Team:Manchester/LabBook

From 2013.igem.org

(Difference between revisions)
 
(23 intermediate revisions not shown)
Line 433: Line 433:
}
}
-
.menu li a
+
.menu li #mlink
{
{
display:block;
display:block;
Line 466: Line 466:
#text, #text1, #text2, #text3,#text4,#text5,#text6,#text7,#text8,#text9,#text10,#text11,#text12,#text13,#text14,#text15,
#text, #text1, #text2, #text3,#text4,#text5,#text6,#text7,#text8,#text9,#text10,#text11,#text12,#text13,#text14,#text15,
-
#text16, #text17, #text18, #text19,#text20,#text21,#text22,#text23,#text24,#text25,#text26,#text27,#text28,#text29,#text30,#text31,#text32, #text33, #text34, #text35,#text36,#text37,#text38,#text39,#text40,#text41,#text42,#text43,#text44
+
#text16, #text17, #text18, #text19,#text20,#text21,#text22,#text23,#text24,#text25,#text26,#text27,#text28,#text29,#text30,#text31,#text32, #text33, #text34, #text35,#text36,#text37,#text38,#text39,#text40,#text41,#text42,#text43,#text44,#text45
{
{
margin:0 auto;
margin:0 auto;
Line 585: Line 585:
margin-top:1px;
margin-top:1px;
padding:5px;
padding:5px;
 +
}
 +
 +
.menu li #mlink2
 +
{
 +
display:block;
 +
width:900px;
 +
text-decoration:none;
 +
margin-bottom:5px;
 +
font-family:Trebuchet MS;
 +
font-weight:bold;
 +
font-size:20px;
 +
color:white;
 +
background-color:#660099;
 +
padding:7px 5px 5px 5px;
 +
 +
-webkit-border-radius: 10px;
 +
border-radius: 10px;
 +
 +
-webkit-box-shadow: 0px 0px 5px 0px rgba(0,0,0,0.75);
 +
-moz-box-shadow: 0px 0px 5px 0px rgba(0,0,0,0.75);
 +
box-shadow: 0px 0px 5px 0px rgba(0,0,0,0.75);
}
}
Line 590: Line 611:
</head>
</head>
-
<body onLoad="showImage(); blocking('text'); blocking('text1'); blocking('text2');blocking('text4'); blocking('text5'); blocking('text6'); blocking('text7'); blocking('text8'); blocking('text9'); blocking('text10'); blocking('text11'); blocking('text12'); blocking('text13'); blocking('text14');blocking('text15'); blocking('text16'); blocking('text17'); blocking('text18'); blocking('text19'); blocking('text20');blocking('text21'); blocking('text22'); blocking('text23');blocking('text24'); blocking('text25'); blocking('text26'); blocking('text27'); blocking('text28'); blocking('text29'); blocking('text30');blocking('text31'); blocking('text32');blocking('text33'); blocking('text34'); blocking('text35'); blocking('text36'); blocking('text37'); blocking('text38'); blocking('text39'); blocking('text40');blocking('text41'); blocking('text42');blocking('text43');blocking('text44');  
+
<body onLoad="showImage(); blocking('text'); blocking('text1'); blocking('text2');blocking('text4'); blocking('text5'); blocking('text6'); blocking('text7'); blocking('text8'); blocking('text9'); blocking('text10'); blocking('text11'); blocking('text12'); blocking('text13'); blocking('text14');blocking('text15'); blocking('text16'); blocking('text17'); blocking('text18'); blocking('text19'); blocking('text20');blocking('text21'); blocking('text22'); blocking('text23');blocking('text24'); blocking('text25'); blocking('text26'); blocking('text27'); blocking('text28'); blocking('text29'); blocking('text30');blocking('text31'); blocking('text32');blocking('text33'); blocking('text34'); blocking('text35'); blocking('text36'); blocking('text37'); blocking('text38'); blocking('text39'); blocking('text40');blocking('text41'); blocking('text42');blocking('text43');blocking('text44');blocking('text45'); 
hover1(); hover2(); hover3(); hover4(); hover5(); hover6(); hover7(); highlight(); ">
hover1(); hover2(); hover3(); hover4(); hover5(); hover6(); hover7(); highlight(); ">
Line 656: Line 677:
                   <li><a href="https://2013.igem.org/Team:Manchester/Modelling" id="link6">Modelling</a>
                   <li><a href="https://2013.igem.org/Team:Manchester/Modelling" id="link6">Modelling</a>
                <ul class="submenu">
                <ul class="submenu">
-
    <li><a href="https://2013.igem.org/Team:Manchester/Parameter" id="link6">Parameter Estimation</a></li>
+
  <li><a href="https://2013.igem.org/Team:Manchester/Enzyme" id="link6">Uncertainty Analysis</a></li>
                             <li><a href="https://2013.igem.org/Team:Manchester/FabProteinModel" id="link6">FabA Dynamics Model</a></li>
                             <li><a href="https://2013.igem.org/Team:Manchester/FabProteinModel" id="link6">FabA Dynamics Model</a></li>
                           <li><a href="https://2013.igem.org/Team:Manchester/PopulationDynamics" id="link6">Population Dynamics</a></li>
