"
Team:UCLA/Notebook/Biobrick
Making the Mtd Biobrick
To create this biobrick, we utilized a combination of splicing overlap extension PCR and Gibson Assembly to extract a sequence from the BPP-1 phage's genomic DNA that would be free of the standard biobrick restriction enzyme sites. The protocols for those methods are listed below:
PCR to generate fragments of mtd
In this step, four separate fragments of the mtd gene are created via PCR. This step is necessary to eliminate illegal internal biobrick sites (EcoRI, PstI, NotI) and to add necessary biobrick sites to the 5' and 3' ends.
| Fragment | Forward Primer | Reverse Primer |
|---|---|---|
| 1 | CCTTGAATTCGCGGCCGCATCTAGAATGAGTACCGCAGTCCAGTTCCG | GCCTGCGCTGCCGCGTTGCTTCC |
| 2 | GGAAGCAACGCGGCAGCGCAGGC | CCAGCGCCTGGAACTCGTTGTAGTTGGGCAGG |
| 3 | CCTGCCCAACTACAACGAGTTCCAGGCGCTGG | CCGATCCGCGGCCTCCAGTGTTGG |
| 4 | CCAACACTGGAGGCCGCGGATCGG | AAGGCTGCAGCGGCCGCTACTAGTCTCAAGAATCAGG |
The 20 µL PCR mix for each fragment is as follows:
| Reagent | Volume |
|---|---|
| mtd genomic template | 1.0 µL (4.5 ng total) |
| 10 µM forward primer | 1.0 µL |
| 10 µM reverse primer | 1.0 µL |
| 10 mM dNTPs | 0.4 µL |
| Buffer HF | 4.0 µL |
| Phusion Polymerase | 0.2 µL |
| ddH2O | 12.4 µL |
The thermocycler program for each reaction is as follows:
| # Cycles | Temperature (°C) | Time |
|---|---|---|
| 1 | 98 | 0:30 |
| 30 | 98 Variable (70 for fragment 1, 69 for fragment 2, 69 for fragment 3, 72 for fragment 3) 72 | 0:10 0:20 0:15 |
| 1 | 72 | 5:00 |
| 1 | 4 | -- |
The PCR product is then resolved on a 1% agarose gel and excised and column-extracted.
Splicing Overlap-Extension (SOE) PCR to connect fragments 3 and 4
The 20 µL reaction mix is as follows:
| Reagent | Volume or Mass |
|---|---|
| Fragment 3 | 20 ng total |
| Fragment 4 | 20 ng total |
| 10 µM forward primer | 1.0 µL |
| 10 µM reverse primer | 1.0 µL |
| 10 mM dNTPs | 0.4 µL |
| Buffer HF | 4.0 µL |
| Phusion Polymerase | 0.2 µL |
| ddH2O | fill to 20 µL |
Created with the HTML Table Generator
