User contributions
From 2013.igem.org
(Latest | Earliest) View (newer 250 | older 250) (20 | 50 | 100 | 250 | 500)
- 00:46, 24 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Analytical digestion and gelelectrophoresis to check whether the transformation of E. coli Xl1 Blue with QuickChanges products of P100 (TEV, QC with O36/O37) and P102 (EreB, QC with O16/O17) were successful)
- 00:45, 24 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Analytical digestion and gelelectrophoresis to check whether the QuickChanges of P100 (TEV, QC with O36/O37) and P102 (EreB, QC with O16/O17) were successful)
- 00:43, 24 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Analytical gelelectrophoresis of QuickChange products of P100, P102 and P28 to check whether the QuickChange PCR and DpnI digestion were successful)
- 00:42, 24 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Quick Change mutagenesis to remove forbidden restriction sites - SDMI - of P28 (Laccase), P100 (TEV S219V), P102 (EreB))
- 00:42, 24 May 2013 (diff | hist) N File:TUM13 20130519 P28QC P100QC P102QC.png (top)
- 00:40, 24 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Sequencing of P105, P28, P100, P102 & P98)
- 00:39, 24 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Analytical gelelectrophoresis of QuickChange products of P100, P102 and P28 to check whether the QuickChange PCR and DpnI digestion were successful)
- 00:38, 24 May 2013 (diff | hist) N File:TUM13 20130521 P28QC P100QC P102QC.png (top)
- 00:36, 24 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal
- 20:32, 22 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Analytical digestion and gelelectrophoresis to check whether the QuickChanges of P100 (TEV, QC with O36/O37) and P102 (EreB, QC with O16/O17) were successful)
- 20:30, 22 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal
- 20:27, 22 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Picking of transformed Plasmid E. coli XL1 blue with QuickChange products of P28 (Laccase, QC with O26/O27))
- 20:27, 22 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Analytical digestion and gelelectrophoresis to check whether the QuickChanges of P100 (TEV, QC with O36/O37) and P102 (EreB, QC with O16/O17) were successful)
- 20:26, 22 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Quick Change mutagenesis to remove forbidden restriction sites of P28 (Laccase), P100 (TEV S219V), P102 (EreB))
- 19:55, 22 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Picking of transformed Plasmid E. coli XL1 blue with QuickChange products of P100 (TEV, QC with O36/O37) and P102 (EreB, QC with O16/O17))
- 19:43, 22 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Week 5)
- 19:43, 22 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Wednesday, May 22nd)
- 19:40, 22 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Wednesday, May 22nd)
- 19:39, 22 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Week 5)
- 19:29, 22 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Picking of transformed Plasmid E. coli XL1 blue with QuickChange products of P100 (TEV, QC with O36/O37) and P102 (EreB, QC with O16/O17))
- 19:28, 22 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Tuesday, May 21st)
- 13:22, 21 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal
- 13:21, 21 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal
- 13:17, 21 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Sequencing of P105, P28, P100, P102 & P98)
- 13:17, 21 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Transformation of the Quickchange products with P28, P100 and P102 into E. coli XL1 blue)
- 13:17, 21 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal
- 13:15, 21 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal
- 13:13, 21 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal
- 13:12, 21 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal
- 13:10, 21 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Week 5)
- 13:09, 21 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal
- 13:06, 21 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Tuesday, May 21st)
- 13:05, 21 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Sequencing of P105, P28, P100, P102 & P98)
- 13:04, 21 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal
- 13:03, 21 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal
- 13:02, 21 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Tuesday, May 21st)
- 12:58, 21 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Sequencing of P105, P28, P100, P102 & P98)
- 12:58, 21 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Sequencing of P105, P28, P100, P102 & P98)
- 12:57, 21 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Tuesday, May 21st)
- 12:44, 21 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Tuesday, May 21st)
- 12:41, 21 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Quick Change mutagenesis to remove forbidden restriction sites of P28 (Laccase), P100 (TEV S219V), P102 (EreB))
- 12:40, 21 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Sunday, May 19th)
- 17:58, 19 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Transformation of the Quickchange products with P28, P98 and P100 into E. coli XL1 blue)
- 17:58, 19 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Sunday, May 19th)
- 17:58, 19 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Sunday, May 19th)
