively</p> | <p>RESULT: Successful. Bands size were 400 and 200 bp respectively</p> | ||
+ | <center><img src="https://static.igem.org/mediawiki/2013/6/6f/GEL1508.JPG" width="500" height="365" /></center> | ||
+ | |||
<p> FadD knockout continued</p> | <p> FadD knockout continued</p> | ||
Line 1,369: | Line 1,396: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text29'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">16/09/2013 </span> Induction of lamda red recombinase and making competent cells</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text29'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">16/09/2013 </span> Induction of lamda red recombinase and making competent cells</a> |
<div id="text29"> | <div id="text29"> | ||
<p>Followed the protocol as on 04/07/13</p> | <p>Followed the protocol as on 04/07/13</p> | ||
Line 1,375: | Line 1,402: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text30'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">19/08/2013 </span> Electroporation of choramphenicol gene in BL21(DE) with lamda red</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text30'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">19/08/2013 </span> Electroporation of choramphenicol gene in BL21(DE) with lamda red</a> |
<div id="text30"> | <div id="text30"> | ||
<p>Followed the protcol as on 25/08/13</p> | <p>Followed the protcol as on 25/08/13</p> | ||
Line 1,383: | Line 1,410: | ||
- | <li id="one"><a href="" onclick="blocking('text31'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">20/08/2013 </span> Electroporation of RBS Biobricks and RBS+ Constitutive promoter</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text31'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">20/08/2013 </span> Electroporation of RBS Biobricks and RBS+ Constitutive promoter</a> |
<div id="text31"> | <div id="text31"> | ||
We decided to use existing BioBrick parts for our Ribosomal Binding sites for FabA, Delta 9, Delta 12 - and also the RBS and promoter Biobrick. We intend on using the RBS+Promoter biobrick for expression of our FabA, Delta9 and Delta 12 genes in our lab work <br> | We decided to use existing BioBrick parts for our Ribosomal Binding sites for FabA, Delta 9, Delta 12 - and also the RBS and promoter Biobrick. We intend on using the RBS+Promoter biobrick for expression of our FabA, Delta9 and Delta 12 genes in our lab work <br> | ||
Line 1,437: | Line 1,464: | ||
- | <li id="one"><a href="" onclick="blocking('text32'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">20/08/2013 </span> FabA PCR Products (from 15/08/2013) - Blunt End Ligation </a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text32'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">20/08/2013 </span> FabA PCR Products (from 15/08/2013) - Blunt End Ligation </a> |
<div id="text32"> | <div id="text32"> | ||
- | We performed a blunt end ligation on the FabA PCR Products from 15/08/2013 using the Thermo Scientific CloneJET PCR | + | We performed a blunt end ligation on the FabA PCR Products from 15/08/2013 using the Thermo Scientific CloneJET PCR Cloning Kit, and transformed chemically competent NovaBlue Cells at 37 degrees celsius for 2 minutes. The cells were left to recover for 3 hours at 37 degress celcius and plated on appropriate antibiotic plates (LB + Ampicillin 100µg/ml) overnight at 37 degrees celcius. <br> |
</div> | </div> | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text33'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">21/08/2013 </span> Growing up of FabA Clone Jet Transformed cells in media & Mini Prep</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text33'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">21/08/2013 </span> Growing up of FabA Clone Jet Transformed cells in media & Mini Prep</a> |
<div id="text33"> | <div id="text33"> | ||
<b>21/08/2013 - Growing up of FabA Clone Jet Transformed cells in media & Mini Prep performed </b><br> | <b>21/08/2013 - Growing up of FabA Clone Jet Transformed cells in media & Mini Prep performed </b><br> | ||
Line 1,450: | Line 1,477: | ||
2.A miniprep was performed using Qiagen Miniprep Kit. <br> | 2.A miniprep was performed using Qiagen Miniprep Kit. <br> | ||
