From 2013.igem.org
(Difference between revisions)
|
|
| Line 1: |
Line 1: |
| - | { | + | {"date" : "2013-07- 08","author" : " emil","title" : " Purification of Inocula (03/7)","content" : "<html>I verifyed the status of the last inocula( 05/7) that resulted a bit strange.</html>{{:Team:UNITN-Trento/Templates/Styles/Spoiler| Inocula|<html>< img src=\"\" width=\" 450px\" /></ html> }}< html> Unfortunately The day before were inoculate uncorrect plates( 03/ 7) so I have purified them following the < a href=\" https:// 2013.igem. org/ Team:UNITN-Trento/ Protocols#miniprep\"> purification protocol </ a> these are the results of the quantification.</html>{{:Team:UNITN-Trento/Templates/Styles/Spoiler| Quantification|<html><center><table class=\"tn-sp-table\"><tr><th> Sample</th>< th> Quantities</ th></tr><tr><td> BBa_K823026+BBa_E0840(1:1) 1</td><td> 438.8 ng/µl</td></tr><tr><td> BBa_K823026+BBa_E0840(1:1) 2</td><td> 400. 7 ng/µl</td></tr><tr><td> BBa_K823024+BBa_E0840(1 :1 ) 3</td><td> 343.6 ng/& micro; l( the only succesful)</td></tr></table></center></html>}}<html> Afterwards I screened 800 ng of the samples following the <a href=\"https://2013.igem.org/Team:UNITN-Trento/ Protocols# Digestion\"> screening protocol</a> with EcoR1 HF and Pst1, these are the results of the gel:</html>{{:Team:UNITN-Trento/Templates/Styles/Spoiler|Gel order|<html><center><table class=\"tn-sp-table\"><tr><th>Sample</th><th> Well</th></tr><tr><td> Ladder 1kb Fermentas</td><td> 1</td></tr><tr><td> BBa_K823026+BBa_E0840(1:1) a</td><td> 3</td></tr><tr><td> BBa_K823026+BBa_E0840(1:1) b</td><td> 4</td></tr><tr><td> BBa_K823024+BBa_E0840(1:1) </td><td> 5</td></tr></table></center></html> }}{{:Team:UNITN-Trento/Templates/Styles/Spoiler| Gel image|<html>< img src=\"\" width=\" 450px\" /></ html> }}< html> As we can see only the third(024) sample shows the insert at the right size of 1000 bp(the lower band), then I did the inocula of the plates of 5/ 07(1:1,1:2 ,1 :3) and of the old plate that gives right results to amplify 024(1:1).</html>","tags" : " K823024-K823026-E0840"} |
| - | "date" : "2013-07-10",
| + | |
| - | "author" : "gabriele-viola",
| + | |
| - | "title" : "Reboot: starting from the beginning",
| + | |
| - | "content" : "<html> Since the new forward primer (with the entire prefix) arrived, I started again from the beginning.<br/><br/><h3>SAM synthetase extraction</h3>The new primer forward has just the EcoRI restriction site added at its beginning ( complete prefix):<br/ >GAATTCGCGGCCGCTTCTAGAGAAGGAGGAACTACTATGGCAAAACACCTTTTT<br/>It has a Tm = 68.7 °C.<br/><br/>Then I performed two Phusion PCR (one GC and one HF) and one Phusion/RBC PCR to identify the best protocol for SAM synthetase extraction with the new primer.</html>{{:Team:UNITN-Trento/Templates/Styles/Spoiler| Phusion PCRs|<html>< center><table class=\" tn-sp-table\" ><tr><th colspan=\" 3\" >PCR Mixes</ th></ tr>< tr> <td style=\"border:none;\"></td><th>Mix HF ( 1)</ th><th>Mix GC (2)< /th></tr><tr><td>Phusion Buffer HF</td><td>10µl</td><td>0</td></tr><tr><td>Phusion Buffer GC</td><td>0</td><td>10µl</td></tr><tr><td>dNTPs</td><td colspan=\" 2\">1µl</ td></ tr><tr><td>template</td><td colspan=\"2\">1µl</td></tr><tr><td>Primer Fw</td><td colspan=\"2\" rowspan=\"2\">2. 5µl</ td></ tr><tr><td>Primer Rv</td></tr><tr><td>Phusion pol</td><td colspan=\"2\"> 0.5µl</ td> </tr><tr><td>Water</td><td colspan=\"2\">33. 5µl</td></tr></table><br/><br/><table class=\"tn-sp-table\"><tr><th colspan=\"4\">Phusion Settings</th></tr><tr><th>Step</th><th>Temperature</th><th>Time</th><th>Go to</th></tr><tr><td>1</td><td>98°C</td><td>30 sec</td><td></td></tr><tr><td>2</td><td>98°C</td><td>10 sec</td><td></td></tr><tr><td>3</td><td>72°C</td><td>35 sec</td><td>step #2, 30 times</td></tr><tr><td>4</td><td>72°C</td><td>10 min</td><td></td></tr><tr><td>5</td><td>4°C</td><td>pause</td><td></td></tr></table></center></html>}}<html></html>{{:Team:UNITN-Trento/Templates/Styles/Spoiler| Phusion/RBC PCR|<html><center><table class=\"tn-sp-table\"><tr><th colspan=\"2\"> PCR Mix</th>< /tr><tr><td style=\"border:none;\"></ td><td>Mix RBC (3)</td></tr><tr><td> Template</td><td>1 µl</td ></tr><tr><td> dNTPs</ td><td>0.5µl</td></tr><tr><td> Primer Fw</td><td rowspan=\"2 \">1µl</td ></tr><tr><td> Primer Rv</td></tr><tr><td>Buffer RBC</td><td>5µl</td></tr><tr><td>Phusion pol</td><td>0. 