| Identifier | Order date | Note | Sequence
|
| HM14:DelH_tetR_fw | 2013-08-16 | Gibson-Primer DelH-tetR: amplifies the tetracycline resistance from the pSB1T3 Backbone and creates an overlap to the end of DelH | ATTGGCGCTGGAGTACGCGCTGGACTGA atgaagttttaaatcaatctaaag
|
| HM15:tetR_stop_BB_rev | 2013-08-16 | Gibson-Primer tetR-pSB6A1: amplifies the tetracycline resistance and creates an overlap with the Terminator of the Backbone pSB6A1 | Cgactgagcctttcgttttatttgatgcctggc ctcgtgatacgcctatttttatagg
|
| HM16:tetR_pSB6A1_fw | 2013-08-16 | Gibson-Primer DelH, amplifies the Backbone pSB6A1 creating an overlap with the tetracycline resistance | Aaaaataggcgtatcacgag gccaggcatcaaataaaacgaaaggctcag
|
| FS_66: DelH_rv | 2013-08-26 | Amplification of DelH from Delftia acidovorans Gibson Primer | TGGGCATTCACCGCATCGATC
|
| FS_67: DelH_fw | 2013-08-26 | Amplification of DelH from Delftia acidovorans Gibson Primer | CTTCACGTTGATTGCGCATG
|
| FS_68: DelH_rv | 2013-08-26 | Amplification of DelH from Delftia acidovorans Gibson Primer | CAGAAGAACTCCCAGACCGAC
|
| FS_69: DelH_fw | 2013-08-26 | Amplification of DelH from Delftia acidovorans Gibson Primer | GACACCGTTCAGCTTCGATG
|
| FS_70: DelH_rv | 2013-08-26 | Amplification of DelH from Delftia acidovorans Gibson Primer | GAAGCTGCTCCGCTGATAGAT
|
| FS_71: DelH_fw | 2013-08-26 | Amplification of DelH from Delftia acidovorans Gibson Primer | ATGTGCTGTCGCTCAAGATG
|
| FS_72_SR_02_fw | 2013-08-30 | Screening of pHM04 | ATGTGCTGTCGCTCAAGATG
|
| FS_73_SR_03_fw | 2013-08-30 | Screening of pHM04 | GTGCTGTTTGGCCGTATG
|
| FS_74_SR_04_fw | 2013-08-30 | Screening of pHM04 | ATCAGGTGCTGAGCTACGAC
|
| FS_75_SR_05_fw | 2013-08-30 | Screening of pHM04 | CTGTTCATCAACACCTTGCC
|
| FS_76_SR_06_rv | 2013-08-30 | Screening of pHM04 | GAAGACAGTCATAAGTGCGGC
|
"