3. We completed a test digestion with ApoI, EcoR1 and Pst1 - same protocol as 15/08/13 confirming the identity of FabA His tag in the N Terminus<br> | 3. We completed a test digestion with ApoI, EcoR1 and Pst1 - same protocol as 15/08/13 confirming the identity of FabA His tag in the N Terminus<br> | ||
+ | <center><img src="https://static.igem.org/mediawiki/2013/c/c2/GEL2108.JPG" width="500" height="365" /></center> | ||
+ | |||
</div> | </div> | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text34'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">27/08/2013 </span> Transformation of Delta9 and Delta 12 synthesised plasmids</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text34'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">27/08/2013 </span> Transformation of Delta9 and Delta 12 synthesised plasmids</a> |
<div id="text34"> | <div id="text34"> | ||
- | 1.The Delta 9 and Delta 12 Synthesised genes arrived, and were transformed using NEB High Efficiency DH5 alpha chemically competent cells. *37 | + | 1.The Delta 9 and Delta 12 Synthesised genes arrived, and were transformed using NEB High Efficiency DH5 alpha chemically competent cells. *37 Degrees Celcius for 2 minutes* <br> |
- | 2. FabA Blunting reaction with CloneJet was repeated and also transformed with NEB DH5 alpha cells. *37 | + | 2. FabA Blunting reaction with CloneJet was repeated and also transformed with NEB DH5 alpha cells. *37 Degrees Celcius for 2 minutes* <br> |
3. All of the transformed cells were left to recover for 3 hours and then plated on appropriate LB plates<br> | 3. All of the transformed cells were left to recover for 3 hours and then plated on appropriate LB plates<br> | ||
</div> | </div> | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text35'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">28/08/2013 </span> Inoculation of LB + AMP with transformants from 27/08/2013 </a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text35'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">28/08/2013 </span> Inoculation of LB + AMP with transformants from 27/08/2013 </a> |
<div id="text35"> | <div id="text35"> | ||
<b> 28/08/2013 - Inoculation of LB + AMP with transformants from 27/08/2013 </b> | <b> 28/08/2013 - Inoculation of LB + AMP with transformants from 27/08/2013 </b> | ||
Line 1,468: | Line 1,497: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text36'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">29/08/2013 </span> Miniprep of FabA, D9, D12</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text36'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">29/08/2013 </span> Miniprep of FabA, D9, D12</a> |
<div id="text36"> | <div id="text36"> | ||
1. Miniprep on the three grown up cell colonies from 28/08/2013 was carried out. <br> | 1. Miniprep on the three grown up cell colonies from 28/08/2013 was carried out. <br> | ||
2. Test digestion was completed with EcoR1 and Pst1 to confirm identity.<br> | 2. Test digestion was completed with EcoR1 and Pst1 to confirm identity.<br> | ||
+ | <center><img src="https://static.igem.org/mediawiki/2013/e/e5/GEL2908.jpeg" width="500" height="365" /></center> | ||
3. Large scale overnight digestion was carried out with EcoR1 and Pst1 to obtain the DNA for Submission Vector and RBS + P biobrick ligation for experimental work. <br> | 3. Large scale overnight digestion was carried out with EcoR1 and Pst1 to obtain the DNA for Submission Vector and RBS + P biobrick ligation for experimental work. <br> | ||
+ | |||
</div> | </div> | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text37'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">03/09/2013 </span> Transformation of NEB-5a with BBA_K608002</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text37'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">03/09/2013 </span> Transformation of NEB-5a with BBA_K608002</a> |
<div id="text37"> | <div id="text37"> | ||
<b> 03/09/2013 - Transformation of NEB-5a with BBA_K608002. </b> <br> | <b> 03/09/2013 - Transformation of NEB-5a with BBA_K608002. </b> <br> | ||
