Team:Heidelberg/Templates/DelH week17

From 2013.igem.org

(Difference between revisions)

Latest revision as of 13:48, 25 October 2013

19-08 - 25-08-13

Summary of Amplified DelH Fragments

Fragment	Concentration [ng/µl]
G0	6.4
G1/2a	8.5

Rather low yield. So we switched the strategy and try to increase the template of DelH by amplifying it in smaller and more fragments. Therefore, we used the following primers: FS64-FS71, HM08, DN07

Amplification of DelH G0

Re-PCR Conditions G0.W17.A

Reagent	G0
Expected length [Kb]	18
Named	G0 1
Template	1 µl G0 fragment (c= 6.4 ng/µl)
Primer fw 10 µM	2 µl short2
Primer rev 10 µM	2 µl HM08
Phusion Flash Ready Mix	10 µl
ddH₂O	5 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 18 Kb

Fig.17.1 gel of amplified DelH-G0 fragment from the fragment itself (loaded 20 µL of PCR)
l1: BB amplified with HM16 by 2-step PCR, l2: BB amplified with HM17by 2-step PCR, l3: BB amplified with HM16, l4: BB amplified with HM17, l5: DelH-G0
l5: G0 was not amplified => not our fragment or without DMSO it is not so effective

Gel does not show expected band.

=> G0 was not amplified. Possibly change Mg²⁺ concentration.

PCR Conditions G0.W17.B

Reagent	G0	G0	G0	G0
Expected length [Kb]	18	18	18	18
Named	G0 0.5	G0 1	G0 2	G0 N
Template	1 µl glycerol stock D. acidovorans	1 µl glycerol stock D. acidovorans	1 µl glycerol stock D. acidovorans	1 µl glycerol stock D. acidovorans
Primer fw 10 µM	2 µl short2	2 µl short2	2 µl short2	2 µl short2
Primer rev 10 µM	2 µl HM08	2 µl HM08	2 µl HM08	2 µl HM08
Phusion Flash Ready Mix	10 µl	10 µl	10 µl	10 µl
ddH₂O	4.5 µl	4 µl	3.5 µl	4 µl
DMSO	1	1	1	1
MgSO₄	0.5 µl	1 µl	1.5 µl	-

Cycles	Temperature DelH [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 18 Kb

Fig.17.2 gel of amplified DelH-G0 with different MgSO₄(loaded 20 µL of PCR)
l1: 1Kb+ ladder, l2: G0 0.5 µl MgSO₄, l3: G0 1 µl MgSO₄, l4: G0 1.5µl MgSO₄, l5: G0 N without MgSO₄
l5: G0 was amplified without DMSO => DMSO is important, but MgSO₄ is not improve the PCR reaction

Fragments were amplified, but yield not significantly increased.

=> DMSO is important, but MgSO₄ is not improve the PCR reaction.

Characterization of DelH Plasmid pHM03 17-08

For the miniprep, the cells were centrifuged at 13,000 rpm for 15 min
The cell pellet was resuspended in 200 µl P1 + 400 µl P2 and incubated for 120
Afterwards, 300 µl S3 were added and transferred into a new 2 ml eppi and centrifuged 20 min at 13,000 rpm
1 ml isopropanol was added and the normal isoprop-ethanol-preipitation
It was resuspended in 35 µl ddH₂O

Result

Miniprep of colony	Concentration [ng/µl]
3	1,868.5
4	1,688.1
5	1,069.2
6	1,778.6
7	2,105.7
8	1,219.7
9	1,083.1
10	1,031.7
11	2,175.3
12	1,449.4

PCR Conditions CP.W17.A

M3 = Miniprep of DelH-pSB6A1(colony 3)

Template	1 µl of 1:1000 diluted M3 (pink)	1 µl of 1:1000 diluted M4 (slightly pink)	1 µl of 1:1000 diluted M5 (slightly pink)	1 µl of 1:1000 diluted M6 (pink)	1 µl of 1:1000 diluted M7 (pink)	1 µl of 1:1000 diluted M 8	1 µl of 1:1000 diluted M 9	1 µl of 1:1000 diluted M10	1 µl of 1:1000 diluted M11	1 µl of 1:1000 diluted M12
Expected length [bp]	663	663	663	663	663	663	663	663	663	663
Named	3	4	5	6	7	8	9	10	11	12
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl

Cycles	Temperature[°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
18	95	60
	65	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.17.3 colony PCR of Gibson assembled DelH-BB with mRFP (loaded 20 µL of PCR)
l1:
l3-12:show expected fragment

Colonies 3 to 12 show expected size.