- 17:53, 19 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Quick Change mutagenesis to remove forbidden restriction sites of P28 (Laccase), P98 (TEV S219V), P100 (EreB))
- 17:51, 19 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Quick Change mutagenesis to remove forbidden restriction sites of P28 (Laccase), P98 (TEV S219V), P100 (EreB))
- 17:43, 19 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Sunday, May 19th)
- 17:35, 19 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Saturday, May 18th)
- 17:34, 19 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Saturday, May 18th)
- 17:14, 18 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Preparative digestion of pSH21 (P61), psB1A2(P41))
- 15:55, 18 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Preparative digestion of pSH21 (P61), psB1A2(P41))
- 15:55, 18 May 2013 (diff | hist) N File:TUM13 20130516 P96 XbaI.AgeI P61 EcoRI.png (top)
- 14:44, 17 May 2013 (diff | hist) N Team:TU-Munich/Results/Overview (Created page with "{{Team:TU-Munich/Header}}")
- 14:43, 17 May 2013 (diff | hist) Team:TU-Munich/Results/BioBricks
- 14:39, 17 May 2013 (diff | hist) Template:Team:TU-Munich/Menu (top)
- 14:11, 17 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Quick Change mutagenesis to remove mutations found by sequencing in our gene constructs)
- 14:11, 17 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Quick Change mutagenesis to remove mutations found by sequencing in our gene constructs)
- 14:10, 17 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Quick Change mutagenesis to remove mutations found by sequencing in our gene constructs)
- 14:02, 17 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Quick Change mutagenesis to remove mutations found by sequencing in our gene constructs)
- 14:00, 17 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Quick Change mutagenesis to remove mutations found by sequencing in our gene constructs)
- 13:58, 17 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Friday, May 17th)
- 22:07, 16 May 2013 (diff | hist) Team:TU-Munich/Team/Collaborations
- 22:07, 16 May 2013 (diff | hist) Team:TU-Munich/Team/Collaborations
- 22:06, 16 May 2013 (diff | hist) Team:TU-Munich/Team/Collaborations
- 02:02, 16 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Your Mom)
- 18:44, 15 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Your Mom)
- 18:43, 15 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Your Mom)
- 18:39, 15 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Your Mom)
- 17:53, 15 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Your Mom)
- 17:52, 15 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→PCR, purification and analytical geleletrophoresis of and EreB (P16))
- 17:38, 15 May 2013 (diff | hist) N File:TUM13 20130515 P90-P96 XbaI.png (top)
- 17:28, 15 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Miniprep of overnight culture of transformated E.~coli XL1-Blue with F10+F11)
- 17:26, 15 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Tuesday, May 14th)
- 17:26, 15 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Monday, May 13th)
- 17:25, 15 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Sunday, May 12th)
- 17:24, 15 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Picking of Plasmid P23 (CaMV35S) and Ligation Product F8 + F15 (TEV))
- 19:10, 14 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Picking of transformed Plasmid F10+F11 (AlcR blunt ligated with pSB1C3 for sequencing))
- 10:11, 14 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Purification and ligation of digested PCR product EreB (F14))
- 10:10, 14 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Purification and ligation of digested PCR product EreB (F14))
- 21:23, 13 May 2013 (diff | hist) m Team:TU-Munich/Team/Members
- 14:45, 13 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Transformation of E. coli XL1 blue with ligation products F8+F14 (EreB in pSB1C3, RFC25) and F8+F15 (TEV in pSB1C3, RFC25))
- 19:04, 12 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Picking of transformed Plasmid P62)
- 13:54, 12 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Analytical gelelectrophoresis of F15 (digested TEV PCR product))
- 13:54, 12 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Analytical digestion and gelelectrophoresis of P63 and P64 with AgeI-HF and XbaI)
- 13:53, 12 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Analytical digestion and gelelectrophoresis of P63 and P64 with AgeI-HF and XbaI)
- 13:51, 12 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Analytical gelelectrophoresis of F15 (digested TEV PCR product))
- 13:50, 12 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Analytical gelelectrophoresis of F15 (digested TEV PCR product))
- 13:50, 12 May 2013 (diff | hist) N File:TUM13 20130512 PCR F12.png (top)
- 13:48, 12 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Analytical digestion and gelelectrophoresis of P63 and P64 with AgeI-HF and XbaI)
- 13:47, 12 May 2013 (diff | hist) N File:TUM13 20130511 P63 P64 XbaI.png (top)
- 13:36, 12 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Saturday, May 11th)
- 13:35, 12 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Analytical gelelectrophoresis of F15 (digested TEV PCR product))
- 13:34, 12 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Preparative digestion of PCR product of S219V pRK793 (F12) with XbaI & AgeI)