Line 1,484: | Line 1,515: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text38'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">05/09/2013 </span> Miniprep of Colonies in LB from 04/09/2013 and digestion</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text38'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">05/09/2013 </span> Miniprep of Colonies in LB from 04/09/2013 and digestion</a> |
<div id="text38"> | <div id="text38"> | ||
1. A Miniprep was carried out using the Qiagen MiniPrep Kit <br> | 1. A Miniprep was carried out using the Qiagen MiniPrep Kit <br> | ||
2. A digestion using EcoR1 and Pst1 was completed on the BioBrick Vector to linearise the fragment for ligation with D9/D12 and FabA and gel ran to confirm the correct size fragments were obtained. Result - Success. <br> | 2. A digestion using EcoR1 and Pst1 was completed on the BioBrick Vector to linearise the fragment for ligation with D9/D12 and FabA and gel ran to confirm the correct size fragments were obtained. Result - Success. <br> | ||
+ | |||
+ | <center><img src="https://static.igem.org/mediawiki/2013/e/ed/GEL0609.JPG" width="500" height="365" /></center> | ||
+ | |||
</div> | </div> | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text39'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">06/09/2013 </span> Gel Extraction of digested BBa_K608002 (RBS + P) from 05/09/2013</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text39'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">06/09/2013 </span> Gel Extraction of digested BBa_K608002 (RBS + P) from 05/09/2013</a> |
<div id="text39"> | <div id="text39"> | ||
Products from digestion from 05/09/2013 were run on a Gel and Extracted using the Qiagen QiaQuick Gel Extraction Kit. The Elution buffer used was heated to 40 degrees celsius to improve eluted DNA concentration. <br> | Products from digestion from 05/09/2013 were run on a Gel and Extracted using the Qiagen QiaQuick Gel Extraction Kit. The Elution buffer used was heated to 40 degrees celsius to improve eluted DNA concentration. <br> | ||
Line 1,497: | Line 1,531: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text40'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">09/09/2013 </span> Gel Extraction of digestion products from 29/08/2013</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text40'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">09/09/2013 </span> Gel Extraction of digestion products from 29/08/2013</a> |
<div id="text40"> | <div id="text40"> | ||
1. A gel was run with the products from the digestion on 29/08/2013 to confirm the size of the required products<br> | 1. A gel was run with the products from the digestion on 29/08/2013 to confirm the size of the required products<br> | ||
+ | <center><img src="https://static.igem.org/mediawiki/2013/a/a0/GEL0909.JPG" width="500" height="365" /></center> | ||
+ | |||
2. A gel extraction was then performed to extract the D9, D12, FabA fragments using the Qiagen Qiaquick Gel Extraction kit.<br> | 2. A gel extraction was then performed to extract the D9, D12, FabA fragments using the Qiagen Qiaquick Gel Extraction kit.<br> | ||
<br> | <br> | ||
Line 1,505: | Line 1,541: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text41'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">12/09/2013 </span> Ligation of D9, D12, FabA into Submission Vector</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text41'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">12/09/2013 </span> Ligation of D9, D12, FabA into Submission Vector</a> |
<div id="text41"> | <div id="text41"> | ||
The Extracted products from 09/02/2013 and digested Submission Vectors were ligated using NEB T4 DNA Ligase protocol. 2ul of ligation mix was used to transform NEB-5 alpha cells <br> | The Extracted products from 09/02/2013 and digested Submission Vectors were ligated using NEB T4 DNA Ligase protocol. 2ul of ligation mix was used to transform NEB-5 alpha cells <br> | ||
+ | <center><img src="https://static.igem.org/mediawiki/2013/d/dc/GEL1209.JPG" width="500" height="365" /></center> | ||
<br> | <br> | ||
</div> | </div> | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text42'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">13/09/2013 </span> Test digestion of Submission vector with D9, D12</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text42'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">13/09/2013 </span> Test digestion of Submission vector with D9, D12</a> |