=> Perform miniprep and test digest with colonies 3-12.

Test Restriction Digest

Of colonies 3, 4, 5, 6, 7

Component	Amount [µl]
DNA of M 3 to 12 (1:10)	19
CutSmart Buffer (10x)	.,2
Enzyme (SalI)	1
ddH₂O	-
Expected bands	14,180 & 9,469 bp

Incubated over night at 37°C and shaking

Result

Expected bands: 14.18 and 9.459 Kb

Fig.17.4 gel of test digest of the colonies 3-7 (loaded 20 µL of PCR)
l1:1 Kb+ ladder, l2:Digested miniprep of colony 3, l3:Digested miniprep of colony 4, l4:Digested miniprep of colony 5, l5:Digested miniprep of colony 6, l6:Digested miniprep of colony 7
l2-6:show not the expected fragment, but a band at ~ 4.8 Kb. Also observed pale bands at 20 Kb and ~ 3.8 Kb

None of the colonies shows expected restriction fragments. Additionally, there are pale bands at +20 Kb and ~3.8 Kb, but not the expected bands.

=> Possible explanation: colonies harbor reconjugated backbone AND something else involving DelH.

PCR Conditions CP.W17.B

M3 = Miniprep of DelH-pSB6A1(colony 3)

Template	1 µl of 1:1000 diluted M3 (pink)	1 µl of 1:1000 diluted M4 (slightly pink)	1 µl of 1:1000 diluted M5 (slightly pink)	1 µl of 1:1000 diluted M6 (pink)	1 µl of 1:1000 diluted M7 (pink)	1 µl of 1:1000 diluted M 8	1 µl of 1:1000 diluted M 9	1 µl of 1:1000 diluted M10	1 µl of 1:1000 diluted M11	1 µl of 1:1000 diluted M12
Expected length [bp]	663	663	663	663	663	663	663	663	663	663
Named	3	4	5	6	7	8	9	10	11	12
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl

Cycles	Temperature DelH-G0 [°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
18	95	60
	65	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.17.5 colony PCR of Gibson assembled DelH-BB with mRFP (loaded 20 µL of PCR)
l1:
l3-12:show an unexpected fragment at ~ 3Kb

Gel shows unexpected fragments at ~3 Kb.

=> Clones are negative despite of latest results. Current strategy does not work out. Development new strategy.

New Gibson Strategy

Gibson Strategy without mRFP

Try a new construct without mRFP, so that we can exclude the red clones from the screening. Therefore we are going to use a new reverse primer for the Backbone which includes only the terminator of the mRFP, but not the mRFP. The primers for the Backbone are HM11 & HM17. The construct is named pHM04 and shown in week 16 were the idea was specified. For first approach pHM04, we will amplify the backbone without mRFP, avoiding backbone reassembly due to ribosome binding site homology. In the second strategy pHM05, we will additionally introduce a tetracycline resistance, to ensure integration of the insert.

Vector Maps and Primers

1st strategy: DelH & pSB6A1 without mRFP

Vector map of the PHM04-DelH-pSB6A1(without mRFP) Gibson plasmid.

Identifier	Order date	Note	Sequence
HM17:DelH_Terminator_BB_fw	16-08-2013	Amplification of Backbone pSb6A1-lacI-mRFP	ATTGGCGCTGGAGTACGCGCTGGACTGA aggcatcaaataaaacgaaaggctcag

2nd strategy: DelH & tetracycline resistance & pSB6A1 without mRFP

Vector map of the PHM05-DelH-tetR-pSB6A1 Gibson plasmid.

Identifier	Order date	Note	Sequence
HM14:DelH_tetR_fw	2013-08-16	Gibson-Primer DelH-tetR: amplifies the tetracycline resistance from the pSB1T3 Backbone and creates an overlap to the end of DelH	ATTGGCGCTGGAGTACGCGCTGGACTGA atgaagttttaaatcaatctaaag
HM15:tetR_stop_BB_rev	2013-08-16	Gibson-Primer tetR-pSB6A1: amplifies the tetracycline resistance and creates an overlap with the Terminator of the Backbone pSB6A1	Cgactgagcctttcgttttatttgatgcctggc ctcgtgatacgcctatttttatagg
HM16:tetR_pSB6A1_fw	2013-08-16	Gibson-Primer DelH, amplifies the Backbone pSB6A1 creating an overlap with the tetracycline resistance	Aaaaataggcgtatcacgag gccaggcatcaaataaaacgaaaggctcag