- 13:28, 12 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Analytical gelelectrophoresis of F15 (digested TEV PCR product))
- 11:27, 12 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Saturday, May 11th)
- 10:25, 12 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal
- 10:22, 12 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal
- 10:21, 12 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Digestion of P61 with S1 Nuclease)
- 10:20, 12 May 2013 (diff | hist) Template:Team:TU-Munich/Header
- 09:19, 12 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Saturday, May 11th)
- 09:18, 12 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Saturday, May 11th)
- 09:10, 12 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Saturday, May 11th)
- 08:49, 12 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→PCR, purification and analytical geleletrophoresis of TEV (P14, pRK793))
- 08:48, 12 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→PCR of of P14 with öljafljafs)
- 14:12, 11 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Saturday, May 11th)
- 10:42, 11 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Preparative digestion and gelelectrophoresis of PCR product of EreB (F2) with XbaI & AgeI)
- 10:40, 11 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Saturday, May 11th)
- 10:40, 11 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→PCR Purification and ligation of digested EreB (F13))
- 10:22, 11 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Preparative digestion and gelelectrophoresis of PCR product of EreB (F2) with XbaI & AgeI)
- 10:21, 11 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→PCR Purification and ligation of PCR product of EreB (F2))
- 10:19, 11 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Preparative digestion and gelelectrophoresis of PCR product of EreB (F2) with XbaI & AgeI)
- 10:16, 11 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Friday, May 10th)
- 10:15, 11 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Saturday, May 11th)
- 10:14, 11 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Saturday, May 11th)
- 10:11, 11 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Saturday, May 11th)
- 10:04, 11 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Saturday, May 11th)
- 09:55, 11 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Saturday, May 11th)
- 09:48, 11 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Week 3)
- 09:45, 11 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Week 3)
- 09:43, 11 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Friday, May 10th)
- 18:39, 10 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Quick Change mutagenesis to remove mutations found by sequencing in our gene constructs)
- 18:37, 10 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Quick Change mutagenesis to remove mutations found by sequencing in our gene constructs)
- 18:10, 10 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Quick Change mutagenesis to remove mutations found by sequencing in our gene constructs)
- 16:44, 10 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Thursday, May 9th)
- 16:42, 10 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal
- 16:42, 10 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal
- 15:59, 10 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Friday, May 10th)
- 15:58, 10 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Friday, May 10th)
- 15:35, 10 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal
- 15:34, 10 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Week 3)
- 15:33, 10 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Friday, May 10th)
- 15:32, 10 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Friday, May 10th)
- 15:30, 10 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Friday, May 10th)
- 15:30, 10 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Friday, May 10th)
- 15:28, 10 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Thursday, May 9th)
- 15:27, 10 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Friday, May 10th)
- 15:25, 10 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Quick Change mutagenesis to remove mutations found by sequencing in our gene constructs)
- 15:22, 10 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Quick Change mutagenesis to remove mutations found by sequencing in our gene constructs)
- 15:21, 10 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Quick Change mutagenesis to remove mutations found by sequencing in our gene constructs)
- 15:20, 10 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Quick Change mutagenesis to remove mutations found by sequencing in our gene constructs)
- 14:34, 10 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Thursday, May 9th)
- 14:33, 10 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Quick Change mutagenesis to remove mutations found by sequencing in our gene constructs)
- 14:32, 10 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Quick Change mutagenesis to remove mutations found by sequencing in our gene constructs)
- 14:32, 10 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Transformation of E. coli XL1 blue with F8(pSB1C3)+F6(EreA) and F8(pSB1C3)+F7(EreB))
- 14:31, 10 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Thursday, May 9th)
- 11:13, 9 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Thursday, May 9th)
