"

From 2013.igem.org

{ "date" : "2013-07-10", "author" : "gabriele-viola", "title" : "Reboot: starting from the beginning", "content" : "Since the new forward primer (with the entire prefix) arrived, I started again from the beginning.

SAM synthetase extraction

The new primer forward has just the EcoRI restriction site added at its beginning (complete prefix):
GAATTCGCGGCCGCTTCTAGAGAAGGAGGAACTACTATGGCAAAACACCTTTTT
It has a Tm = 68.7°C.

Then I performed two Phusion PCR (one GC and one HF) and one Phusion/RBC PCR to identify the best protocol for SAM synthetase extraction with the new primer.
The products of these three PCRs were then loaded on a 1% agarose gel.As showed by the gel, only the Phusion/RBC PCR was successful.

---

Purifications

Then, I purified the EX-SAMsynthetase-SP sample produced today with the Phusion/RBC PCR, and the 5 R0010 PCR insert that were amplified on tuesday 02/07.

Sample	Type	Quantity
RBC(3)	EX-SAMsynthetase-SP	103.6ng/µl
HF1	R0010 insert	17.5ng/µl
HF2	R0010 insert	19.5ng/µl
HF3	R0010 insert	15.9ng/µl
G1	R0010 insert	17.8ng/µl
G2	R0010 insert	16.3ng/µl

---

OverNight Purification

Then, Viola was so polite to prepare the O/N digestion mixes (with the usual protocol) and incubate them at 37°C. An EX-SAMsynthetase-SP sample (RBC#3 from today, 103.6ng/µl) and a linear pSB1C3 sample (G3A from 01/07, 44.8ng/µl) were restricted with XbaI and PstI (Nebuffer2).", "tags" : "SAMsynthetase" }