Team:UTK-Knoxville/construct
From 2013.igem.org
Contents[hide] |
Construst
Buffers & Solution
COMING SOON
[back]
Kits
Coming Soon
[back]
Marker
COMING SOON
[back]
Enzymes
COMING SOON
[back]
-
Cytoplasmic foundation
-
TodS?
-
Protein design
-
Aer - Aer is an aerotaxis sensing flavoprotein in E. coli. It is a member of the superfamily of PAS domain proteins, a group of which sense oxygen, redox potential and light. Aer is an intracellular sensor that is bound to the membrane, so it mediates aerotactic responses based on the oxygen and energy state of the cell.
Design: For our chimera of Aer and EnvZ, we used the sensing domain of Aer, through its transmembrane regions, and up to its HAMP domain, since the HAMP and sensor domains work together for signal transduction. The histidine kinase region of EnvZ was used and the two pieces were fused together.
http://onlinelibrary.wiley.com/doi/10.1111/j.1365-2958.2007.05889.x/full#b4
-
NarX - NarX is a transmembrane nitrate/nitrite sensor from E. coli. Michael Manson et al. [Source] have already fused the Tar sensor to the NarX histidine kinase domain with good results. Our design attaches the NarX sensing domain to the EnvZ HAMP and kinase domains.
-
Scott M. Ward, Arjan F. Bormans, and Michael D. Manson. Mutationally Altered Signal Output in the Nart (NarX-Tar) Hybrid Chemoreceptor. Journal of Bacteriology. 188 (2006): 3944-3951 doi:10.1128/JB.00117-06.
- HemAT - HemAT senses oxygen from Bacillus subtilis. HemAT is a cytoplasmic sensor, so we have attached it to the TodT reporter machinery.
Fig. 4. The schematic models of (A) the sensor domain of HemAT-Bs and (B) the sensor and transmembrane domains of MCP. The crystal structures of sensor domains in HemAT-Bs (PDB: 1OR6) and Tar from Salmonella typhimurium (PDB: 1WAT) that is a typical MCP are shown in (C) and (D), respectively. (E) and (F) are the top view of (C) and (D), respectively. The helices colored in red are the constituent of the conserved helix bundle.
Figure 1. The Molecular Structure of the HemAT Sensor Domain Represented with Ribbon Diagrams(A) Stereo view of the structure. The signaling domain would be located further down on the page.(B) Top view showing the flanking of the core helices, G and H, by the rest of the molecule. The helices are labeled corresponding to the nomenclature of the globin fold. Subunit A, cyan; subunit B, yellow.
-
TodS - TodS primarily senses toluene but also senses benzene and styrene. We are attaching the TodS sensing domain to EnvZ because TodS is cytoplasmic and we want to see if a cytoplasmic sensor works with a transmembrane histidine kinase domain. TodT is also our chosen platform for cytoplasmic sensor domains.
-
RcoM -
-
LasR -
-
Plasmids
[back]
Name | Sequence | Melting Temperature (°C) |
Function / Comment | Status |
---|---|---|---|---|
General (Transmembrane) | ||||
EnvZ_r | aaaaaactcgagttaggatccTTACCCTTCTTTTGTCGTGCC | 57 | Lowercase part has restriction sites: XhoI-ctcgag BamHI-ggatcc | In |
OmpR_r | AAAAAACTCGAGAGGGGATCtcatgctttagagccgtccgg | 60 | Restriction sites: XhoI-ctcgag BamHI-ggatcc | In |
OmpR_f | aaaaaaCATATGCAAGAGACCTACAAGATTCTG | 53 | Restriction site: NdeI-catatg | In |
Aer | ||||
Aer_f | aaaaaagaattctaaagatctaaggagatataATGTCTTCTCATCCGTATGTC | 53 | Lowercase part has restriction sites: EcoRI-gaattc BglII-agatct | In 5/30 |
Aer-EnvZ_1r | GCGCAAGTCGTGACTTACCCatttctgacactggacacctgg | 58 | Overlapping PCR primers | In 5/30 |
Aer-EnvZ_1f | ccaggtgtccagtgtcagaaatGGGTAAGTCACGACTTGCGC | 59 | Overlapping PCR primers | In 5/30 |
NarX | ||||
NarX_F | ||||
NarX_R | ||||
NarX-EnvZ_R | ||||
HemAT | ||||
HemAT_F | aaaaaactcgagaaggagatatattgttatttaaaaaagacagaaaacaag | 52 | XhoI- ctcgag | |
HemAT_R | ggcgctggttatccatcggactggttgtactcgctttgaaacg | 58 | Overlapping PCR primers | |
HemAT_NtrB_F | cgtttcaaagcgagtacaaccagtccgatggataaccagcgcc | 61 | Overlapping PCR primers | |
TodS | ||||
RcoM | ||||
RcoM_F | aaaaaactcgagaaggagatataTTAGTTTTTACTTGCTTCAGTTGG | 54 | XhoI-ctcgag | |
RcoM_R | ggcgctggttatccatcggaatgtttaaatattttgcaattgcttc | 52 | Overlapping PCR primers | |
RcoM_NtrB_F | gaagcaattgcaaaatatttaaacattccgatggataaccagcgcc | 61 | Overlapping PCR primers | |
LasR | ||||
Cytoplasmic Construct | ||||
NtrC_F | aaaaaacatatgatgcaacgagggatagtctgg | 58 | Restriction site: NdeI-catatg | |
NtrC_R | agatccgagctggggatggagtgactcgagaaaaaa | 57 | XhoI-ctcgag | |
NtrB_R | aaaaaactcgagttaggatccTTATTTCCTGATAGGCAGGTAAAC | 54 | Lowercase part has restriction sites: XhoI-ctcgag BamHI-ggatcc | |
Synthetic oligonucleotides
COMING SOON
[back]
Phages
COMING SOON | ||
[back]
Bacteria
COMING SOON
[back]
Bacteria Growth Media
COMING SOON
[back]