Amplification of Tetracycline Fragment

Preparation of Tetraycline Medium

Weight 100 mg of tetracycline and dissolve it in 10 ml ethanol = stock solution
Add 500 µl of stock solution in 100 ml LB and mix

Transformation of Tetrazyklin Backbone

For the new strategy we need a tetracycline resistance (length ~1.2 Kb) of the pSB1T3 Backbone (2013 Distribution, Plate 5, well 7A, insert: BBa_J04450) [http://parts.igem.org/Part:pSB1T3:Design|pSB1T3]
The primers are already designed and shown in the table above
With these primers, we amplify the tetracycline resistance and include an overlap to DelH end and the backbone pSB6A1 excluding the mRFP
For the transformation I incubated 10 min at room temperature the well 7A of plate 5 with 10 µl ddH₂O

PCR Conditions TR.W17.A

Reagent	pSB1T3	pSB1T3
Template	picked colony 1	picked colony 2
Primer fw 10 µM	1 µl HM14	1 µl HM14
Primer rev 10 µM	1 µl HM15	1 µl HM15
Phusion Ready Mix	10 µl	10 µl
ddH₂O	8 µl	8 µl

Cycles	Temperature DelH [°C]	Time [s]
1	98	5
12	98	1
	68 (touchdown -0,5°C)	5
	72	30
18	98	1
	67	5
	72	30
1	72	5 min
1	4	inf

Result

Expected band: 1.468 Kb

Fig.17.6 gel of amplified tetracycline resistance (loaded 20 µL of PCR)
l1: 2 log, l2: tetracycline resistance amplified from colony, l3: tetracycline resistance amplified from colony 2
l2-3: show no band = maybe annealing temperature to high

Gel does not schow any band.

=> Try amplification with lower annealing temperature.

PCR Conditions TR.W17.B

Reagent	pSB1T3
Template	picked colony
Primer fw 10 µM	1 µl HM14
Primer rev 10 µM	1 µl HM15
Phusion Ready Mix	10 µl
ddH₂O	8 µl
DMSO	-

Cycles	Temperature DelH BB [°C]	Time [s]
1	98	5
12	98	1
	55 (touchdown -0,5°C)	5
	72	30
18	98	1
	55	5
	72	30
1	72	5 min
1	4	inf

Result

Expected band: 1.468 Kb

Fig.17.7 gel of amplified tetracycline resistance (loaded 20 µL of PCR)
l1: 2 log, l2: tetracycline resistance amplified from new picked colony 1, l3: tetracycline resistance amplified from new picked colony 2,
l2-3: show no band

Gel does not show expected band.

=> Repeat amplification with miniprep, therefore miniprep the 3 colonies containing pSB1T3.

PCR Conditions TR.W17.C

Reagent	pSB1T3	pSB1T3	pSB1T3
Template	Minipreped pSB1T3	Minipreped pSB1T3	Minipreped pSB1T3
Primer fw 10 µM	2 µl HM14	2 µl HM14	2 µl HM14
Primer rev 10 µM	2 µl HM15	2 µl HM15	2 µl HM15
Phusion Ready Mix	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	55 (touchdown -0,5°C)	5
	72	30
18	98	1
	55	5
	72	30
1	72	5 min
1	4	inf

Result

Expected band: 1.468 Kb

Fig.17.8 gel of amplified tetracycline resistance (loaded 20 µL of PCR)
l1: tetracycline resistance amplified from minipreped colony 1, l2: tetracycline resistance amplified from minipreped colony 2, l3: tetracycline resistance amplified from minipreped colony 3,l4: 2 log,
l1-3: show expected band = was cut

Gel does show expected band.

=> Fragment was cut and gel extracted (c= 132.1 ng/µl).

Amplification of Backbone

PCR Conditions BB.W7.A

With new primers (HM16 & HM17)

Reagent	BB with tetracycline & without mRFP	BB without mRFP
Template	1 µl BB 3.08	1 µl BB 3.08
Primer fw 10 µM	2 µl HM11	2 µl HM11
Primer rev 10 µm	2 µl HM16	2 µl HM17
Phusion Flash Ready Mix	10 µl	10 µl
ddH₂O 5µl	5 µl

Cycles	Temperature DelH BB [°C]	Time [s]
1	98	5
12	98	1
	69 (touchdown -0,5°C)	5
	72	75
18	98	1
	68	5
	72	75
1	72	5 min
1	4	inf

Result

Expected band: ~ 4.4 Kb

Fig.17.9 gel of amplified BB (loaded 25 µL of PCR)
l1: BB amplified with HM16, l2: BB amplified with HM17
l1:specific band as expected = was cut out

Gel shows specific band for amplification using HM16.