                           <li><a href="https://2013.igem.org/Team:Manchester/PopulationDynamics" id="link6">Population Dynamics</a></li>
Line 684: Line 705:
</ul>
</ul>
    </li>
    </li>
 +
                            <li><a href="https://2013.igem.org/Team:Manchester/businessplan" id="link4">Business Plan</a></li>
                             <li><a href="https://2013.igem.org/Team:Manchester/Collaboration" id="link4">Modelling Collaboration</a></li>
                             <li><a href="https://2013.igem.org/Team:Manchester/Collaboration" id="link4">Modelling Collaboration</a></li>
                    <li><a href="https://2013.igem.org/Team:Manchester/KnowledgeDeficit" id="link4">Knowledge Deficit Assumption</a></li>
                    <li><a href="https://2013.igem.org/Team:Manchester/KnowledgeDeficit" id="link4">Knowledge Deficit Assumption</a></li>
Line 750: Line 772:
<ul class="menu">
<ul class="menu">
-
<li id="one"><a href="" onclick="blocking('text'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">14/06/2013 </span>  Making media</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">14/06/2013 </span>  Making media</a>
     <div id="text">        
     <div id="text">        
<p>
<p>
Line 761: Line 783:
</li>
</li>
 
 
-
<li id="one"><a href="" onclick="blocking('text1'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">19/06/2013</span>  Preparation of Chemically competent Cells</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text1'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">19/06/2013</span>  Preparation of Chemically competent Cells</a>
     <div id="text1">        
     <div id="text1">        
<p>
<p>
Line 792: Line 814:
</li>  
</li>  
                 
                 
-
<li id="one"><a href="" onclick="blocking('text2'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">20/06/2013</span> FadD Knock Out Part 1 </a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text2'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">20/06/2013</span> FadD Knock Out Part 1 </a>
     <div id="text2">        
     <div id="text2">        
<p>
<p>
Line 806: Line 828:
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text4'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">21/06/2013</span> Continued</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text4'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">21/06/2013</span> Continued</a>
     <div id="text4">        
     <div id="text4">        
<p>
<p>
Line 818: Line 840:
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text5'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">24/06/2013</span> Growing Cells From 21/06/2013 </a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text5'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">24/06/2013</span> Growing Cells From 21/06/2013 </a>
     <div id="text5">        
     <div id="text5">        
<p>
<p>
Line 828: Line 850:
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text6'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">25/06/2013</span> Electrically Competent Cells For Electroporation (E.Coli BL21 DE3) </a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text6'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">25/06/2013</span> Electrically Competent Cells For Electroporation (E.Coli BL21 DE3) </a>
     <div id="text6">        
     <div id="text6">        
<p>
<p>
Line 840: Line 862:
<p><i>Preparation of cells</i></p>
<p><i>Preparation of cells</i></p>
<p>At an OD of 0.6:</p>
<p>At an OD of 0.6:</p>
-
<p>Centrifuge 1: transfer the cultures to ice-cold centrifuge bottles. Harvest the cells by centrifugation at 2000g for 20 minutes at 4 ⁰C. Decant the supernantant and resuspend the cell pellet in 50 ml of ice-cold sterilised water.</p>
+
<p>Centrifuge 1: transfer the cultures to ice-cold centrifuge bottles. Harvest the cells by centrifugation at 2000g for 20 minutes at 4 ⁰C. Decant the supernatant and resuspend the cell pellet in 50 ml of ice-cold sterilised water.</p>
<p>Centrifuge 2: harvest the cells by centrifuge at 2000g for 20 minutes at 4⁰C. Decant the supernatant and resuspend the cell pellet in 20 ml ice-cold sterilised water</p>
<p>Centrifuge 2: harvest the cells by centrifuge at 2000g for 20 minutes at 4⁰C. Decant the supernatant and resuspend the cell pellet in 20 ml ice-cold sterilised water</p>
<p>Centrifuge 3: harvest the cells by centrifuge at 2000g for 20 minutes at 4⁰C . Decant the supernatant and resuspend the cell pellet in 1-2 ml ice-cold 10% glycerol.  
