"
Team:UC Chile/Team Members
From 2013.igem.org
(Difference between revisions)
| Line 17: | Line 17: | ||
<img src="https://static.igem.org/mediawiki/2013/6/61/Team_UC_Chile_ALL_Header.png" usemap="#fotoMap" id="foto" border="0"> | <img src="https://static.igem.org/mediawiki/2013/6/61/Team_UC_Chile_ALL_Header.png" usemap="#fotoMap" id="foto" border="0"> | ||
<map name="fotoMap"> | <map name="fotoMap"> | ||
| - | <area shape=" | + | <area shape="poly" coords="953,302,953,290,949,282,954,274,952,268,956,261,937,258,914,252,894,241,884,227,883,214,888,201,899,191,915,184,932,178,946,177,961,176,972,177,985,180,1000,186,1013,196,1023,206,1025,224,1019,237,1007,246,993,251,983,256,991,261,997,267,1003,266,999,276,1002,284,999,294,1002,303,993,307,984,315,978,316,968,318,966,311,958,307,953,302" href="https://2013.igem.org/Team:UC_Chile/The Game"> |
| - | + | ||
</map> | </map> | ||
<div id="MENU"><!--Inicio de MENU--> | <div id="MENU"><!--Inicio de MENU--> | ||
Revision as of 21:50, 26 September 2013
Team Members
Magdalena Ribbeck
XX - ATGGCAGGCGATGCACTGGAAAACGCA AGAATTTAATAAGAGTGTAAG
| Occupation | : | Civil Engineer in Biotechnology. |
| iGEM | : | Videogame realization and lab work. |
| Likes to | : | Write, read about psychology, to draw and to practice Judo. |
| Frustrated Dream | : | To be a writer. |
| Fun fact | : | Reads “Origin of species”, Charles Darwin, for fun. |
| Lab mistake | : | Spill chloroform on Valentina. |
Valentina Frenkel
XX - GTCGCCCTTGAGAACACAATTAATGCC TTCAGAGAGAATAAAGAGCTC
| Occupation | : | Civil Engineer in Biotechnology. |
| iGEM | : | Primer design. Wiki and videogame development. Lab work. |
| Likes to | : | Draw, watch anime and series, play Lucas arts games (Monkey island, Grim fandango, Full throttle, etc) and Pokemon. |
| Frustrated Dream | : | To be able to do better illustrations and play an instrument professionally. |
| Fun fact | : | She does not believe in photographs, she thinks she can get a better capture of the essence of people through her cute drawings. |
| Lab mistake | : | Use the whole stock pHnCBS1D instead of the dilution. |
Felipe Ignacio Erices Canales
XY - TTTGAGCTTATACCCGAG GAAAGAATTTGTGAGTCT
| Occupation | : | Civil Engineer in Biotechnology. |
| iGEM | : | Human translator to 1&0 and hunter of optimal sequences. Wiki programing and lab work. |
| Likes to | : | Do sports, eat pineapple and corn pizza, random Youtube videos, eat Inca Gold, share food, solve puzzles and do origami. |
| Frustrated Dream | : | Not to be ignored, try to keep the lab neat and be able to hibernate. |
| Fun fact | : | He can split an apple in half just with his hands. |
| Lab mistake | : | Run an important gel without the ladder. |
Ilenne Del Valle.
XX - ATACTTGAAAACAACGAG GATGAATTG GTAGCGTTGCTAGAA
| Occupation | : | Biochemist |
| iGEM | : | Prevention of future complications. Lab work organization and administration. Experimental design. |
| Likes to | : | Practice Judo and read. |
| Frustrated Dream | : | That the iGEM team doesn’t think that she is sending the emails while angry at them. |
| Fun fact | : | She has a really high rate of paper reading. She did an exchange program in US. She suffers for being the only vegetarian in a carnivorous group. |
| Lab mistake | : | Break a huge ellermeyer flask the very first day in the lab and in front of the boss. |
Josefina Philippi
XX - TAATAAAGCGAATTTATAAACGCG CCACACATCCTGATACCTCCAATA
| Occupation | : | Economist and Biologist. |
| iGEM | : | Team’s boss. Bureaucratics and lab experiment management. |
| Likes to | : | Cook, sitcom series, "The Little Prince" and the beach. |
| Frustrated Dream | : | To be a good singer. |
| Fun fact | : | She makes the lab explode with dry ice. |
| Lab mistake | : | Make a high concentrated RedGel Agarose and stain Lab notebook with chloroform. |
Sebastián Álvarez
XY - AGCGAGTAAGCGTCTACTATTGCCAAT GCGTTGGTGGCCAGGGAGTAA
| Occupation | : | Biologist. |
| iGEM | : | More that he can handle, but not enough to get credit for it. |
| Likes to | : | Swim (male marmaid aka marman), eat sushi, the amazing word of science fiction with authors like Isaac Asimov, comedy and staff. |
| Frustrated Dream | : | To grow a majestic beard, the manliest ever seen. |
| Fun fact | : | He won a masculinity contest of napkin folding and burnt a part of his hair trying to hear fire. |
| Lab mistake | : | Leave the centrifuge working with no tubes inside … all night long. |
Javier Cillero
XY - TAAGCAGTTATTGAAAGG TGCATCCTACTTGAGCGCTAA
| Occupation | : | Biologist. |
| iGEM | : | Lab work and experimental design. |
| Likes to | : | Play soccer, go to the stadium, walk under the rain and feel like a fish. |
| Frustrated Dream | : | To be a soccer player and be able to play any instrument. |
| Fun fact | : | He can make cigarette smoke rings. Has a collection of beer cans, USA, prepare!. |
| Lab mistake | : | He told us “I’m immune to those mistakes … noobies”. The next day he dropped ALL THE IMPORTANT TUBES, that took us months to do, and broke the containing box. |
Belén Céspedes
XX - TAAGAGTTAGAAAAC TGCGAATCTCCCGAGGACGAGAGT
| Occupation | : | Physicist. |
| iGEM | : | Mathematical modelling, Human Practices and paper traffic. |
| Likes to | : | Play with animals and plants, eat deserts and collect stuff. Drink Quatro Guaraná. |
| Frustrated Dream | : | To make a sound biosensor and cure the world from Malaria. Join Cirque du Soleil. |
| Fun fact | : | She can talk with animals, juggles and rides a monocycle. She’s allergic to everything. |
| Lab mistake | : | She transplant the Nicotianas and change the order of the plants so, we didn’t know which plants had the GFP. We had to redo all genomic extraction. |
Manuel Álamo
XY - ATGGCCAACTAAGAGTTG GCACTCGCCATGTAA
| Occupation | : | Physicist. |
| iGEM | : | Mathematical modeling and Human Practice organization. |
| Likes to | : | Argue and annoy. Watch Slam Dunk and Captain Tsubasa, drink “mate” and read about politics. |
| Frustrated Dream | : | Have a good voice, be able to draw, recognize colors, have good eyesight and more time. |
| Fun fact | : | Not a funny guy. |
| Lab mistake | : | Nobody knows how he made a gel that didn’t solidify. |