=> Fragment wa scut and gel extracted. For HM17, run a two-step PCR because of it's high annealing temperature. Also we are going to rise the amplification time to 1:30 min.

PCR Conditions BB.W7.B

Reagent	BB with tetracycline & without mRFP	BB without mRFP	BB with tetracycline & without mRFP	BB without mRFP
Template	1 µl BB 3,08	1 µl BB 3,08	1 µl BB 3,08	1 µl BB 3,08
Primer fw 10 µM	2 µl HM11	2 µl HM11	5 µl HM11	5 µl HM11
Primer rev 10 µM	2 µl HM16	2 µl HM17	5 µl HM16	5 µl HM17
Phusion Flash Ready Mix	10 µl	10 µl	25 µl	25 µl
ddH₂O	5 µl	5 µl	14 µl	14 µl

Cycles	Temperature (20 µl = sample 1 & 2) [°C]	Time	Temperature (50 µl = sample 3 & 4) [°C]	Time [s]
1	98	5	98	5
12	98	1	98	1
	69 (touchdown -0,5°C)	5	-
	72	90	72	90
18	98	1	98	1
	68	5	-
	72	90	72	90
1	72	5 min	72	5 min
1	4	inf	4	inf

Result

Expected band: ~ 4.4 Kb

Fig.17.10 gel of amplified BB with different primers (loaded 20 µL of PCR)
l1: BB amplified with HM16 by 2-step PCR, l2: BB amplified with HM17by 2-step PCR, l3: BB amplified with HM16, l4: BB amplified with HM17, l5: DelH-G0
all 4 samples (l1-4) showed a specific band at 4.4 Kb = was cut

All samples show expected length.

=> Fragments were cut and gel extracted.

Sample	Concentration [ng/µl]
BB-16	76.7
BB-17	51.3

Restriction Digest with DpnI

Incubated at 37°C for 2.5 h

Sample [µl]	Buffer [µl]	Enzyme [µl]
18 BB-16	2.1 CutSmart Buffer	1 DpnI
18 BB-16	2.1 CutSmart Buffer	1 DpnI

Afterwards, a purification was performed with the nucleotide removal kit

Generation of DelH Plasmid pHM04 23-08

Summary of Fragments

Fragment	Concentration [ng/µl]	Date
G0	6.4	22-08
G1/2a	8.5	22-08
G2b	18.6	Example
BB	Example	22-08

Gibson Assembly

Mix name	DelH G0	DelH G1/2a	DelH G2b	BB17	Gibson Master Mix [µl]	Final volume [µl]
E1	9	-	-	0.5	10	20
E2	-	7	2.5	0.5	10	20

Incubate the Gibson Assembly for 1 h at 50°C

Electroporation

Sample	Electroporated with	Plated out	Cuvette "exploded"
1	1 µl of E1 (5 µl Gibson + 10 µl ddH₂O)	22.08.2013	v
2	14 µl of E1 (5 µl Gibson + 10 µl ddH₂O)	22.08.2013	v
3	1 µl of E2 (5 µl Gibson + 10 µl ddH₂O)	22.08.2013	-
4	14 µl of E2 (5 µl Gibson + 10 µl ddH₂O)	22.08.2013	v
5	20 µl of E1 (purified by isoprop-precipitation)	22.08.2013	-
6	20 µl of E2 (purified by isoprop-precipitation)	22.08.2013	- (no pellet observed)

Colony-PCR CP.W17.C

50 colonies of plate 5 (= isoprop purified E1 => G0-complete in Backbone)
10 colonies of plate ...
2 different screening are performed
PC = picked colony
S5 = Sample 5 (watch names above on construct DelH-BB)

Template	50 x 1 PC S5	50 x 1 PC S5	4 x 1 PC S3	4 x 1 PC S3
Expected length [bp]	663	2,500	663	2,500
Named	A -J (5 colonies per tube)	A -J (5 colonies per tube)	1-4	1-4
Primer fw 10 µM	10 x 1 µl VF2	10 x 1 µl HM13	4 x 1 µl VF2	4 x 1 µl HM13
Primer rev 10 µM	10 x 1 µl DN07	10 x 1 µl VR2	1 µl DN07	1 µl VR2
Dream-Taq Polymerase (2x)	10 x 10 µl	10 x 10 µl	4 x 10 µl	4 x 10 µl
ddH₂O	10 x 8 µl	10 x 8 µl	4 x 8 µl	4 x 8 µl