<p>Centrifuge 3: harvest the cells by centrifuge at 2000g for 20 minutes at 4⁰C . Decant the supernatant and resuspend the cell pellet in 1-2 ml ice-cold 10% glycerol.  
Line 848: Line 870:
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text7'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">26/06/2013 </span> Electroporation of PKD46 in E.Coli BL21 DE3 from 25/06/2013</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text7'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">26/06/2013 </span> Electroporation of PKD46 in E.Coli BL21 DE3 from 25/06/2013</a>
     <div id="text7">        
     <div id="text7">        
<p>
<p>
Line 862: Line 884:
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text8'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">27/06/2013</span> Transformation Results </a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text8'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">27/06/2013</span> Transformation Results </a>
     <div id="text8">        
     <div id="text8">        
<p>
<p>
Line 896: Line 918:
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text9'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">28/06/2013</span> Further selection of Transformed cells and verification </a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text9'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">28/06/2013</span> Further selection of Transformed cells and verification </a>
     <div id="text9">        
     <div id="text9">        
<p>
<p>
Line 904: Line 926:
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text10'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">01/07/2013</span> Continued </a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text10'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">01/07/2013</span> Continued </a>
-
     <div id="text10">      
+
     <div id="text10">
<p>
<p>
-
<p>WHAT IS THIS MATHS?</p>
+
<p>Overnight colonies of plated electroporated cells created. Incubated overnight at 30 C      
-
</p>
+
     </div>
     </div>
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text11'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">02/07/2013</span> Primer ordering </a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text11'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">02/07/2013</span> Primer ordering </a>
     <div id="text11">        
     <div id="text11">        
<p>
<p>
<p> Order for primers put in today. They were as follows:</p>
<p> Order for primers put in today. They were as follows:</p>
<p><i>H1catF</i></p>
<p><i>H1catF</i></p>
-
<p>5’<u>CCGTACATATAGTAAACCCCAACGCTACTGCTGCTTGTGCGTAAAATCTCCACTTCTT</u><i>TACCTCTTTTTTTAGTGACC</i> 3’</p>
+
<p>5’<u>CCGTACATATAGTAAACCCCAACGCTACTGCTGCTTGTGCGTAAAATCTCCACTTCTT</u><i>TACCTCTTTTTTTAGT<br>GACC</i> 3’</p>
<p><i>H1catR</i></p>
<p><i>H1catR</i></p>
-
<p>5’<u>CTCTTTAGTGGGCGTCAAAAAAAACGCCGGATTAACCGGCGTCTGACGACTGACTTAACACT</u><i>TTACGCCCCGCCCTGCC</i> 3’</p>
+
<p>5’<u>CTCTTTAGTGGGCGTCAAAAAAAACGCCGGATTAACCGGCGTCTGACGACTGACTTAACACT</u><i>TTACGCCCCGCCCT<br>GCC</i> 3’</p>
<p><i>VerF1</i></p>
<p><i>VerF1</i></p>
<p>5’ GGGTCGTCCACTAATACGGC 3’</p>
<p>5’ GGGTCGTCCACTAATACGGC 3’</p>
Line 929: Line 950:
<p>5’ GGGTTGTGGTAATTCGCC 3’</p>
<p>5’ GGGTTGTGGTAATTCGCC 3’</p>
<br>
<br>
-
<p><b>03/07/2013</b></p>
 
-
<p><b><i>WHAT IS THIS????</i></b></p>
 
</p>
</p>
     </div>
     </div>
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text12'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">04/07/2013</span> Induction of Lambda Red Recombinase & Electro-Competency of transformed cells</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text12'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">04/07/2013</span> Induction of Lambda Red Recombinase & Electro-Competency of transformed cells</a>
     <div id="text12">        
     <div id="text12">        
<p>
<p>
Line 949: Line 968:
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text13'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">09/07/2013</span> PCR of Chloramphenicol and Homologous regions </a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text13'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">09/07/2013</span> PCR of Chloramphenicol and Homologous regions </a>
     <div id="text13">        
     <div id="text13">        
<p>
<p>
Line 1,051: Line 1,070:
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text14'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">10/07/2013</span> Agarose Gel Electrophoresis of PCR product from 09/07</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text14'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">10/07/2013</span> Agarose Gel Electrophoresis of PCR product from 09/07</a>
     <div id="text14">        
     <div id="text14">        
<p>
<p>
Line 1,069: Line 1,088:
</li>    
</li>    
-
<li id="one"><a href="" onclick="blocking('text15'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">11/07/2013 </span> Received FAS Module - Plating up</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text15'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">11/07/2013 </span> Received FAS Module - Plating up</a>
