Team:Manchester/LabBook

1. Calculate amount of powder of LB agar or LB broth mix required in accordance with manufacturer's instructions

2. Add LB powder to distilled water (we used 10 g of LB-broth or LB agar to 400ml of water

3. Autoclave the flask ( Make sure you have the autoclave tape on with label)

4. Add any antibiotic if needed once the flask has sufficiently cooled (approx 50 degrees).

1. Grow the specific strain (BL21(DE3))on the plate. Plates will be in the incubator.

2. Select a colony from the plate with inoculating loop

3. The colony is dispersed in 100 ml LB broth in a conical flask.

4. The culture is left overnight- vigorous shaking at 37°C

Taking the OD of the grown culture

Want an OD of 0.1 in a culture volume of 100ml

Calculation:

V₁ x 3.2 = 100 x 0.1

V₁= 3.1 ml

96.9 ml [LB broth] + 3.1 ml [culture] = 100 ml culture with OD of 0.1

5. Take original OD volume of the culture (at 600 nm). Use LB as a blank. N.B: You need an OD less than 1.5 to measure the density accurately

6. Diluted culture is transferred to sterile flask. This is placed in shaking incubator at 37°C. After an hour, the OD is measured 15 minutes until it reaches the range of 0.4- 0.6

7. Centrifuge at 6000 xg for 10 min or 5500 xg for 15 min in 2 x 50 ml tubes.

8. Remove the supernatant from the tubes. Combine both the pellets and suspend in ice cold 0.1M CaCl₂

9. Leave the tube on ice for 30 min.

10. Spin cells at 6000 xg for 10 min or 5500 xg for 15 min and remove supernatant

11. Resuspend the pellet in 4 ml ice cold 0.1 CaCl2

12. Put on ice in cold room overnight

13. Add 1 ml sterile 100% glycerol

14. Make 50 µl aliquot and store at -80°C (after freezing with liquid nitrogen)

1) Incubate 50-100µl of competent cells with either 0.5-1 µl of commercial plasmid (pKD46: (Lambda Red Recombinase Plasmid)) or the same volume of water/ligation mixture (control). ~1.2µl of plasmid to 50µl of cells

2) Leave on ice for 30 minutes

3) Heat shock: 42 ºC in water bath for 45 seconds OR 37ºC heat block for 2 mins

4) Leave on ice for 5 minutes

5) Recover cells by adding 500µl of LB broth

6) Incubate at 37 ºC for 1-2 hours

7) Plate dilutions on agar containing appropriate antibiotic

Yesterday’s transformation failed. Today we tried the experiment following the protocol of 20/06 although cells were heat shocked at 37 ºC on a heat block for 2 minutes instead of 42 ºC in a water bath for 45 seconds.

50 µg/ml ampicillin agar plates mate. 0.75g of ampicillin added to 15 ml of 50% ethanol to create 50 mg/ml stock to be kept in -20 ºC freezer. 0.4ml of this stock added to 400 ml of LB-agar:

50 mg/ml x V₁ = 50 µg/ml x 400 ml

50000 µg x V₁ = 50 µg/ml x 400ml

V₁=0.4 ml (400 µl)

1) Colony selected with inoculating loop

2) Colony added to 100 ml LB broth

3) Colony left overnight in incubator at 37 ºC

Change of method for transformation

The pKD46 plasmid we are using has temperature sensitive replication. Heat shocking and incubating at 37 ºC is NOT an appropriate method for transformation. Electroporation will be used instead. The protocol for forming electrocompetent cells is as follows:

Preparation of stock

1. Add 1 ml of the overnight culture to the eppendorf tube.

2. Centrifuge the culture at 5000g for 10 minutes , harvest the cells.

3. Resuspend the cells in 1 ml of 10% glycerol in LB .

4. Store the cells at -80C.

Preparation of cells

At an OD of 0.6:

Centrifuge 1: transfer the cultures to ice-cold centrifuge bottles. Harvest the cells by centrifugation at 2000g for 20 minutes at 4 ⁰C. Decant the supernantant and resuspend the cell pellet in 50 ml of ice-cold sterilised water.