Cycles	Temperature Screening start[°C]	Time [s]	Temperature Screening end [°C]	Time [s]
1	95	120	95	120
12	95	60	95	60
	68 (touchdown -0.5°C)	30	60 (touchdown -0.5°C)	30
	72	45	72	2:30 min
12x/ 34x	95	60	95	60
	65	30	60	30
	72	45	72	2:30 min
1	72	5 min	72	5 min
1	12	inf	12	inf

Result

Expected band: 663 bp (screening start), 2.5 Kb (screening end)

Fig.17.11 colony PCR of Gibson assembled DelH-BB with mRFP (loaded 20 µL of PCR)
l1:
l3-12:show an unexpected fragment at ~ 3Kb

Gel does not show expected bands.

=> Screen 10 minipreped colonies of the plate 5 and pick another 10 colonies of plate 1, 2, 3 and 6 (on plate 4 are no colonies).

Colony-PCR CP.W17.D

2 different screening are performed
PC = picked colony
S5 = Sample 5 (watch names above on construct DelH-BB)

Template	10 x 1 PC S1	10 x 1 PC S1	10 x 1 PC S2	10 x 1 PC S2	10 x 1 PC S3	10 x 1 PC S3	10 x 1 PC S6	10 x 1 PC S6	10 x 1 µl of minipreped colony	10 x 1 µl of minipreped colony
Expected length [bp]	663	2.5	663	2.5	663	2.5	663	2.5	663	2.5
Named	1A-E (2 colonies per tube)	1F-J (2 colonies per tube)	2A-E (2 colonies per tube)	2F-J (2 colonies per tube)	3A-E (2 colonies per tube)	3F-J (2 colonies per tube)	6A-E (2 colonies per tube)	6F-J (2 colonies per tube)	.............	....................
Primer fw 10 µM	5 x 1 µl VF2	5 x 1 µl HM13	5 x 1 µl VF2	5 x 1 µl HM13	5 x 1 µl VF2	5 x 1 µl HM13	5 x 1 µl VF2	5 x 1 µl HM13	5 x 1 µl VF2	5 x 1 µl HM13
Primer rev 10 µM	5 x 1 µl DN07	5 x 1 µl VR2	5 µl DN07	5 µl VR2	5 x 1 µl DN07	5 x 1 µl VR2	5 µl DN07	5 µl VR2	5 x 1 µl DN07	5 x 1 µl VR2
Dream-Taq Polymerase (2x)	5 x 10 µl	5 x 10 µl	5 x 10 µl	5 x 10 µl	5 x 10 µl	5 x 10 µl	5 x 10 µl	5 x 10 µl	5 x 10 µl	5 x 10 µl
ddH₂O	5 x 8 µl	5 x 8 µl	5 x 8 µl	5 x 8 µl	5 x 8 µl	5 x 8 µl	5 x 8 µl	5 x 8 µl	5 x 6 µl	5 x 6 µl

Cycles	Temperature Screening start [°C]	Time [s]	Temperature Screening end [°C]	Time [s]
1	95	120	95	120
12	95	60	95	60
	68 (touchdown -0.5°C)	30	60 (touchdown -0.5°C)	30
	72	45	72	2:30 min
12x/ 34x	95	60	95	60
	65	30	60	30
	72	45	72	2:30 min
1	72	5 min	72	5 min
1	12	inf	12	inf

Result

Expected band: 663 bp (screening start), 2.5 Kb (screening end)

Fig.17.13 colony PCR of Gibson assembled DelH-BB without mRFP with the screening primer VR2 and HM13 (loaded 1 µL of PCR)
l1:2log ladder l2-24: PCR of picked colonies from plate 1,2,3,5,6
no band at 663 bp observed

Fig.17.12 colony PCR of Gibson assembled DelH-BB without mRFP with the screening primer VF2 and DN11(loaded 1 µL of PCR)
l1:2log ladder l2-24: PCR of picked colonies from plate 1,2,3,5,6
no band at 663 bp observed

None of the gels shows expected fragment.

=> Overthink strategy.