     <div id="text15">        
     <div id="text15">        
<p>
<p>
Line 1,081: Line 1,100:
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text16'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">15/07/2013 </span> Stock of FAS cells for freezer</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text16'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">15/07/2013 </span> Stock of FAS cells for freezer</a>
     <div id="text16">        
     <div id="text16">        
<p>
<p>
Line 1,108: Line 1,127:
</li>    
</li>    
-
<li id="one"><a href="" onclick="blocking('text17'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">24/07/2013 </span> Knockout Take II PCR of Chloramphenicol (New primers)</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text17'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">24/07/2013 </span> Knockout Take II PCR of Chloramphenicol (New primers)</a>
     <div id="text17">        
     <div id="text17">        
<p>
<p>
Line 1,115: Line 1,134:
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text18'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">25/07/2013 </span> Knockout Take II PCR of Chloramphenicol (New primers)</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text18'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">25/07/2013 </span> Knockout Take II PCR of Chloramphenicol (New primers)</a>
     <div id="text18">        
     <div id="text18">        
<p><b>25/7/2013 - Results of PCR</b></p>
<p><b>25/7/2013 - Results of PCR</b></p>
Line 1,168: Line 1,187:
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text19'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">26/07/2013 </span> Chloramphenicol resistance gene extraction</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text19'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">26/07/2013 </span> Chloramphenicol resistance gene extraction</a>
     <div id="text19">        
     <div id="text19">        
<p>
<p>
Line 1,177: Line 1,196:
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text20'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">29/07/2013 </span> Knockout Take II PCR of Chloramphenicol (New primers)</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text20'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">29/07/2013 </span> Knockout Take II PCR of Chloramphenicol (New primers)</a>
     <div id="text20">
     <div id="text20">
<p>Want a 34 mg/ml stock in 100% ethanol: 0.34 g in 10 ml of ethanol</p>
<p>Want a 34 mg/ml stock in 100% ethanol: 0.34 g in 10 ml of ethanol</p>
Line 1,188: Line 1,207:
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text21'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">01/08/2013 </span> Making FAS module media</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text21'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">01/08/2013 </span> Making FAS module media</a>
     <div id="text21">
     <div id="text21">
<p>Due to the high levels of fatty acid production in bacteria containing the FAS module, a new media is required to keep the cells alive:</p>
<p>Due to the high levels of fatty acid production in bacteria containing the FAS module, a new media is required to keep the cells alive:</p>
Line 1,221: Line 1,240:
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text22'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">02/08/2013-05/08/2013 </span> Chloramphenicol PCRs</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text22'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">02/08/2013-05/08/2013 </span> Chloramphenicol PCRs</a>
     <div id="text22">
     <div id="text22">
<p> Repeated PCR described previously another two times, both failed. Discovered incorrect PCR settings. Repeated and got successful band:</p>
<p> Repeated PCR described previously another two times, both failed. Discovered incorrect PCR settings. Repeated and got successful band:</p>
Line 1,229: Line 1,248:
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text23'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">08/08/2013 </span> Cell growth curve NEED TO DO THIS TABLE</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text23'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">08/08/2013 </span> Cell growth curve</a>
     <div id="text23">
     <div id="text23">
-
<p><b>8/8/2013 - Cell growth curve NEED TO DO THIS TABLE</b></p>
+
<p><b>A cell growth curve was created in order to determine if FAS media gives better growth than normal LB media. It appeared to do so, but not significantly. Will repeat at a later date </b></p>
<br>
<br>
     </div>
     </div>
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text24'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">12/08/2013 </span> RBS Biobrick Hydration</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text24'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">12/08/2013 </span> RBS Biobrick Hydration</a>
     <div id="text24">
     <div id="text24">
<p>Hydrated 3 ribosomal binding site biobricks: BBa_B0034, BBa_B0034, BBa_B0032, and transformed into chemically competent NovaBlue cells. They were plated on LB-AMP plates</p>
