"
Team:UCLA/Notebook/Biobrick
From 2013.igem.org
(Difference between revisions)
Michaelc1618 (Talk | contribs) |
Michaelc1618 (Talk | contribs) |
||
| Line 109: | Line 109: | ||
<tr><td>4</td><td>CCAACACTGGAGGCCGCGGATCGG | <tr><td>4</td><td>CCAACACTGGAGGCCGCGGATCGG | ||
</td><td>AAGGCTGCAGCGGCCGCTACTAGTCTCAAGAATCAGG</td></tr> | </td><td>AAGGCTGCAGCGGCCGCTACTAGTCTCAAGAATCAGG</td></tr> | ||
| + | </table> | ||
| + | |||
| + | </html> | ||
| + | |||
| + | <br><br> | ||
| + | <p>The 20 µL PCR mix for each fragment is as follows: </p> | ||
| + | |||
| + | <html> | ||
| + | <!-- Row Highlight Javascript --> | ||
| + | <script type="text/javascript"> | ||
| + | window.onload=function(){ | ||
| + | var tfrow = document.getElementById('tfhover').rows.length; | ||
| + | var tbRow=[]; | ||
| + | for (var i=1;i<tfrow;i++) { | ||
| + | tbRow[i]=document.getElementById('tfhover').rows[i]; | ||
| + | tbRow[i].onmouseover = function(){ | ||
| + | this.style.backgroundColor = '#ffffff'; | ||
| + | }; | ||
| + | tbRow[i].onmouseout = function() { | ||
| + | this.style.backgroundColor = '#d4e3e5'; | ||
| + | }; | ||
| + | } | ||
| + | }; | ||
| + | </script> | ||
| + | |||
| + | <style type="text/css"> | ||
| + | table.tftable {font-size:12px;color:#333333;width:100%;border-width: 1px;border-color: #729ea5;border-collapse: collapse;} | ||
| + | table.tftable th {font-size:12px;background-color:#acc8cc;border-width: 1px;padding: 8px;border-style: solid;border-color: #729ea5;text-align:left;} | ||
| + | table.tftable tr {background-color:#d4e3e5;} | ||
| + | table.tftable td {font-size:12px;border-width: 1px;padding: 8px;border-style: solid;border-color: #729ea5;} | ||
| + | </style> | ||
| + | |||
| + | <table id="tfhover" class="tftable" border="1"> | ||
| + | <tr><th>Reagent</th><th>Volume</th></tr> | ||
| + | <tr><td><i>mtd</i> genomic template</td><td>1.0 µL (4.5 ng total)</td></tr> | ||
| + | <tr><td>10 µM forward primer</td><td>1.0 µL</td></tr> | ||
| + | <tr><td>10 µM reverse primer</td><td>1.0 µL</td></tr> | ||
| + | <tr><td>10 mM dNTPs</td><td>0.4 µL</td></tr> | ||
| + | <tr><td>Buffer HF</td><td>4.0 µL</td></tr> | ||
| + | <tr><td>Phusion Polymerase</td><td>0.2 µL</td></tr> | ||
| + | <tr><td>ddH<sub>2</sub>O</td><td>12.4 µL</td></tr> | ||
</table> | </table> | ||
<p><small>Created with the <a href="http://www.textfixer.com/html/html-table-generator.php" target="_blank">HTML Table Generator</a></small></p> | <p><small>Created with the <a href="http://www.textfixer.com/html/html-table-generator.php" target="_blank">HTML Table Generator</a></small></p> | ||
</html> | </html> | ||
Revision as of 22:04, 27 September 2013
Making the Mtd Biobrick
To create this biobrick, we utilized a combination of splicing overlap extension PCR and Gibson Assembly to extract a sequence from the BPP-1 phage's genomic DNA that would be free of the standard biobrick restriction enzyme sites. The protocols for those methods are listed below:
PCR to generate fragments of mtd
In this step, four separate fragments of the mtd gene are created via PCR. This step is necessary to eliminate illegal internal biobrick sites (EcoRI, PstI, NotI) and to add necessary biobrick sites to the 5' and 3' ends.
| Fragment | Forward Primer | Reverse Primer |
|---|---|---|
| 1 | CCTTGAATTCGCGGCCGCATCTAGAATGAGTACCGCAGTCCAGTTCCG | GCCTGCGCTGCCGCGTTGCTTCC |
| 2 | GGAAGCAACGCGGCAGCGCAGGC | CCAGCGCCTGGAACTCGTTGTAGTTGGGCAGG |
| 3 | CCTGCCCAACTACAACGAGTTCCAGGCGCTGG | CCGATCCGCGGCCTCCAGTGTTGG |
| 4 | CCAACACTGGAGGCCGCGGATCGG | AAGGCTGCAGCGGCCGCTACTAGTCTCAAGAATCAGG |
The 20 µL PCR mix for each fragment is as follows:
| Reagent | Volume |
|---|---|
| mtd genomic template | 1.0 µL (4.5 ng total) |
| 10 µM forward primer | 1.0 µL |
| 10 µM reverse primer | 1.0 µL |
| 10 mM dNTPs | 0.4 µL |
| Buffer HF | 4.0 µL |
| Phusion Polymerase | 0.2 µL |
| ddH2O | 12.4 µL |
Created with the HTML Table Generator