Centrifuge 2: harvest the cells by centrifuge at 2000g for 20 minutes at 4⁰C. Decant the supernatant and resuspend the cell pellet in 20 ml ice-cold sterilised water

Centrifuge 3: harvest the cells by centrifuge at 2000g for 20 minutes at 4⁰C . Decant the supernatant and resuspend the cell pellet in 1-2 ml ice-cold 10% glycerol. Store the cells at -80⁰C.

3 cuvettes prepared: each contained 50 µl of electrocompetent cells and either 1 µl of pKD46 plasmid, 5 µl of pKD46 plasmid or 5 µl of sterile H₂O. The following protocol was followed:

1) Place the cuvettes on ice and put the cells in them

2) Add the plasmid/water to the cuvettes, tapping to remove any air bubbles

3) Electroporate using electroporation machine on bacteria setting

4) Add 750 µl of super optimal broth (SOB) to each cuvette and carefully transfer to sterile 1.5 ml eppendorf tube

5) Recover the cells at 30 ºC for 2 hours

Cells were then plated on 50 µg/ml ampicillin plates (100 µl or 600 µl of culture) and LB only plates (100 µl of culture) and incubated at 30 ºC overnight

The following table shows the number of colony forming units (cfu) found on each plate. The number in brackets indicates number of colonies taken to be re-plated

Successful cultures from yesterday were re-plated

Overnight colonies of plated electroplated cells created. Incubated overnight at 30 C

Order for primers put in today. They were as follows:

H1catF

5’CCGTACATATAGTAAACCCCAACGCTACTGCTGCTTGTGCGTAAAATCTCCACTTCTTTACCTCTTTTTTTAGT
GACC 3’

H1catR

5’CTCTTTAGTGGGCGTCAAAAAAAACGCCGGATTAACCGGCGTCTGACGACTGACTTAACACTTTACGCCCCGCCCT
GCC 3’

VerF1

5’ GGGTCGTCCACTAATACGGC 3’

VerfadR

5’ GGTGCCGCCGGTGTATTGTTGCAG 3’

VercatR

5’ GTGTAGAAACTGCCGGAAATCG 3’

VerR1

5’ GGGTTGTGGTAATTCGCC 3’

For each batch of cells, 2 batches were prepared. Some were electrically induced, and others were not

1) 70 ml of LB broth added to 700 µl of overnight culture of induced and uninduced cells

2) Grow cultures at 30 ºC for 1 hour

3) Check and record the OD until it is in a range of 0.1-0.3

4) Add 400 µl of arabinose to 10 ml of culture from step 1 to get a final concentration of 0.2%

5) Grow the culture at 30 ºC for a further 2 hours

6) Check and record the OD value until it lies in a range 0.6-0.9

Creation of a dNTP stock

dNTPs initially come at 100 mM concentration. Working stock requires 10 mM concentration. This was made by adding 10 µl each of dATP, dGTP, dCTP and dTTP to 60 µl of water

Creation of a Master Mix

PCR Thermocyler Settings

Making The Gel

1% gel we require 1 g Agarose in 100 ml TAE. Therefore, 0.7% gel we require 0.7g agarose in 100 ml TAE

1. Microwave 1-3 min unless agarose is dissolved in TAE and rolling boil of mixture

2. Leave to cool 5 mins. Add 2 ul of Ethidium Bromide per 100 ml

3. Pour into casting plates with comb

4. Leave 10-15 mins at 4⁰C or 20 mins at room temperature

Result of PCR: FAILURE

2 vials of stab culture received from Prof Mattheos Koffas of the Rensselaer Polytechnic Institute, NY, USA (2x DH5α w/pETM6-CnFatB2-fabAH^*GI in Amp80