<p>Hydrated 3 ribosomal binding site biobricks: BBa_B0034, BBa_B0034, BBa_B0032, and transformed into chemically competent NovaBlue cells. They were plated on LB-AMP plates</p>
Line 1,242: Line 1,261:
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text25'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">09/08/2013 </span> Primers recieved for FabA</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text25'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">09/08/2013 </span> Primers recieved for FabA</a>
     <div id="text25">
     <div id="text25">
<p><b>9/08/13 Primers recieved for FabA</b></p>
<p><b>9/08/13 Primers recieved for FabA</b></p>
Line 1,260: Line 1,279:
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text26'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">13/08/2013 </span> Finding the failure for the FadD knockout</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text26'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">13/08/2013 </span> Finding the failure for the FadD knockout</a>
     <div id="text26">
     <div id="text26">
<p>Agarose Gel for confirmation the presence of DNA in pKD46</p>
<p>Agarose Gel for confirmation the presence of DNA in pKD46</p>
<p>RESULT: Success</p>
<p>RESULT: Success</p>
 +
<center><img src="https://static.igem.org/mediawiki/2013/7/73/GEL1308.JPG" width="500" height="365" /></center>
<p>Conclusion: Electrocompetent cells are no longer competent</p>
<p>Conclusion: Electrocompetent cells are no longer competent</p>
<p><b>FadD knockout all over again</b></p>
<p><b>FadD knockout all over again</b></p>
<p>Result PCR of Chloramphenicol DNA</p><p>RESULT: Obtained the desired band. Non-template control was contaminated, showing a band same the chloramphenicol gene</p>
<p>Result PCR of Chloramphenicol DNA</p><p>RESULT: Obtained the desired band. Non-template control was contaminated, showing a band same the chloramphenicol gene</p>
 +
<center><img src="https://static.igem.org/mediawiki/2013/d/df/GEL1308B.JPG" width="500" height="365" /></center>
 +
     </div>
     </div>
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text27'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">14/08/2013 </span> Primers received</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text27'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">14/08/2013 </span> Primers received</a>
     <div id="text27">
     <div id="text27">
<p>Delta9_Rev</p>
<p>Delta9_Rev</p>
Line 1,352: Line 1,374:
<p>The samples were run on 2% gel</p>
<p>The samples were run on 2% gel</p>
<p> RESULT: Success</p>
<p> RESULT: Success</p>
 +
<center><img src="https://static.igem.org/mediawiki/2013/6/66/GEL1408.JPG" width="500" height="365" /></center>
 +
     </div>
     </div>
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text28'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">15/08/2013 </span> Result of FabA PCR of 14/8/13</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text28'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">15/08/2013 </span> Result of FabA PCR of 14/8/13</a>
     <div id="text28">
     <div id="text28">
-
<img src="" width="" height="" />
 
<p>RESULT: Successful. Band size 600bp</p>
<p>RESULT: Successful. Band size 600bp</p>
Line 1,365: Line 1,388:
<p>The restriction digest was performed at 50°C for an hour</p>
<p>The restriction digest was performed at 50°C for an hour</p>
<p>RESULT: Successful. Bands size were 400 and 200 bp respectively</p>  
<p>RESULT: Successful. Bands size were 400 and 200 bp respectively</p>  
 +
<center><img src="https://static.igem.org/mediawiki/2013/6/6f/GEL1508.JPG" width="500" height="365" /></center>
 +
<p> FadD knockout continued</p>  
<p> FadD knockout continued</p>  
Line 1,371: Line 1,396:
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text29'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">16/09/2013 </span> Induction of lamda red recombinase and making competent cells</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text29'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">16/09/2013 </span> Induction of lamda red recombinase and making competent cells</a>
     <div id="text29">    
     <div id="text29">    
<p>Followed the protocol as on 04/07/13</p>
<p>Followed the protocol as on 04/07/13</p>
Line 1,377: Line 1,402:
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text30'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">19/08/2013 </span> Electroporation of choramphenicol gene in BL21(DE) with lamda red</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text30'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">19/08/2013 </span> Electroporation of choramphenicol gene in BL21(DE) with lamda red</a>
     <div id="text30">
     <div id="text30">
<p>Followed the protcol as on 25/08/13</p>
<p>Followed the protcol as on 25/08/13</p>
Line 1,385: Line 1,410:
-
<li id="one"><a href="" onclick="blocking('text31'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">20/08/2013 </span> Electroporation of RBS Biobricks and RBS+ Constitutive promoter</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text31'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">20/08/2013 </span> Electroporation of RBS Biobricks and RBS+ Constitutive promoter</a>