- 11:07, 9 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Wednesday, May 8th)
- 18:52, 8 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Midiprep of blablablablökadflkjasdfd)
- 18:52, 8 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Week 3)
- 18:50, 8 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Wednesday, May 8th)
- 18:49, 8 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Preparative digestion and gelelectrophoresis of PCR product of EreA (F1) and EreB (F2) with XbaI & AgeI)
- 18:49, 8 May 2013 (diff | hist) N File:TUM13 20130508 F1 F2 P52 Xb.png (top)
- 18:43, 8 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Wednesday, May 8th)
- 15:44, 8 May 2013 (diff | hist) m Team:TU-Munich (→PhyscoFilter)
- 21:25, 7 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Preparative digestion and gelelectrophoresis of PhyB (P9) and PIF3-20aa linker (P50) with AgeI and PstI as well as 20aalinker-PIF3 (P51) with EcoRI and NgoMIV)
- 21:23, 7 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→PCR, purification and analytical geleletrophoresis of EreA (P15) and EreB (P16))
- 21:21, 7 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→PCR, purification and analytical geleletrophoresis of EreA (P15) and EreB (P16))
- 21:14, 7 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→PCR, purification and analytical geleletrophoresis of EreA (P15) and EreB (P16))
- 21:13, 7 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Preparative digestion and gelelectrophoresis of PhyB (P9) and PIF3-20aa linker (P50) with AgeI and PstI as well as 20aalinker-PIF3 (P51) with EcoRI and NgoMIV)
- 20:59, 7 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→PCR, purification and analytical geleletrophoresis of EreA (P15) and EreB (P16))
- 20:41, 7 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Preparative digestion and gelelectrophoresis of PhyB (P9) and PIF3-20aa linker (P50) with AgeI and PstI as well as 20aalinker-PIF3 (P51) with EcoRI and NgoMIV)
- 20:40, 7 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Preparative digestion and gelelectrophoresis of PhyB (P9) and PIF3-20aa linker (P50) with AgeI and PstI as well as 20aalinker-PIF3 (P51) with EcoRI and NgoMIV)
- 20:38, 7 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→PCR, purification and analytical geleletrophoresis of EreA (P15) and EreB (P16))
- 19:20, 7 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→PCR of EreA (P15) and EreB (P16))
- 19:19, 7 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Preparative digestion and gelelectrophoresis of PhyB (P9) and PIF3-20aa linker (P50) with AgeI and PstI as well as 20aalinker-PIF3 (P51) with EcoRI and NgoMIV)
- 19:18, 7 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→PCR of EreA (P15) and EreB (P16))
- 19:17, 7 May 2013 (diff | hist) File:TUM13 20130507 P15 P16 PCR.png (uploaded a new version of "File:TUM13 20130507 P15 P16 PCR.png") (top)
- 19:17, 7 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Preparative digestion and gelelectrophoresis of PhyB (P9) and PIF3-20aa linker (P50) with AgeI and PstI as well as 20aalinker-PIF3 (P51) with EcoRI and NgoMIV)
- 19:17, 7 May 2013 (diff | hist) N File:TUM13 20130507 P9 AgeI.PstI P50 AgeI.PstI P51 EcoRI.NgoMIV.png (top)
- 19:15, 7 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→PCR of EreA (P15) and EreB (P16))
- 19:14, 7 May 2013 (diff | hist) N File:TUM13 20130507 P9 AgeI.PstI P50 A.png (top)
- 19:13, 7 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Preparative digestion and gelelectrophoresis of PhyB (P9) and PIF3-20aa linker (P50) with AgeI and PstI as well as 20aalinker-PIF3 (P51) with EcoRI and NgoMIV)
- 19:12, 7 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Preparative digestion and gelelectrophoresis of PhyB (P9) and PIF3-20aa linker (P50) with AgeI and PstI as well as 20aalinker-PIF3 (P51) with EcoRI and NgoMIV)
- 19:11, 7 May 2013 (diff | hist) N File:TUM13 20130507 P15 P16 PCR.png
- 19:11, 7 May 2013 (diff | hist) N File:20130507 P9 AgeI.PstI P50 A.png (top)
- 17:38, 7 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→PCR of EreA (P15) and EreB (P16))
- 17:37, 7 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal
- 14:42, 7 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal
- 13:48, 7 May 2013 (diff | hist) Team:TU-Munich/Notebook/Materials
- 11:22, 7 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal
- 17:33, 6 May 2013 (diff | hist) Team:TU-Munich/Notebook/Materials
- 17:32, 6 May 2013 (diff | hist) Team:TU-Munich/Notebook/Materials
- 17:30, 6 May 2013 (diff | hist) Team:TU-Munich/Notebook/Materials
- 12:14, 6 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal
- 12:14, 6 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal
- 12:11, 6 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal
- 12:08, 6 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal
- 12:07, 6 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal
- 12:06, 6 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal
- 12:04, 6 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal
- 12:01, 6 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal
- 21:20, 5 May 2013 (diff | hist) N Team:TU-Munich/Notebook/Materials (Created page with "{{Team:TU-Munich/Header}} =Oligonucleotides= {|cellspacing="0" border="1" |Name |Sequence |- |EreA_for |<code>5’- GCGCGTCTAGATGGCCGGCACGTGGAGAACGACCAGA -3‘</code><br> |- ...")