@@ Line 56: / Line 56: @@
 <br/>
 [[File:Heidelberg_20130822 BB16-17 G0 1kb+.png|200px|thumb|right|'''Fig.17.1''' gel of amplified DelH-G0 fragment from the fragment itself (loaded 20 µL of PCR) <br> ''l1:'' BB amplified with HM16 by 2-step PCR, ''l2:'' BB amplified with HM17by 2-step PCR, ''l3:'' BB amplified with HM16, ''l4:'' BB amplified with HM17, ''l5:'' DelH-G0 <br> l5: G0 was not amplified => not our fragment or without DMSO it is not so effective ]]
-<div style="clear:both"></div>
 Gel does not show expected band.
 :=> G0 was not amplified. Possibly change Mg<sup>2+</sup> concentration.
 <br/>
+<div style="clear:both"></div>
 ====PCR Conditions G0.W17.B====
 {| class="wikitable" style="float:left; margin-right:1em"
@@ Line 107: / Line 108: @@
 <br/>
 [[File:Heidelberg_20130823 G00,5 G0-1 G0-1,5 GoN.png|200px|thumb|right|'''Fig.17.2''' gel of amplified DelH-G0 with different MgSO<sub>4</sub>(loaded 20 µL of PCR) <br> ''l1:'' 1Kb+ ladder, ''l2:'' G0 0.5 µl MgSO<sub>4</sub>, ''l3:'' G0 1 µl MgSO<sub>4</sub>, ''l4:'' G0 1.5µl MgSO<sub>4</sub>, ''l5:'' G0 N without MgSO<sub>4</sub> <br> l5: G0 was amplified without DMSO => DMSO is important, but MgSO<sub>4</sub> is not improve the PCR reaction]]
-<div style="clear:both"></div>
 Fragments were amplified, but yield not significantly increased.
 :=> DMSO is important, but MgSO<sub>4</sub> is not improve the PCR reaction.
 <br/>
+<div style="clear:both"></div>
 ===Characterization of DelH Plasmid pHM03 17-08===
 * For the miniprep, the cells were centrifuged at 13,000 rpm for 15 min
@@ Line 186: / Line 188: @@
 <br/>
 [[File:Heidelberg_20130818_Colony_PCR_DelH.png|200px|thumb|right|'''Fig.17.3''' colony PCR of Gibson assembled DelH-BB with mRFP (loaded 20 µL of PCR) <br> ''l1:'' <br> ''l3-12'':show expected fragment ]]
-<div style="clear:both"></div>
 Colonies 3 to 12 show expected size.
 :=> Perform miniprep and test digest with colonies 3-12.
 <br/>
+<div style="clear:both"></div>
 ====Test Restriction Digest====
 Of colonies 3, 4, 5, 6, 7
@@ Line 211: / Line 214: @@
 <br/>
 [[File:Heidelberg_20130819 digestedColonies3-7.png|200px|thumb|right|'''Fig.17.4''' gel of test digest of the colonies 3-7 (loaded 20 µL of PCR) <br> ''l1:''1 Kb+ ladder, ''l2:''Digested miniprep of colony 3, ''l3:''Digested miniprep of colony 4, ''l4:''Digested miniprep of colony 5, ''l5:''Digested miniprep of colony 6, ''l6:''Digested miniprep of colony 7 <br> ''l2-6'':show not the expected fragment, but a band at ~ 4.8 Kb. Also observed pale bands at 20 Kb and ~ 3.8 Kb]]
-<div style="clear:both"></div>
 None of the colonies shows expected restriction fragments. Additionally, there are pale bands at +20 Kb and ~3.8 Kb, but not the expected bands.
 :=> Possible explanation: colonies harbor reconjugated backbone AND something else involving DelH.
 <br/>
+<div style="clear:both"></div>
 ====PCR Conditions CP.W17.B====
 M3 = Miniprep of DelH-pSB6A1(colony 3)
@@ Line 258: / Line 262: @@
 <br/>
 [[File:Heidelberg_20130820_col_PCR_delH_zoom.png|200px|thumb|right|'''Fig.17.5''' colony PCR of Gibson assembled DelH-BB with mRFP (loaded 20 µL of PCR) <br> ''l1:'' <br> ''l3-12'':show an unexpected fragment at ~ 3Kb ]]
-<div style="clear:both"></div>
 Gel shows unexpected fragments at ~3 Kb.
 :=> Clones are negative despite of latest results. Current strategy does not work out. '''Development new strategy.'''
 <br/>
+<div style="clear:both"></div>
 ===New Gibson Strategy===
 ====Gibson Strategy without mRFP====