     <div id="text31">
     <div id="text31">
We decided to use existing BioBrick parts for our Ribosomal Binding sites for FabA, Delta 9, Delta 12 - and also the RBS and promoter Biobrick. We intend on using the RBS+Promoter biobrick for expression of our FabA, Delta9 and Delta 12 genes in our lab work <br>
We decided to use existing BioBrick parts for our Ribosomal Binding sites for FabA, Delta 9, Delta 12 - and also the RBS and promoter Biobrick. We intend on using the RBS+Promoter biobrick for expression of our FabA, Delta9 and Delta 12 genes in our lab work <br>
Line 1,439: Line 1,464:
-
<li id="one"><a href="" onclick="blocking('text32'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">20/08/2013 </span> FabA PCR Products (from 15/08/2013) - Blunt End Ligation </a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text32'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">20/08/2013 </span> FabA PCR Products (from 15/08/2013) - Blunt End Ligation </a>
     <div id="text32">
     <div id="text32">
-
We performed a blunt end ligation on the FabA PCR Products from 15/08/2013 using the Thermo Scientific CloneJET PCR Cloing Kit, and transformed chemically competent NovaBlue Cells at 37 degrees celsius for 2 minutes. The cells were left to recover for 3 hours at 37 degress celcius and plated on appropriate antibiotic plates (LB + Ampicillin 100µg/ml) overnight at 37 degrees celcius. <br>
+
We performed a blunt end ligation on the FabA PCR Products from 15/08/2013 using the Thermo Scientific CloneJET PCR Cloning Kit, and transformed chemically competent NovaBlue Cells at 37 degrees celsius for 2 minutes. The cells were left to recover for 3 hours at 37 degress celcius and plated on appropriate antibiotic plates (LB + Ampicillin 100µg/ml) overnight at 37 degrees celcius. <br>
     </div>
     </div>
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text33'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">21/08/2013 </span> Growing up of FabA Clone Jet Transformed cells in media & Mini Prep</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text33'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">21/08/2013 </span> Growing up of FabA Clone Jet Transformed cells in media & Mini Prep</a>
     <div id="text33">
     <div id="text33">
<b>21/08/2013 - Growing up of FabA Clone Jet Transformed cells in media & Mini Prep performed </b><br>
<b>21/08/2013 - Growing up of FabA Clone Jet Transformed cells in media & Mini Prep performed </b><br>
Line 1,452: Line 1,477:
2.A miniprep was performed using Qiagen Miniprep Kit. <br>
2.A miniprep was performed using Qiagen Miniprep Kit. <br>
3. We completed a test digestion with ApoI, EcoR1 and Pst1 - same protocol as 15/08/13 confirming the identity of FabA His tag in the N Terminus<br>
3. We completed a test digestion with ApoI, EcoR1 and Pst1 - same protocol as 15/08/13 confirming the identity of FabA His tag in the N Terminus<br>
 +
<center><img src="https://static.igem.org/mediawiki/2013/c/c2/GEL2108.JPG" width="500" height="365" /></center>
 +
     </div>
     </div>
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text34'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">27/08/2013 </span> Transformation of Delta9 and Delta 12 synthesised plasmids</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text34'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">27/08/2013 </span> Transformation of Delta9 and Delta 12 synthesised plasmids</a>
     <div id="text34">  
     <div id="text34">  
-
1.The Delta 9 and Delta 12 Synthesised genes arrived, and were transformed using NEB High Efficiency DH5 alpha chemically competent cells. *37 Degress Celcius for 2 minutes* <br>
+
1.The Delta 9 and Delta 12 Synthesised genes arrived, and were transformed using NEB High Efficiency DH5 alpha chemically competent cells. *37 Degrees Celcius for 2 minutes* <br>
-
2. FabA Blunting reaction with CloneJet was repeated and also transformed with NEB DH5 alpha cells. *37 Degress Celcius for 2 minutes* <br>
+
2. FabA Blunting reaction with CloneJet was repeated and also transformed with NEB DH5 alpha cells. *37 Degrees Celcius for 2 minutes* <br>
3. All of the transformed cells were left to recover for 3 hours and then plated on appropriate LB plates<br>
3. All of the transformed cells were left to recover for 3 hours and then plated on appropriate LB plates<br>
     </div>
     </div>
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text35'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">28/08/2013 </span> Inoculation of LB + AMP with transformants from 27/08/2013 </a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text35'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">28/08/2013 </span> Inoculation of LB + AMP with transformants from 27/08/2013 </a>
     <div id="text35">
     <div id="text35">
<b> 28/08/2013 - Inoculation of LB + AMP with transformants from 27/08/2013 </b>  
<b> 28/08/2013 - Inoculation of LB + AMP with transformants from 27/08/2013 </b>  
