"

From 2013.igem.org

Revision as of 18:23, 3 October 2013 (view source) Shengsheng (Talk | contribs) ← Older edit		Revision as of 18:24, 3 October 2013 (view source) Shengsheng (Talk | contribs) Newer edit →
Line 16:		Line 16:
	|  atgagcacaaaaaagaaaccatt		|  atgagcacaaaaaagaaaccatt
	| No description		| No description
-	|-
-	! scope="row"| [http://www.instructables.com/id/Arduino-PCR-thermal-cycler-for-under-85/ Arduino PCR]
-	| $85
-	| No heated lid, room for only 2 tubes, fan-only cooling.
	|-		|-
	|}		|}

---

Revision as of 18:24, 3 October 2013

Name	Project	Sequence	Description
BBa_C0051-Forward	Gemote	atgagcacaaaaaagaaaccatt	No description
BBa_C0051-Forward	Gemote	atgagcacaaaaaagaaaccatt	No description