@@ Line 269: / Line 274: @@
 ====Vector Maps and Primers====
 '''1st strategy: DelH & pSB6A1 without mRFP'''
-[[File:Heidelberg_PHM04-DelH-pSB6A1.png|300px|left|thumb|Vector map of the [[:File:Heidelberg_PHM04-DelH-pSB6A1(without mRFP).gb|PHM04-DelH-pSB6A1(without mRFP) Gibson plasmid]].]]
+[[File:Heidelberg_PHM_04.png|300px|left|thumb|Vector map of the [[:File:Heidelberg_PHM04-DelH-pSB6A1(without mRFP).gb|PHM04-DelH-pSB6A1(without mRFP) Gibson plasmid]].]]
 {| class="wikitable"
 |-
@@ Line 292: / Line 297: @@
 <div style="clear:both"></div>
 <br/>
 ===Amplification of Tetracycline Fragment===
 ====Preparation of Tetraycline Medium====
@@ Line 345: / Line 351: @@
 <br/>
 [[File:Heidelberg_20130822 tetR1-2.png|200px|thumb|right|'''Fig.17.6''' gel of amplified tetracycline resistance (loaded 20 µL of PCR) <br> ''l1:'' 2 log, ''l2:'' tetracycline resistance amplified from colony, ''l3:'' tetracycline resistance amplified from colony 2 <br> l2-3: show no band = maybe annealing temperature to high]]
-<div style="clear:both"></div>
 Gel does not schow any band.
 :=> Try amplification with lower annealing temperature.
 <br/>
+<div style="clear:both"></div>
 ====PCR Conditions TR.W17.B====
 {| class="wikitable" style="float:left; margin-right:1em"
@@ Line 394: / Line 400: @@
 <br/>
 [[File:Heidelberg_20130823 tetR 2log.png|200px|thumb|right|'''Fig.17.7''' gel of amplified tetracycline resistance (loaded 20 µL of PCR) <br>  ''l1:'' 2 log, ''l2:'' tetracycline resistance amplified from new picked colony 1, ''l3:'' tetracycline resistance amplified from new picked colony 2, <br> l2-3: show no band]]
-<div style="clear:both"></div>
 Gel does not show expected band.
 :=> Repeat amplification with miniprep, therefore miniprep the 3 colonies containing pSB1T3.
 <br/>
+<div style="clear:both"></div>
 ====PCR Conditions TR.W17.C====
 {| class="wikitable" style="float:left; margin-right:1em"
@@ Line 441: / Line 448: @@
 <br/>
 [[File:Heidelberg_20130823 tetR 2log.png|200px|thumb|right|'''Fig.17.8''' gel of amplified tetracycline resistance (loaded 20 µL of PCR) <br>  ''l1:'' tetracycline resistance amplified from minipreped colony 1, ''l2:'' tetracycline resistance amplified from minipreped colony 2, ''l3:'' tetracycline resistance amplified from minipreped colony 3,''l4:'' 2 log, <br> l1-3: show expected band = was cut]]
-<div style="clear:both"></div>
 Gel does show expected band.
 :=> Fragment was cut and gel extracted (c= 132.1 ng/µl).
 <br/>
+<div style="clear:both"></div>
 ===Amplification of Backbone===
 ====PCR Conditions BB.W7.A====
@@ Line 490: / Line 497: @@
 <br/>
 [[File:Heidelberg_20130821 BB-PCCR.png|200px|thumb|right|'''Fig.17.9''' gel of amplified BB (loaded 25 µL of PCR) <br> ''l1:'' BB amplified with HM16, ''l2:'' BB amplified with HM17 <br> l1:specific band as expected = was cut out]]
-<div style="clear:both"></div>
 Gel shows specific band for amplification using HM16.
 :=> Fragment wa scut and gel extracted. For HM17, run a two-step PCR because of it's high annealing temperature. Also we are going to rise the amplification time to 1:30 min.
 <br/>
+<div style="clear:both"></div>
 ====PCR Conditions BB.W7.B====
 {| class="wikitable" style="float:left; margin-right:1em"
@@ Line 537: / Line 544: @@
 <br/>
 [[File:Heidelberg_20130822 BB16-17 G0 1kb+.png|200px|thumb|right|'''Fig.17.10''' gel of amplified BB with different primers (loaded 20 µL of PCR) <br> ''l1:'' BB amplified with HM16 by 2-step PCR, ''l2:'' BB amplified with HM17by 2-step PCR, ''l3:'' BB amplified with HM16, ''l4:'' BB amplified with HM17, ''l5:'' DelH-G0 <br> all 4 samples (l1-4) showed a specific band at 4.4 Kb = was cut]]
