"
Team:Hong Kong HKU/project/surface
From 2013.igem.org
(Difference between revisions)
SamsonWlsh (Talk | contribs) |
SamsonWlsh (Talk | contribs) |
||
| Line 41: | Line 41: | ||
The inner structure of bacteria could be quite complicated, despite its small size. The organization of the bacterial cell is a crucial element in the function of biosynthetic and metabolic pathways. It has been documented that bacteria can also have compartmentalization, known as</font> <font face="century gothic" size="3" color="red">bacterial microcompartments (MCP).</font> | The inner structure of bacteria could be quite complicated, despite its small size. The organization of the bacterial cell is a crucial element in the function of biosynthetic and metabolic pathways. It has been documented that bacteria can also have compartmentalization, known as</font> <font face="century gothic" size="3" color="red">bacterial microcompartments (MCP).</font> | ||
<br><br> | <br><br> | ||
| - | Bacterial MCP, unlike the lipid vesicular organelles of eukaryotes, are formed by proteins, enclosing enzymes and cofactors for carbon fixation or various forms of fermentative metabolism. A prominent example of bacterial microcompartment is the caryboxysome, which packages the enzyme ribulose bis-phosphate carboxylase oxygenase (RuBisCo) by forming polyhedral bodies with a diameter of 80-140 nm. Similar microcompartments build from related shell-forming proteins, the eut and pdu organelles, also package enzymes involved in metabolic reactions.<br><br> | + | <font face="century gothic" size="3">Bacterial MCP, unlike the lipid vesicular organelles of eukaryotes, are formed by proteins, enclosing enzymes and cofactors for carbon fixation or various forms of fermentative metabolism. A prominent example of bacterial microcompartment is the caryboxysome, which packages the enzyme ribulose bis-phosphate carboxylase oxygenase (RuBisCo) by forming polyhedral bodies with a diameter of 80-140 nm. Similar microcompartments build from related shell-forming proteins, the eut and pdu organelles, also package enzymes involved in metabolic reactions.<br><br> |
</font> | </font> | ||
<img src="https://static.igem.org/mediawiki/parts/8/8d/Diffmcp.png" width="400px" height=auto><br><br> | <img src="https://static.igem.org/mediawiki/parts/8/8d/Diffmcp.png" width="400px" height=auto><br><br> | ||
Revision as of 20:39, 27 September 2013
Micro-compartment
A Nano-Bioreactor inside a Bacterial Cell
The inner structure of bacteria could be quite complicated, despite its small size. The organization of the bacterial cell is a crucial element in the function of biosynthetic and metabolic pathways. It has been documented that bacteria can also have compartmentalization, known as bacterial microcompartments (MCP).
Bacterial MCP, unlike the lipid vesicular organelles of eukaryotes, are formed by proteins, enclosing enzymes and cofactors for carbon fixation or various forms of fermentative metabolism. A prominent example of bacterial microcompartment is the caryboxysome, which packages the enzyme ribulose bis-phosphate carboxylase oxygenase (RuBisCo) by forming polyhedral bodies with a diameter of 80-140 nm. Similar microcompartments build from related shell-forming proteins, the eut and pdu organelles, also package enzymes involved in metabolic reactions.
EUT Microcompartment
Both recombinant Salmonella enterica ethanolamine utilization (Eut) and propanediol utilization (Pdu) bacterial MCPs can be expressed heterologously in E.coli, with and without the associated interior enzymes. Noticing Team from the University of Minnesota in 2010 successfully cloned the Eut shell protein genes: EutS, M, N, L, K from Salmonella enterica LT2 and expressed in E. coli. We chose to work based on their contribution and utilize the Eut MCP biobrick they submitted (BBa_K311004).
Localizing PPK1 into MCP
It had been demonstrated that signal sequences at the N-terminus of MCP associated enzymes are capable of causing their compartmentalization inside shells. For Eut MCP, the sequence of 19 amino acids at the N-terminus of EutC has been showed to serve as this function, localizing the signal fused protein into the MCP. In order to localize the PPK1 to the inside of our recombinant Eut BMCs, we will construct a PPK1 fused with this N-terminal targeting sequence and co-transformed in E.coli alongside the Eut SMNLK expression cassette.
The nucleotide sequence of the signal peptide is
ATGGATCAAAAACAGATTGAAGAAATTGTACGTAGCGTGATGGCGTCAATGGGACAG.
And its corresponsing 19 amino acid is
MDQKQIEEIVRSVMASMGQ.
By localizing only PPK1 into the MCP, the engineered MCP is expected to form a sink for phosphate in the system which after normal metabolic uptake by the bacteria. As phosphate is converted into ATP, this small molecule can easily passing through the pores of the MCP surface and enter the MCP. The ATP entered to the MCP can be utilized by PPK1 and converted into polyP. As polyP is too large to pass out of the pores of the MCP, it accumulates in the microcompartments, generating irreversibility in the process, and preventing phosphate returning to the system/ environment.
Surface Tagging of MCP
MCP is a promising platform for metabolic engineering, considering its magnificent features of concentrating desired enzymes and controlling substrate transfer. We utilize this properties to accomplish our goal – enhancing the PolyP synthesis and accumulation.
Yet being a bioreactor as it always has been, we start thinking if this protein cage can be exploited as a different tools, for example, a delivery vesicle?
There are some protein cages, including viral capsids, ferritins and heat shock proteins being investigated as nanocontainers for biomedical applications. Through genetic and chemical engineering, they can be potentially developed into therapeutic and imaging delivery systems.
One important feature for delivery vesicle is specific targeting, e.g. cell specific targeting for tumour cells. If exterior surface of the MCP can be genetically incorporated with designed targeting sequence, it might become a new candidates as a delivery vesicle.
