"
Team:UTK-Knoxville/primers
From 2013.igem.org
Gibson Primers
| Name | Sequence | Melting Temperature | Function / Comment |
| Transmembrane Construct | |||
| EnvZ_F | gtaagtcacgacttgcgcacgccgctgac | 70 | Amplifies EnvZ does not include any overlap of the sensor part. |
| Envz_R | ggcggccgctctattagtgatggtggtgatgatgttacccttcttttgtcgtgc | 75 | Amplifies EnvZ (20 bp) and includes overlap (34 bp) of the free space between it and the terminator. |
| OmpR_F | agaaataattttgtttaactataagaaggagatatacatatgcaagagaactacaagatt | 64 | Amplifies OmpR and overlaps with the RBS and T7 promoter. Note the backbone needs to have the T7 promoter and RBS already. |
| OmpR_R | tcatgctttagagccgtccggtacaaagac | 65 | Amplifies OmpR and does not include the second RBS to avoid homology. |
| Aer | |||
| Aer_f | tctttgtaccggacggctctaaagcatgaaaggagatataatgtcttctcatccgtatgt | 71 | Includes overlap with OmpR (29 bp), the RBS (11 bp) and overlap with Aer (20 bp) |
| Aer_R | TACGCgtcagcggcgtgcgcaagtcgtgacttacatttctgacactggacacctg | 77 | Include overlap with EnvZ (34 bp) and Aer (21 bp). The temperature differance is quite extereme. |
| NarX | |||
| NarX_F | tctttgtaccggacggctctaaagcatgaAAGGAGATATAatgcttaaacgttgtctctc | 71 | Includes overlap with OmpR (29 bp), the RBS (11 bp) and overlap with NarX (20 bp) |
| NarX_R | tacgcgtcagcggcgtgcgcaagtcgtgacttacatttttatgctccagcccggc | 79 | Include overlap with EnvZ (34 bp) and NarX (21 bp). The temperature differance is quite extereme. |
| Cytoplasmic Construct | |||
| NtrC_F | TAGAAATAATTTTGTTTAACTataagaaggagatatacatatgcaacgagggatagtctg | 65 | Amplifies NtrC and overlaps with the RBS and T7 promoter. Note the backbone needs to have the T7 promoter and RBS already. |
| NtrC_R | gagctggggatggagtgaTTTTAACTTACGC | 64 | Amplifies NtrC and does not include the second RBS to avoid homology. |
| NtrB_F | ccgatggataaccagcgccgcTTAAGTCAGG | 69 | Amplifies NtrB does not include any overlap of the sensor part. |
| NtrB_R | GGCGGCCGCTCTATTAGTGATGGTGGTGATGATGttatttcctgataggcaggt | 74 | Amplifies NtrB (20 bp) and includes overlap (34 bp) of the free space between it and the terminator. |
| HemAT | |||
| HemAT_F | gtaagttaaaatcactccatccccagctcAAGGAGATATAttgttatttaaaaaagacag | 67 | Includes overlap with NtrC (29 bp), the RBS (11 bp) and overlap with HemAT (20 bp) |
| HemAT_R | CTGTTCCTGACTTAAGCggcgctggttatccatcggctggttgtactcgctttgaaac | 75 | Include overlap with NtrB (34 bp) and HemAT (21 bp). The temperature differance is quite extereme. |
| RcoM | |||
| RcoM_F | gtaagttaaaatcactccatccccagctcAAGGAGATATAatgtttaaatattttgcaatt | 67 | Includes overlap with NtrC (29 bp), the RBS (11 bp) and overlap with RcoM (20 bp) |
| RcoM_R | gttcctgacttaagcggcgctggttatccatcggcttatggacggttacactacc | 75 | Include overlap with NtrB (34 bp) and RcoM (21 bp). The temperature differance is quite extereme. |
| TodS | |||
| TodS_F | gtaagttaaaatcactccatccccagctcAAGGAGATATAatgagctccttggatagaaa | 70 | Includes overlap with NtrC (29 bp), the RBS (11 bp) and overlap with TodS (20 bp) |
| TodS_R | GTTCCTGACTTAAgcggcgctggttatccatcggatcggtaatattgcgcccttc | 75 | Include overlap with NtrB (34 bp) and TodS (21 bp) |
| LasR | |||
| LasR_F | |||
| LasR_R | |||
| Note: APE and IDT primer Tm differ |
[back]