-<div style="clear:both"></div>
 All samples show expected length.
 :=> Fragments were cut and gel extracted.
@@ Line 549: / Line 556: @@
 |}
 <br/>
+<div style="clear:both"></div>
 ===Restriction Digest with DpnI===
 * Incubated at 37°C for 2.5 h
@@ Line 655: / Line 662: @@
 <br/>
 [[File:Heidelberg_20130823 2log screening1-4end.svg.png|200px|thumb|right|'''Fig.17.11''' colony PCR of Gibson assembled DelH-BB with mRFP (loaded 20 µL of PCR) <br> ''l1:'' <br> ''l3-12'':show an unexpected fragment at ~ 3Kb ]]
-<div style="clear:both"></div>
 Gel does not show expected bands.
 :=>  Screen 10 minipreped colonies of the plate 5 and pick another 10 colonies of plate 1, 2, 3 and 6 (on plate 4 are no colonies).
 <br/>
+<div style="clear:both"></div>
 ====Colony-PCR CP.W17.D====
 * 2 different screening are performed
@@ Line 706: / Line 713: @@
 Expected band: 663 bp (screening start), 2.5 Kb (screening end)
 <br/>
-[[File:Heidelberg_20130824 2log screening 1A-6E.png|200px|thumb|right|'''Fig.17.12''' colony PCR of Gibson assembled DelH-BB without mRFP
+[[File:Heidelberg_20130826 2log screening 1F-6J.png|200px|thumb|right|'''Fig.17.13''' colony PCR of Gibson assembled DelH-BB without mRFP with the screening primer VR2 and HM13 (loaded 1 µL of PCR) <br> ''l1:''2log ladder ''l2-24:'' PCR of picked colonies from plate 1,2,3,5,6  <br> no band at 663 bp observed]]
-with the screening primer VF2 and DN11(loaded 1 µL of PCR) <br> ''l1:''2log ladder ''l2-24:'' PCR of picked colonies from plate 1,2,3,5,6  <br> no band at 663 bp observed]]
+<div class="tright" style="clear:none">[[File:Heidelberg_20130824 2log screening 1A-6E.png|200px|thumb|right|'''Fig.17.12''' colony PCR of Gibson assembled DelH-BB without mRFP
- [[File:Heidelberg_20130826 2log screening 1F-6J.png|200px|thumb|right|'''Fig.17.13''' colony PCR of Gibson assembled DelH-BB without mRFP with the screening primer VR2 and HM13 (loaded 1 µL of PCR) <br> ''l1:''2log ladder ''l2-24:'' PCR of picked colonies from plate 1,2,3,5,6  <br> no band at 663 bp observed]]
+with the screening primer VF2 and DN11(loaded 1 µL of PCR) <br> ''l1:''2log ladder ''l2-24:'' PCR of picked colonies from plate 1,2,3,5,6  <br> no band at 663 bp observed]]</div>
-<div style="clear:both"></div>
 None of the gels shows expected fragment.
 :=> Overthink strategy.
 <br/>
+<div style="clear:both"></div>

Team:Heidelberg/Templates/DelH week17

From 2013.igem.org

Latest revision as of 13:48, 25 October 2013

Contents

19-08 - 25-08-13

Summary of Amplified DelH Fragments

Amplification of DelH G0

Re-PCR Conditions G0.W17.A

Result

PCR Conditions G0.W17.B

Result

Characterization of DelH Plasmid pHM03 17-08

Result

PCR Conditions CP.W17.A

Result

Test Restriction Digest

Result

PCR Conditions CP.W17.B

Result

New Gibson Strategy

Gibson Strategy without mRFP

Vector Maps and Primers

Amplification of Tetracycline Fragment

Preparation of Tetraycline Medium

Transformation of Tetrazyklin Backbone

PCR Conditions TR.W17.A

Result

PCR Conditions TR.W17.B

Result

PCR Conditions TR.W17.C

Result

Amplification of Backbone

PCR Conditions BB.W7.A

Result

PCR Conditions BB.W7.B

Result

Restriction Digest with DpnI

Generation of DelH Plasmid pHM04 23-08

Summary of Fragments

Gibson Assembly

Electroporation

Colony-PCR CP.W17.C

Result

Colony-PCR CP.W17.D

Result