Team:UCLA/Notebook/Biobrick

From 2013.igem.org

(Difference between revisions)
Line 75: Line 75:
<h4>PCR to generate fragments of <i>mtd</i></h4>
<h4>PCR to generate fragments of <i>mtd</i></h4>
<p>In this step, four separate fragments of the <i>mtd</i> gene are created via PCR. This step is necessary to eliminate illegal internal biobrick sites (EcoRI, PstI, NotI) and to add necessary biobrick sites to the 5' and 3' ends.</p>
<p>In this step, four separate fragments of the <i>mtd</i> gene are created via PCR. This step is necessary to eliminate illegal internal biobrick sites (EcoRI, PstI, NotI) and to add necessary biobrick sites to the 5' and 3' ends.</p>
 +
 +
<html>
 +
<!-- Row Highlight Javascript -->
 +
<script type="text/javascript">
 +
window.onload=function(){
 +
var tfrow = document.getElementById('tfhover').rows.length;
 +
var tbRow=[];
 +
for (var i=1;i<tfrow;i++) {
 +
tbRow[i]=document.getElementById('tfhover').rows[i];
 +
tbRow[i].onmouseover = function(){
 +
  this.style.backgroundColor = '#ffffff';
 +
};
 +
tbRow[i].onmouseout = function() {
 +
  this.style.backgroundColor = '#d4e3e5';
 +
};
 +
}
 +
};
 +
</script>
 +
 +
<style type="text/css">
 +
table.tftable {font-size:12px;color:#333333;width:100%;border-width: 1px;border-color: #729ea5;border-collapse: collapse;}
 +
table.tftable th {font-size:12px;background-color:#acc8cc;border-width: 1px;padding: 8px;border-style: solid;border-color: #729ea5;text-align:left;}
 +
table.tftable tr {background-color:#d4e3e5;}
 +
table.tftable td {font-size:12px;border-width: 1px;padding: 8px;border-style: solid;border-color: #729ea5;}
 +
</style>
 +
 +
<table id="tfhover" class="tftable" border="1">
 +
<tr><th>Fragment</th><th>Forward Primer</th><th>Reverse Primer</th></tr>
 +
<tr><td>1</td><td>CCTTGAATTCGCGGCCGCATCTAGAATGAGTACCGCAGTCCAGTTCCG</td><td>GCCTGCGCTGCCGCGTTGCTTCC</td></tr>
 +
<tr><td>2</td><td>GGAAGCAACGCGGCAGCGCAGGC</td><td>CCAGCGCCTGGAACTCGTTGTAGTTGGGCAGG</td></tr>
 +
<tr><td>3</td><td>CCTGCCCAACTACAACGAGTTCCAGGCGCTGG</td><td>CCGATCCGCGGCCTCCAGTGTTGG
 +
</td></tr>
 +
<tr><td>4</td><td>CCAACACTGGAGGCCGCGGATCGG
 +
</td><td>AAGGCTGCAGCGGCCGCTACTAGTCTCAAGAATCAGG</td></tr>
 +
</table>
 +
 +
<p><small>Created with the <a href="http://www.textfixer.com/html/html-table-generator.php" target="_blank">HTML Table Generator</a></small></p>
 +
</html>

Revision as of 21:57, 27 September 2013




Making the Mtd Biobrick

To create this biobrick, we utilized a combination of splicing overlap extension PCR and Gibson Assembly to extract a sequence from the BPP-1 phage's genomic DNA that would be free of the standard biobrick restriction enzyme sites. The protocols for those methods are listed below:

PCR to generate fragments of mtd

In this step, four separate fragments of the mtd gene are created via PCR. This step is necessary to eliminate illegal internal biobrick sites (EcoRI, PstI, NotI) and to add necessary biobrick sites to the 5' and 3' ends.

FragmentForward PrimerReverse Primer
1CCTTGAATTCGCGGCCGCATCTAGAATGAGTACCGCAGTCCAGTTCCGGCCTGCGCTGCCGCGTTGCTTCC
2GGAAGCAACGCGGCAGCGCAGGCCCAGCGCCTGGAACTCGTTGTAGTTGGGCAGG
3CCTGCCCAACTACAACGAGTTCCAGGCGCTGGCCGATCCGCGGCCTCCAGTGTTGG
4CCAACACTGGAGGCCGCGGATCGG AAGGCTGCAGCGGCCGCTACTAGTCTCAAGAATCAGG

Created with the HTML Table Generator

Retrieved from "http://2013.igem.org/Team:UCLA/Notebook/Biobrick"