Team:UC Chile/Team Members
From 2013.igem.org
(Difference between revisions)
Line 12: | Line 12: | ||
<body> | <body> | ||
- | <div id="hidden-links">Hidden<br>Links</div> | + | <div id="hidden-links">Hidden<br>Links</div> |
<div id="aux-igem"><a href="https://igem.org/Main_Page"><img src="https://static.igem.org/mediawiki/2013/archive/d/de/20130919203514%21IGEM_basic_Logo_stylized.png" id="igem-logo" border="0"></a></div> | <div id="aux-igem"><a href="https://igem.org/Main_Page"><img src="https://static.igem.org/mediawiki/2013/archive/d/de/20130919203514%21IGEM_basic_Logo_stylized.png" id="igem-logo" border="0"></a></div> | ||
<div id="Header"><!--Inicio de Header--> | <div id="Header"><!--Inicio de Header--> | ||
<img src="https://static.igem.org/mediawiki/2013/6/61/Team_UC_Chile_ALL_Header.png" usemap="#fotoMap" id="foto" border="0"> | <img src="https://static.igem.org/mediawiki/2013/6/61/Team_UC_Chile_ALL_Header.png" usemap="#fotoMap" id="foto" border="0"> | ||
<map name="fotoMap"> | <map name="fotoMap"> | ||
- | <area shape=" | + | <area shape="rect" coords="61,167,153,213" href="Prueba link.html"> |
+ | <area shape="rect" coords="34,207,62,243" href="Prueba link.html"> | ||
</map> | </map> | ||
<div id="MENU"><!--Inicio de MENU--> | <div id="MENU"><!--Inicio de MENU--> | ||
Line 28: | Line 29: | ||
<div class="text">Project</div> | <div class="text">Project</div> | ||
<ul class="sub oculto"> | <ul class="sub oculto"> | ||
- | <li class="pos1 sub_item oculto"> | + | <li class="pos1 sub_item oculto">Description<a href="https://2013.igem.org/Team:UC_Chile/Description"></a></li> |
- | <li class="pos2 sub_item oculto"> | + | <li class="pos2 sub_item oculto">Formation<a href="https://2013.igem.org/Team:UC_Chile/Formation"></a></li> |
- | <li class="pos3 sub_item oculto"> | + | <li class="pos3 sub_item oculto">Targeting<a href="https://2013.igem.org/Team:UC_Chile/Targeting"></a></li> |
- | <li class="pos4 sub_item oculto"> | + | <li class="pos4 sub_item oculto">Purification<a href="https://2013.igem.org/Team:UC_Chile/Purification"></a></li> |
+ | <li class="pos5 sub_item oculto">Disruption<a href="https://2013.igem.org/Team:UC_Chile/Disruption"></a></li> | ||
+ | <li class="pos5 sub_item oculto">In vitro Channeling<a href="https://2013.igem.org/Team:UC_Chile/In vitro Channeling"></a></li> | ||
</ul> | </ul> | ||
- | </div> | + | </div> |
<div class="h2 hexa" onclick="aux(2)"> | <div class="h2 hexa" onclick="aux(2)"> | ||
<div class="rec d"></div> | <div class="rec d"></div> | ||
Line 40: | Line 43: | ||
<div class="text">Methodology</div> | <div class="text">Methodology</div> | ||
<ul class="sub oculto"> | <ul class="sub oculto"> | ||
- | <li class="pos1 sub_item oculto"> | + | <li class="pos1 sub_item oculto">Lab Notebook<a href="https://2013.igem.org/Team:UC_Chile/Lab NoteBook"></a></li> |
- | <li class="pos2 sub_item oculto"> | + | <li class="pos2 sub_item oculto">Protocols<a href="https://2013.igem.org/Team:UC_Chile/Protocols"></a></li> |
</ul> | </ul> | ||
- | + | </div> | |
<div class="h3 hexa" onclick="aux(3)"> | <div class="h3 hexa" onclick="aux(3)"> | ||
<div class="rec d"></div> | <div class="rec d"></div> | ||
<div class="rec d d2"></div> | <div class="rec d d2"></div> | ||
<div class="rec d d3"></div> | <div class="rec d d3"></div> | ||
- | <div class="text"> | + | <div class="text">Results</div> |
<ul class="sub oculto"> | <ul class="sub oculto"> | ||
- | <li class="pos1 sub_item oculto">Mathematical Model<a href="https://2013.igem.org/Team:UC_Chile/Mathematical Model"></a></li> | + | <li class="pos1 sub_item oculto">BioBricks<a href="https://2013.igem.org/Team:UC_Chile/BioBricks"></a></li> |
- | <li class=" | + | <li class="pos2 sub_item oculto">Mathematical Model<a href="https://2013.igem.org/Team:UC_Chile/Mathematical Model"></a></li> |
+ | <li class="pos3 sub_item oculto">Wet Lab<a href="https://2013.igem.org/Team:UC_Chile/Wet Lab"></a></li> | ||
</ul> | </ul> | ||
</div> | </div> | ||
Line 59: | Line 63: | ||
<div class="rec d d3"></div> | <div class="rec d d3"></div> | ||
<div class="text">Team</div> | <div class="text">Team</div> | ||
- | <ul class="sub "> | + | <ul class="sub "> |
<li class="pos1 sub_item ">Team Members<a href="https://2013.igem.org/Team:UC_Chile/Team Members"></a></li> | <li class="pos1 sub_item ">Team Members<a href="https://2013.igem.org/Team:UC_Chile/Team Members"></a></li> | ||