Line 1,470: Line 1,497:
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text36'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">29/08/2013 </span> Miniprep of FabA, D9, D12</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text36'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">29/08/2013 </span> Miniprep of FabA, D9, D12</a>
     <div id="text36">
     <div id="text36">
1. Miniprep on the three grown up cell colonies from 28/08/2013 was carried out. <br>
1. Miniprep on the three grown up cell colonies from 28/08/2013 was carried out. <br>
2. Test digestion was completed with EcoR1 and Pst1 to confirm identity.<br>
2. Test digestion was completed with EcoR1 and Pst1 to confirm identity.<br>
 +
<center><img src="https://static.igem.org/mediawiki/2013/e/e5/GEL2908.jpeg" width="500" height="365" /></center>
3. Large scale overnight digestion was carried out with EcoR1 and Pst1 to obtain the DNA for Submission Vector and RBS + P biobrick ligation for experimental work. <br>
3. Large scale overnight digestion was carried out with EcoR1 and Pst1 to obtain the DNA for Submission Vector and RBS + P biobrick ligation for experimental work. <br>
 +
     </div>
     </div>
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text37'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">03/09/2013  </span> Transformation of NEB-5a with BBA_K608002</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text37'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">03/09/2013  </span> Transformation of NEB-5a with BBA_K608002</a>
     <div id="text37">
     <div id="text37">
<b> 03/09/2013 - Transformation of NEB-5a with BBA_K608002. </b> <br>
<b> 03/09/2013 - Transformation of NEB-5a with BBA_K608002. </b> <br>
Line 1,486: Line 1,515:
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text38'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">05/09/2013 </span> Miniprep of Colonies in LB from 04/09/2013 and digestion</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text38'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">05/09/2013 </span> Miniprep of Colonies in LB from 04/09/2013 and digestion</a>
     <div id="text38">
     <div id="text38">
1. A Miniprep was carried out using the Qiagen MiniPrep Kit <br>
1. A Miniprep was carried out using the Qiagen MiniPrep Kit <br>
2. A digestion using EcoR1 and Pst1 was completed on the BioBrick Vector to linearise the fragment for ligation with D9/D12 and FabA  and gel ran to confirm the correct size fragments were obtained. Result - Success. <br>  
2. A digestion using EcoR1 and Pst1 was completed on the BioBrick Vector to linearise the fragment for ligation with D9/D12 and FabA  and gel ran to confirm the correct size fragments were obtained. Result - Success. <br>  
 +
 +
<center><img src="https://static.igem.org/mediawiki/2013/e/ed/GEL0609.JPG" width="500" height="365" /></center>
 +
     </div>
     </div>
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text39'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">06/09/2013 </span> Gel Extraction of digested BBa_K608002 (RBS + P) from 05/09/2013</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text39'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">06/09/2013 </span> Gel Extraction of digested BBa_K608002 (RBS + P) from 05/09/2013</a>
     <div id="text39">
     <div id="text39">
Products from digestion from 05/09/2013 were run on a Gel and Extracted using the Qiagen QiaQuick Gel Extraction Kit. The Elution buffer used was heated to 40 degrees celsius to improve eluted DNA concentration. <br>
Products from digestion from 05/09/2013 were run on a Gel and Extracted using the Qiagen QiaQuick Gel Extraction Kit. The Elution buffer used was heated to 40 degrees celsius to improve eluted DNA concentration. <br>
Line 1,499: Line 1,531:
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text40'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">09/09/2013 </span> Gel Extraction of digestion products from 29/08/2013</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text40'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">09/09/2013 </span> Gel Extraction of digestion products from 29/08/2013</a>
     <div id="text40">
     <div id="text40">
1. A gel was run with the products from the digestion on 29/08/2013 to confirm the size of the required products<br>
1. A gel was run with the products from the digestion on 29/08/2013 to confirm the size of the required products<br>
 +
<center><img src="https://static.igem.org/mediawiki/2013/a/a0/GEL0909.JPG" width="500" height="365" /></center>
 +
2. A gel extraction was then performed to extract the D9, D12, FabA fragments using the Qiagen Qiaquick Gel Extraction kit.<br>
2. A gel extraction was then performed to extract the D9, D12, FabA fragments using the Qiagen Qiaquick Gel Extraction kit.<br>
<br>
<br>
Line 1,507: Line 1,541:
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text41'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">12/09/2013 </span> Ligation of D9, D12, FabA into Submission Vector</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text41'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">12/09/2013 </span> Ligation of D9, D12, FabA into Submission Vector</a>