<div id="text42"> | <div id="text42"> | ||
Following Ligation of 09/0/2013 a test digestion was carried out as a preliminary method of confirming the constructs produced.<br> | Following Ligation of 09/0/2013 a test digestion was carried out as a preliminary method of confirming the constructs produced.<br> | ||
Line 1,518: | Line 1,555: | ||
2. D12+SUBMISSION VECTOR was Digestions with BamHI and Pvu1 - Failed digestion, this was a result of the wrong Enzyme buffer used.<br> | 2. D12+SUBMISSION VECTOR was Digestions with BamHI and Pvu1 - Failed digestion, this was a result of the wrong Enzyme buffer used.<br> | ||
3. D12+SUBMISSION VECTOR Digestion repeated with correct restriction enzyme buffers and new restriction enzymes (BamHI, EcoR1, Pst1 )and gel repeated - Gel confirmed correct fragment size, Success. <br> | 3. D12+SUBMISSION VECTOR Digestion repeated with correct restriction enzyme buffers and new restriction enzymes (BamHI, EcoR1, Pst1 )and gel repeated - Gel confirmed correct fragment size, Success. <br> | ||
+ | <center><img src="https://static.igem.org/mediawiki/2013/0/0a/GEL1309.jpeg" width="500" height="365" /></center> | ||
+ | |||
4. As our Submission Vectors with D9 and D12 constructs appeared to be present these plasmids were sent for sequencing with the iGEM Verification primers. <br> | 4. As our Submission Vectors with D9 and D12 constructs appeared to be present these plasmids were sent for sequencing with the iGEM Verification primers. <br> | ||
</div> | </div> | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text43'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">20/09/2013 </span> FabA test digestion</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text43'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">20/09/2013 </span> FabA test digestion</a> |
<div id="text43"> | <div id="text43"> | ||
1. NEB Enzymes EcoRV and Pst1 were used to digest the FabA and submission vector ligation from 13/09/2013 - Results proved this to be successful. <br> | 1. NEB Enzymes EcoRV and Pst1 were used to digest the FabA and submission vector ligation from 13/09/2013 - Results proved this to be successful. <br> | ||
+ | <center><img src="https://static.igem.org/mediawiki/2013/7/77/GEL2009.jpeg" width="500" height="365" /></center> | ||
+ | |||
2. FabA construct sent for sequencing <br> | 2. FabA construct sent for sequencing <br> | ||
</div> | </div> | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text44'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">22/09/2013 </span> Ligation of Into RBS + P (BBa_K608002) vector from 05/09/2013</a> | + | <li id="one"><a id="mlink" href="" onclick="blocking('text44'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">22/09/2013 </span> Ligation of Into RBS + P (BBa_K608002) vector from 05/09/2013</a> |
<div id="text44"> | <div id="text44"> | ||
The extracted delta 9, 12 and fabA products from 09/09/2013 were ligated into the RBS + P biobrick vectors and then transformed into NEB-5 alpha cells for expression in the laboratory experiments. <br> | The extracted delta 9, 12 and fabA products from 09/09/2013 were ligated into the RBS + P biobrick vectors and then transformed into NEB-5 alpha cells for expression in the laboratory experiments. <br> | ||
Line 1,537: | Line 1,578: | ||
(D12 - BamHI, Pst1, Xba1) -> Success<br> | (D12 - BamHI, Pst1, Xba1) -> Success<br> | ||
(FabA - EcoRV and Pst1) -> Success <br> | (FabA - EcoRV and Pst1) -> Success <br> | ||
+ | <center><img src="https://static.igem.org/mediawiki/2013/b/b9/GEL2309.JPG" width="500" height="365" /></center> | ||
+ | |||
Samples sent to LC-MS for characterisation | Samples sent to LC-MS for characterisation | ||
+ | </div> | ||
+ | </li> | ||
+ | |||
+ | <li id="one"><a id="mlink2" href="" onclick="blocking('text45'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">23/09/2013-03/10/2013 </span> Characterisation</a> | ||
+ | <div id="text45"> | ||
+ | Orbitrap LC-MS was carried out on the samples for analysis. For complete detail, click <a href="https://static.igem.org/mediawiki/2013/6/6d/MancLCMS.pdf" target="_blank">here</a> | ||
</div> | </div> | ||
</li> | </li> |
Latest revision as of 13:33, 26 October 2013