<li class="pos2 sub_item ">PSB Lab<a href="https://2013.igem.org/Team:UC_Chile/PSBL Lab"></a></li> | <li class="pos2 sub_item ">PSB Lab<a href="https://2013.igem.org/Team:UC_Chile/PSBL Lab"></a></li> | ||
Line 65: | Line 69: | ||
</ul> | </ul> | ||
</div> | </div> | ||
- | <div class="h5 hexa " onclick="aux(5)"> | + | <div class="h5 hexa" onclick="aux(5)"> |
<div class="rec d"></div> | <div class="rec d"></div> | ||
<div class="rec d d2"></div> | <div class="rec d d2"></div> | ||
Line 71: | Line 75: | ||
<div class="text">Human<br>Practices</div> | <div class="text">Human<br>Practices</div> | ||
<ul class="sub oculto"> | <ul class="sub oculto"> | ||
- | <li class="pos1 sub_item oculto">Home<a href="https://2013.igem.org/Team:UC_Chile/Human Practices"></a></li> | + | <li class="pos1 sub_item oculto">Home<a href="https://2013.igem.org/Team:UC_Chile/Human Practices"></a></li> |
+ | <li class="pos2 sub_item oculto">Synbio web<a href="https://2013.igem.org/Team:UC_Chile/Synbio web"></a></li> | ||
</ul> | </ul> | ||
- | </div> | + | </div> |
<div class="h6 hexa" onclick="aux(6)"> | <div class="h6 hexa" onclick="aux(6)"> | ||
<div class="rec d"></div> | <div class="rec d"></div> | ||
Line 80: | Line 85: | ||
<div class="text">More</div> | <div class="text">More</div> | ||
<ul class="sub oculto"> | <ul class="sub oculto"> | ||
- | <li class="pos1 sub_item oculto"> | + | <li class="pos1 sub_item oculto">Acknowledgments<a href="https://2013.igem.org/Team:UC_Chile/Acknowledgments"></a></li> |
- | <li class="pos2 sub_item oculto"> | + | <li class="pos2 sub_item oculto">Biosafety<a href="https://2013.igem.org/Team:UC_Chile/Biosafety"></a></li> |
- | + | ||
</ul> | </ul> | ||
- | </div> | + | </div> |
- | <div class="h7 hexa" onclick=" | + | <div class="h7 hexa " onclick="location.href='https://2013.igem.org/Team:UC_Chile/Overview'"> |
<div class="rec d"></div> | <div class="rec d"></div> | ||
<div class="rec d d2"></div> | <div class="rec d d2"></div> | ||
Line 92: | Line 96: | ||
<ul class="sub oculto"> | <ul class="sub oculto"> | ||
<li class="pos1 sub_item oculto">Overview<a href="https://2013.igem.org/Team:UC_Chile/Overview"></a></li> | <li class="pos1 sub_item oculto">Overview<a href="https://2013.igem.org/Team:UC_Chile/Overview"></a></li> | ||
- | |||
</ul> | </ul> | ||
</div> | </div> | ||
</div><!--Fin de new Menu--> | </div><!--Fin de new Menu--> | ||
- | </div><!--Fin de MENU--> | + | </div><!--Fin de MENU--> |
</div><!--Fin de Header--> | </div><!--Fin de Header--> | ||
<div id="Container"><!--Inicio de Contenedor--> | <div id="Container"><!--Inicio de Contenedor--> |
Latest revision as of 02:35, 8 October 2013
Team Members
Magdalena Ribbeck
XX - ATGGCAGGCGATGCACTGGAAAACGCA AGAATTTAATAAGAGTGTAAG
Occupation | : | Civil Engineer in Biotechnology. |
iGEM | : | Videogame realization and lab work. |
Likes to | : | Write, read about psychology, to draw and to practice Judo. |
Frustrated Dream | : | To be a writer. |
Fun fact | : | Reads “Origin of species”, Charles Darwin, for fun. |
Lab mistake | : | Spill chloroform on Valentina. |
Valentina Frenkel
XX - GTCGCCCTTGAGAACACAATTAATGCC TTCAGAGAGAATAAAGAGCTC
Occupation | : | Civil Engineer in Biotechnology. |
iGEM | : | Primer design. Wiki and videogame development. Lab work. |
Likes to | : | Draw, watch anime and series, play Lucas arts games (Monkey island, Grim fandango, Full throttle, etc) and Pokemon. |
Frustrated Dream | : | To be able to do better illustrations and play an instrument professionally. |
Fun fact | : | She does not believe in photographs, she thinks she can get a better capture of the essence of people through her cute drawings. |
Lab mistake | : | Use the whole stock pHnCBS1D instead of the dilution. |
Felipe Ignacio Erices Canales
XY - TTTGAGCTTATACCCGAG GAAAGAATTTGTGAGTCT
Occupation | : | Civil Engineer in Biotechnology. |
iGEM | : | Human translator to 1&0 and hunter of optimal sequences. Wiki programing and lab work. |
Likes to | : | Do sports, eat pineapple and corn pizza, random Youtube videos, eat Inca Gold, share food, solve puzzles and do origami. |
Frustrated Dream | : | Not to be ignored, try to keep the lab neat and be able to hibernate. |
Fun fact | : | He can split an apple in half just with his hands. |
Lab mistake | : | Run an important gel without the ladder. |
Ilenne Del Valle.