3µl</ td></tr><tr><td>RBC</td><td>0.25µl</td></tr><tr><td> Water</td><td>40.95µl</td></tr></table><br/><br/><table class=\"tn-sp-table\"><tr><th colspan=\"4\">PCR Settings</th></tr><tr><th>Step</th><th>Temperature</th><th>Time</th><th>Go to</th></tr><tr><td>1 </td><td>94°C</td><td>2 min</td><td></td></tr><tr><td>2</td><td>94°C</td><td>1 min</td><td></td></tr><tr><td>3</td><td> 62. 5°C</td><td>1 min</td><td></td></tr><tr><td>4</td><td>72°C</td><td>1 min 9 sec</td><td>step #2, 30 times</td></tr><tr><td>5</td><td>72°C</td><td>7 min</td><td></td></tr><tr><td>6 </ td><td>4& deg; C</td><td>pause</td><td></td></tr></table></html>}}<html><br/>The products of these three PCRs were then loaded on a 1% agarose gel.</html>{{:Team:UNITN-Trento/Templates/Styles/Spoiler|Gel|<html><center><table class=\"tn-sp-table\"><tr><th colspan=\"4\">Loading scheme</th></tr><tr><td>1kb ladder</td><td>GC( 2)</td><td>HF(1)</td><td>RBC(3)</td></tr></table ><img src=\"https://static.igem.org/mediawiki/2013/8/82/Tn-20130710-GG_SAMsynthetase_newPrimers_chosePCR.jpg\" alt=\"Gel\" width=\"450px\"></center></html>}}<html> As showed by the gel, only the Phusion/RBC PCR was successful.<br/><br/><hr><h3>Purifications</h3>Then, I purified the EX-SAMsynthetase-SP sample produced today with the Phusion/RBC PCR, and the 5 R0010 PCR insert that were amplified on <a href=\"https://2013.igem.org/ wiki/index.php?title=Team:UNITN-Trento/ Notebook# tn-post-2013-07-02-gabriele\"> tuesday 02/07</a> .<center><table class=\"tn-sp-table\"><tr><th>Sample</th><th> Type</th><th>Quantity</th></tr><tr><td> RBC(3)</td><td> EX-SAMsynthetase-SP</td><td>103.6ng/µl</td></tr><tr><td> HF1</td><td> R0010 insert</td><td>17.5ng/µl</td></tr><tr><td> HF2</td><td> R0010 insert</td><td>19.5ng/µl</td></tr><tr><td> HF3</td><td> R0010 insert</td><td>15.9ng/µl</td></tr><tr><td>G1</td><td>R0010 insert</td><td>17.8ng/µl</td></tr><tr><td>G2</td><td>R0010 insert</td><td>16.3ng/µl</td></tr></table></center> <br><hr><h3>OverNight Purification</h3>Then, Viola was so polite to prepare the O/N digestion mixes (<a href=\"https://2013.igem.org/Team:UNITN-Trento/Protocols#Digestion\">with the usual protocol</a>) and incubate them at 37°C. An EX-SAMsynthetase-SP sample (RBC#3 from today, 103.6ng/µl) and a linear pSB1C3 sample (G3A from <a href=\"https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/Notebook#tn-post-2013-07-01-Gabriele\">01/07</a>, 44.8ng/µl) were restricted with XbaI and PstI (Nebuffer2).</html>{{:Team:UNITN-Trento/Templates/Styles/Spoiler| Digestion mixes|<html>< center><table class=\" tn-sp-table\" ><tr><td style=\" border:none;\" ></ td> <th>RBC#3</ th>< th> G3A</th></tr><tr><td>Template</td><td>40µl</td><td>50µl</td></tr><tr><td>XbaI</td><td rowspan=\"2\">2.5 µl</ td><td rowspan=\"2 \">1. 5µl</td></tr><tr><td>PstI</td></tr><tr><td>NEBuffer 2</td><td>10µl</td><td>5µl</td></tr><tr><td>BSA</td><td>10µl</td><td>5µl</td></tr><tr><td>Water</td><td>35µl</td><td>0</td></tr></table></center></html>}}<html></html>", | + | |
| - | "tags" : "SAMsynthetase"
| + | |
| - | } | + | |
Latest revision as of 10:37, 3 October 2013
{"date" : "2013-07-08","author" : "emil","title" : " Purification of Inocula (03/7)","content" : "I verifyed the status of the last inocula(05/7) that resulted a bit strange.
Unfortunately The day before were inoculate uncorrect plates(03/7) so I have purified them following the
purification protocol these are the results of the quantification.
Quantification| Sample | Quantities |
|---|
| BBa_K823026+BBa_E0840(1:1) 1 | 438.8 ng/µl |
| BBa_K823026+BBa_E0840(1:1) 2 | 400.7 ng/µl |
| BBa_K823024+BBa_E0840(1:1) 3 | 343.6 ng/µl(the only succesful) |
Afterwards I screened 800 ng of the samples following the
screening protocol with EcoR1 HF and Pst1, these are the results of the gel:
Gel order| Sample | Well |
|---|
| Ladder 1kb Fermentas | 1 |
| BBa_K823026+BBa_E0840(1:1) a | 3 |
| BBa_K823026+BBa_E0840(1:1) b | 4 |
| BBa_K823024+BBa_E0840(1:1) | 5 |
As we can see only the third(024) sample shows the insert at the right size of 1000 bp(the lower band), then I did the inocula of the plates of 5/07(1:1,1:2,1:3) and of the old plate that gives right results to amplify 024(1:1).","tags" : "K823024-K823026-E0840"}
"