1 vial kept at 4 ºC and other vial plated on LB with Amp100

Left on bench for 3 hours and then placed in a 30 ºC incubator

Second plate, Amp 50µg/ml, plated w/DH5α w/pETM6-CnFatB2-fabAH^*GI and placed in 30 ºC incubator

Both plates removed and left on bench overnight

Successful growth found on the plates over the weekend. Stock made using the following protocol:

1) Make 10 ml of LB and 100 µg/ml of Ampicillin

2) Inoculate media with cells on plates w/FAS

3) Grow at 37 ºC for 5 hours

4) Spin cells down in centrifuge

5) Resuspend in 700 µl of LB and glycerol

18/07/2013: Growing up DH5α for plasmid extraction

1) 100 ml of LB w/100 µg/ml Ampicillin

2) Inoculate with cells

3) Leave to grow at 37 ºC overnight

18/07/2013: Extraction of FAS module

FAS module successfully extracted using plasmid purification kit

19/07/2013-24th July: New Primers

Found that the PCR from 9/7/2013 failed due to incorrect primers (H1catF and H2catR). New primers were ordered:

H1catF_2a

CGGCATGTATATCATTTGGGGTTGCGATGACGACGAACACGCATT

H1catR_2a

CTCTTTAGTGGGCGTCAAAAAAAACGCCGGATTAACCGGCGTCTG

PCR ran with new primers. To be on the safe side we ran a PCR gradient in order to find the best annealing temperature. A rough estimate of the optimum T_m was made using the T_m calculator on the NEB site

25/7/2013 - Results of PCR

Tuc01 strain of E. coli used for third attempt at fadD knockout

Method used was the QIAGEN method for genome extraction

Analysis using nanodrop: 480 ng/µl of DNA

Want a 34 mg/ml stock in 100% ethanol: 0.34 g in 10 ml of ethanol

Making a subculture of Tuc01 strain for DNA extraction:

1. Add 600 µl of Tuc01 in 5ml of Cm₁₀ and LB

2. Put the tube in 37 ºC shaking incubation

3. After 5 hours, transfer 1 ml from the tube to 9 ml LB Cm ₁₀

4. Culture overnight

Due to the high levels of fatty acid production in bacteria containing the FAS module, a new media is required to keep the cells alive:

1. Making the growth media (without Glucose stock)

10 g Yeast Extract

4 g (NH₄)2HPO₄ - Diammonium Phosphate

13.5 g KH2PO4 -Mono potassium phosphate

1.7 g Citric Acid

Dissolve in approx 300ml DI water, add more if required.

Send for Auto-Clave

*Also send water for autoclave as this will be required in the later step if there is not sufficient water autoclaved. You will need approx 700 ml water max

2. Making the glucose stock

20 g glucose dissolved in approx 100ml DI water, add more if required.

3. Prepare the trace metal stock

You will eventually add 10 ml of this stock, these volumes are required to make a 100 ml stock.

1.0 g FeSO₄.7H₂O

0.2 g CaCl₂

0.22 g ZnSO₄.7H₂O

0.05 g MnSO₄.4H₂O

0.1 g CuSO₄.5H₂O

0.01 g (NH₄)6Mo₇O₂4.4H₂O - Ammonium molybdate hydrate

0.002 g Na₂B₄O₇.10H₂O (BORAX) - Sodium Borate

4. Filter sterilisation of metal stock and glucose stock (separately)

5. Mix filtered stocks with autoclaved growth media.

6. Add NaOH to make to pH6.8

7. Make up to 1 Litre with sterilised water

Ran a gel of chloramphenicol resistance gene: successful band

However gel extraction failed: 5ng/ul, 280/260 of 6. Ran an overnight repeat PCR

Repeated PCR described previously another two times, both failed. Discovered incorrect PCR settings. Repeated and got successful band:

Performed PCR purification (QIAGEN). Resulted in 16.9ng/ul of DNA. Electroporated cells and plated. Cells failed to grow

A cell growth curve was created in order to determine if FAS media gives better growth than normal LB media. It appeared to do so, but not significantly. Will repeat at a later date

Hydrated 3 ribosomal binding site biobricks: BBa_B0034, BBa_B0034, BBa_B0032, and transformed into chemically competent NovaBlue cells. They were plated on LB-AMP plates

9/08/13 Primers recieved for FabA

FabA_Fwd_EcoRI

CTAGTAGAATTCATGGTAGATAAACGCGAATCCT

FabA_Rev_Spe1

CTAGTACTGCAGTTATTAGAAGGCAGACGTATCCTGG

FabA_Fwd_Prefix

GAATTCGCGGCCGCTTCTAGATGGTAGATAAACGCGAATCCT

FabA_Rev_Suffix

CTGCAGCGGCCGCTACTAGTATTATTAGAAGGCAGACGTATCCTG

FabA_Fwd_Prefix_N-His

GAATTCGCGGCCGCTTCTAGATGCATCATCACCACCACCATGTAGATAAACGCGAATCCT

CTGCAGCGGCCGCTACTAGTATTATTAATGGTGGTGGTGATGATGGAAGGCAGACGTATCCTGG

Agarose Gel for confirmation the presence of DNA in pKD46

RESULT: Success

Conclusion: Electrocompetent cells are no longer competent

FadD knockout all over again

Result PCR of Chloramphenicol DNA

RESULT: Obtained the desired band. Non-template control was contaminated, showing a band same the chloramphenicol gene

Delta9_Rev

CTGCAGCGGCCGCTACTAGTATTATTAGGCTTTGTTGGCCATCGCAGTT (49)

Delta12_Rev

CTGCAGCGGCCGCTACTAGTATTATTAAACTTTTTTCAGGGAGCCGAAG (49)

Delta9 & Delta12_F

GAATTCGCGGCCGCTTCTA (19)

sSB1C3_VF2

TGCCACCTGACGTCTAAGAA (20)

sSB1C3_VR

ATTACCGCCTTTGAGTGAGC (20)

FabA_Fwd

TGGTAGATAAACGCGAATCCT (21)

FabA_Rev

TTATTAGAAGGCAGACGTATCCTGG (25)

PCR for FabA

A full scale 3 hour PCR was run after the confirmation of the product. The primers used in this PCR contained His-tags.

FadD knockout Continued

Transforming pKD46 in BL21(DE3)

1.Overnight culture at 30°C

2.Measure the OD₆₀₀. It was in the range of 0-0-1

3.Keep in 30°C shaking incubator for 2 hrs

4.Measure the OD again and were in the range of 0.2-0.6

5.Store in 4°C

6.Follow the protocol for making the cells Electrocompetent as on 25/6/13

DNA precipitation of chloramphenicol gene product on 13/8/13

Ethanol precipitation

1. 2 volumes absolute ethanol (ice cold) and 1/10 volumes sodium acetate (pH 5.2)

2. Keep for an hour at -80°C

3. Centrifuge at 5417 rpm for 30 minutes at 4°C

4. Wash with 70% ethanol

5. Repeat the centrifuge as step 3

6. Nanodrop was performed scaling up to 52 ng/ul

Restriction digest of chloramphenicol gene

The restriction digestion was performed using the enzyme EcoRI.

The samples were run on 2% gel

RESULT: Success

RESULT: Successful. Band size 600bp

FabA restriction digestion

Enzyme used Apo1

The restriction digest was performed at 50°C for an hour

RESULT: Successful. Bands size were 400 and 200 bp respectively

FadD knockout continued

Followed the protocol as on 25/08/13

Followed the protocol as on 04/07/13

Followed the protcol as on 25/08/13

RESULT: FadD knockout failed.