XX - ATACTTGAAAACAACGAG GATGAATTG GTAGCGTTGCTAGAA
Occupation | : | Biochemist |
iGEM | : | Prevention of future complications. Lab work organization and administration. Experimental design. |
Likes to | : | Practice Judo and read. |
Frustrated Dream | : | That the iGEM team doesn’t think that she is sending the emails while angry at them. |
Fun fact | : | She has a really high rate of paper reading. She did an exchange program in US. She suffers for being the only vegetarian in a carnivorous group. |
Lab mistake | : | Break a huge ellermeyer flask the very first day in the lab and in front of the boss. |
Josefina Philippi
XX - TAATAAAGCGAATTTATAAACGCG CCACACATCCTGATACCTCCAATA
Occupation | : | Economist and Biologist. |
iGEM | : | Team’s boss. Bureaucratics and lab experiment management. |
Likes to | : | Cook, sitcom series, "The Little Prince" and the beach. |
Frustrated Dream | : | To be a good singer. |
Fun fact | : | She makes the lab explode with dry ice. |
Lab mistake | : | Make a high concentrated RedGel Agarose and stain Lab notebook with chloroform. |
Sebastián Álvarez
XY - AGCGAGTAAGCGTCTACTATTGCCAAT GCGTTGGTGGCCAGGGAGTAA
Occupation | : | Biologist. |
iGEM | : | More that he can handle, but not enough to get credit for it. |
Likes to | : | Swim (male marmaid aka marman), eat sushi, the amazing word of science fiction with authors like Isaac Asimov, comedy and staff. |
Frustrated Dream | : | To grow a majestic beard, the manliest ever seen. |
Fun fact | : | He won a masculinity contest of napkin folding and burnt a part of his hair trying to hear fire. |
Lab mistake | : | Leave the centrifuge working with no tubes inside … all night long. |
Javier Cillero
XY - TAAGCAGTTATTGAAAGG TGCATCCTACTTGAGCGCTAA
Occupation | : | Biologist. |
iGEM | : | Lab work and experimental design. |
Likes to | : | Play soccer, go to the stadium, walk under the rain and feel like a fish. |
Frustrated Dream | : | To be a soccer player and be able to play any instrument. |
Fun fact | : | He can make cigarette smoke rings. Has a collection of beer cans, USA, prepare!. |
Lab mistake | : | He told us “I’m immune to those mistakes … noobies”. The next day he dropped ALL THE IMPORTANT TUBES, that took us months to do, and broke the containing box. |
Belén Céspedes
XX - TAAGAGTTAGAAAAC TGCGAATCTCCCGAGGACGAGAGT
Occupation | : | Physicist. |
iGEM | : | Mathematical modelling, Human Practices and paper traffic. |
Likes to | : | Play with animals and plants, eat deserts and collect stuff. Drink Quatro Guaraná. |
Frustrated Dream | : | To make a sound biosensor and cure the world from Malaria. Join Cirque du Soleil. |
Fun fact | : | She can talk with animals, juggles and rides a monocycle. She’s allergic to everything. |
Lab mistake | : | She transplant the Nicotianas and change the order of the plants so, we didn’t know which plants had the GFP. We had to redo all genomic extraction. |
Manuel Álamo
XY - ATGGCCAACTAAGAGTTG GCACTCGCCATGTAA
Occupation | : | Physicist. |
iGEM | : | Mathematical modeling and Human Practice organization. |
Likes to | : | Argue and annoy. Watch Slam Dunk and Captain Tsubasa, drink “mate” and read about politics. |
Frustrated Dream | : | Have a good voice, be able to draw, recognize colors, have good eyesight and more time. |
Fun fact | : | Not a funny guy. |
Lab mistake | : | Nobody knows how he made a gel that didn’t solidify. |