     <div id="text41">
     <div id="text41">
The Extracted products from 09/02/2013 and digested Submission Vectors were ligated using NEB T4 DNA Ligase protocol. 2ul of ligation mix was used to transform NEB-5 alpha cells <br>
The Extracted products from 09/02/2013 and digested Submission Vectors were ligated using NEB T4 DNA Ligase protocol. 2ul of ligation mix was used to transform NEB-5 alpha cells <br>
 +
<center><img src="https://static.igem.org/mediawiki/2013/d/dc/GEL1209.JPG" width="500" height="365" /></center>
<br>
<br>
     </div>
     </div>
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text42'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">13/09/2013 </span> Test digestion of Submission vector with D9, D12</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text42'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">13/09/2013 </span> Test digestion of Submission vector with D9, D12</a>
     <div id="text42">
     <div id="text42">
Following Ligation of 09/0/2013 a test digestion was carried out as a preliminary method of confirming the constructs produced.<br>
Following Ligation of 09/0/2013 a test digestion was carried out as a preliminary method of confirming the constructs produced.<br>
Line 1,520: Line 1,555:
2. D12+SUBMISSION VECTOR  was Digestions with BamHI and Pvu1 - Failed digestion, this was a result of the wrong Enzyme buffer used.<br>
2. D12+SUBMISSION VECTOR  was Digestions with BamHI and Pvu1 - Failed digestion, this was a result of the wrong Enzyme buffer used.<br>
3. D12+SUBMISSION VECTOR Digestion repeated  with correct restriction enzyme buffers and new restriction enzymes (BamHI, EcoR1, Pst1 )and gel repeated - Gel confirmed correct fragment size, Success. <br>
3. D12+SUBMISSION VECTOR Digestion repeated  with correct restriction enzyme buffers and new restriction enzymes (BamHI, EcoR1, Pst1 )and gel repeated - Gel confirmed correct fragment size, Success. <br>
 +
<center><img src="https://static.igem.org/mediawiki/2013/0/0a/GEL1309.jpeg" width="500" height="365" /></center>
 +
4. As our Submission Vectors with D9 and D12 constructs appeared to be present these plasmids were sent for sequencing with the iGEM Verification primers. <br>
4. As our Submission Vectors with D9 and D12 constructs appeared to be present these plasmids were sent for sequencing with the iGEM Verification primers. <br>
     </div>
     </div>
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text43'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">20/09/2013 </span> FabA test digestion</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text43'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">20/09/2013 </span> FabA test digestion</a>
     <div id="text43">
     <div id="text43">
1. NEB Enzymes EcoRV and Pst1 were used to digest the FabA and submission vector ligation from 13/09/2013 - Results proved this to be successful. <br>
1. NEB Enzymes EcoRV and Pst1 were used to digest the FabA and submission vector ligation from 13/09/2013 - Results proved this to be successful. <br>
 +
<center><img src="https://static.igem.org/mediawiki/2013/7/77/GEL2009.jpeg" width="500" height="365" /></center>
 +
2. FabA construct sent for sequencing <br>
2. FabA construct sent for sequencing <br>
     </div>
     </div>
</li>
</li>
-
<li id="one"><a href="" onclick="blocking('text44'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">22/09/2013 </span> Ligation of Into RBS + P (BBa_K608002) vector from 05/09/2013</a>
+
<li id="one"><a id="mlink" href="" onclick="blocking('text44'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">22/09/2013 </span> Ligation of Into RBS + P (BBa_K608002) vector from 05/09/2013</a>
     <div id="text44">
     <div id="text44">
The extracted delta 9, 12 and fabA products from 09/09/2013 were ligated into the RBS + P biobrick vectors and then transformed into NEB-5 alpha cells for expression in the laboratory experiments. <br>
The extracted delta 9, 12 and fabA products from 09/09/2013 were ligated into the RBS + P biobrick vectors and then transformed into NEB-5 alpha cells for expression in the laboratory experiments. <br>
Line 1,539: Line 1,578:
(D12 - BamHI, Pst1, Xba1) -> Success<br>
(D12 - BamHI, Pst1, Xba1) -> Success<br>
(FabA - EcoRV and Pst1) -> Success <br>
(FabA - EcoRV and Pst1) -> Success <br>
 +
<center><img src="https://static.igem.org/mediawiki/2013/b/b9/GEL2309.JPG" width="500" height="365" /></center>
 +
Samples sent to LC-MS for characterisation
Samples sent to LC-MS for characterisation
 +
    </div>
 +
</li>
 +
 +
<li id="one"><a id="mlink2" href="" onclick="blocking('text45'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">23/09/2013-03/10/2013 </span> Characterisation</a>
 +
    <div id="text45">
 +
Orbitrap LC-MS was carried out on the samples for analysis. For complete detail, click <a href="https://static.igem.org/mediawiki/2013/6/6d/MancLCMS.pdf" target="_blank">here</a>
     </div>
     </div>
</li>
</li>

Latest revision as of 13:33, 26 October 2013

Top

Safety