We look through the solved structure of all five shell protein monomers: EutS, EutM, EutN, EutL and EutK. Luckily, we find EutS monomer is suitable for tagging at its N terminus because:
1. EutS monomer N terminus is extruding out of the EutS hexamer’s surface.
2. Studies showed that convex side of the EutS hexamer is the exterior side of Eut MCP.
Hence, we hypothesize fusing a designed targeting peptide to the EutS N termini will be presented on the exterior surface of the MCP, at the same time, pose little steric effect on the MCP assembly.
To our surprise, a study in 2012 (doi:10.1371/journal.pone.0033342) showed that EutS alone is necessary and sufficient for the formation of shells in vivo. Hence, homogenous EutS MCP might offer a simplier strategy for engineering of cell-specific targeting capsid, and potentially having higher specificity and affinity.
Hence we can study surface decoration affinity of two version MCPs:
(1) EutS MCP
(2) EutSMNLK native MCP
In our project, we use short tagging peptide – 6 Histidine tag – as a proof of principle. Since Histidine tag is conveniently used for protein purification, we will try purifying the Histidine tagged MCP through Nickel affinity column.
A Nano-Bioreactor inside a Bacterial Cell
The inner structure of bacteria could be quite complicated, despite its small size. The organization of the bacterial cell is a crucial element in the function of biosynthetic and metabolic pathways. It has been documented that bacteria can also have compartmentalization, known as bacterial microcompartments (MCP).
Bacterial MCP, unlike the lipid vesicular organelles of eukaryotes, are formed by proteins, enclosing enzymes and cofactors for carbon fixation or various forms of fermentative metabolism. A prominent example of bacterial microcompartment is the caryboxysome, which packages the enzyme ribulose bis-phosphate carboxylase oxygenase (RuBisCo) by forming polyhedral bodies with a diameter of 80-140 nm. Similar microcompartments build from related shell-forming proteins, the eut and pdu organelles, also package enzymes involved in metabolic reactions.
EUT Microcompartment
Both recombinant Salmonella enterica ethanolamine utilization (Eut) and propanediol utilization (Pdu) bacterial MCPs can be expressed heterologously in E.coli, with and without the associated interior enzymes. Noticing Team from the University of Minnesota in 2010 successfully cloned the Eut shell protein genes: EutS, M, N, L, K from Salmonella enterica LT2 and expressed in E. coli. We chose to work based on their contribution and utilize the Eut MCP biobrick they submitted (BBa_K311004).
Localizing PPK1 into MCP
It had been demonstrated that signal sequences at the N-terminus of MCP associated enzymes are capable of causing their compartmentalization inside shells. For Eut MCP, the sequence of 19 amino acids at the N-terminus of EutC has been showed to serve as this function, localizing the signal fused protein into the MCP. In order to localize the PPK1 to the inside of our recombinant Eut BMCs, we will construct a PPK1 fused with this N-terminal targeting sequence and co-transformed in E.coli alongside the Eut SMNLK expression cassette.
The nucleotide sequence of the signal peptide is
ATGGATCAAAAACAGATTGAAGAAATTGTACGTAGCGTGATGGCGTCAATGGGACAG.
And its corresponsing 19 amino acid is
MDQKQIEEIVRSVMASMGQ.
By localizing only PPK1 into the MCP, the engineered MCP is expected to form a sink for phosphate in the system which after normal metabolic uptake by the bacteria. As phosphate is converted into ATP, this small molecule can easily passing through the pores of the MCP surface and enter the MCP. The ATP entered to the MCP can be utilized by PPK1 and converted into polyP. As polyP is too large to pass out of the pores of the MCP, it accumulates in the microcompartments, generating irreversibility in the process, and preventing phosphate returning to the system/ environment.
Surface Tagging of MCP
MCP is a promising platform for metabolic engineering, considering its magnificent features of concentrating desired enzymes and controlling substrate transfer. We utilize this properties to accomplish our goal – enhancing the PolyP synthesis and accumulation.
Yet being a bioreactor as it always has been, we start thinking if this protein cage can be exploited as a different tools, for example, a delivery vesicle?
There are some protein cages, including viral capsids, ferritins and heat shock proteins being investigated as nanocontainers for biomedical applications. Through genetic and chemical engineering, they can be potentially developed into therapeutic and imaging delivery systems.
One important feature for delivery vesicle is specific targeting, e.g. cell specific targeting for tumour cells. If exterior surface of the MCP can be genetically incorporated with designed targeting sequence, it might become a new candidates as a delivery vesicle.
We look through the solved structure of all five shell protein monomers: EutS, EutM, EutN, EutL and EutK. Luckily, we find EutS monomer is suitable for tagging at its N terminus because:
1. EutS monomer N terminus is extruding out of the EutS hexamer’s surface.
2. Studies showed that convex side of the EutS hexamer is the exterior side of Eut MCP.
Hence, we hypothesize fusing a designed targeting peptide to the EutS N termini will be presented on the exterior surface of the MCP, at the same time, pose little steric effect on the MCP assembly.
To our surprise, a study in 2012 (doi:10.1371/journal.pone.0033342) showed that EutS alone is necessary and sufficient for the formation of shells in vivo. Hence, homogenous EutS MCP might offer a simplier strategy for engineering of cell-specific targeting capsid, and potentially having higher specificity and affinity.
Hence we can study surface decoration affinity of two version MCPs:
(1) EutS MCP
(2) EutSMNLK native MCP
In our project, we use short tagging peptide – 6 Histidine tag – as a proof of principle. Since Histidine tag is conveniently used for protein purification, we will try purifying the Histidine tagged MCP through Nickel affinity column.
|
|