- 21:10, 5 May 2013 (diff | hist) Template:Team:TU-Munich/Menu
- 15:30, 5 May 2013 (diff | hist) Team:TU-Munich/Team/Attributions
- 16:59, 3 May 2013 (diff | hist) Template:Team:TU-Munich/Header
- 16:59, 3 May 2013 (diff | hist) Template:Team:TU-Munich/Header
- 16:57, 3 May 2013 (diff | hist) Template:Team:TU-Munich/Header
- 16:56, 3 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal
- 16:55, 3 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal
- 16:54, 3 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal
- 16:48, 3 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal
- 16:46, 3 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal
- 12:14, 2 May 2013 (diff | hist) Template:Team:TU-Munich/Header
- 12:12, 2 May 2013 (diff | hist) Template:Team:TU-Munich/Header
- 12:10, 2 May 2013 (diff | hist) Template:Team:TU-Munich/Header
- 12:08, 2 May 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal
- 23:21, 1 May 2013 (diff | hist) Team:TU-Munich/Results/BioBricks
- 19:42, 1 May 2013 (diff | hist) Template:Team:TU-Munich/Header
- 19:41, 1 May 2013 (diff | hist) Template:Team:TU-Munich/Header
- 19:39, 1 May 2013 (diff | hist) Template:Team:TU-Munich/Header
- 19:37, 1 May 2013 (diff | hist) Team:TU-Munich
- 19:36, 1 May 2013 (diff | hist) Template:Team:TU-Munich/Header
- 19:33, 1 May 2013 (diff | hist) Template:Team:TU-Munich/Header
- 19:31, 1 May 2013 (diff | hist) Template:Team:TU-Munich/Header
- 19:31, 1 May 2013 (diff | hist) Template:Team:TU-Munich/Header
- 19:28, 1 May 2013 (diff | hist) Team:TU-Munich (→iGEM TU-Munich 2013 Team)
- 16:32, 1 May 2013 (diff | hist) Team:TU-Munich/Team/Members
- 15:34, 1 May 2013 (diff | hist) Team:TU-Munich (→iGEM TU-Munich 2013 Team)
- 15:16, 1 May 2013 (diff | hist) Team:TU-Munich
- 14:06, 1 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Week 2)
- 13:57, 1 May 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Analytical digestion and gelelectrophoresis of mINF1 and Leptin with HindIII and EheI)
- 11:44, 30 April 2013 (diff | hist) Team:TU-Munich
- 11:43, 30 April 2013 (diff | hist) Team:TU-Munich
- 11:43, 30 April 2013 (diff | hist) Team:TU-Munich
- 11:42, 30 April 2013 (diff | hist) Team:TU-Munich
- 11:41, 30 April 2013 (diff | hist) Team:TU-Munich
- 11:41, 30 April 2013 (diff | hist) Team:TU-Munich
- 11:40, 30 April 2013 (diff | hist) N File:TUM13 Gruppenfoto iGEM.jpg
- 11:38, 30 April 2013 (diff | hist) Team:TU-Munich
- 16:41, 23 April 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Analytical digestion and gelelectrophoresis of RFP-generator (RFC25, pSB1C3, P4 & P5))
- 16:39, 23 April 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Analytical digestion and gelelectrophoresis of RFP-generator (RFC25, pSB1C3, P4 & P5))
- 16:38, 23 April 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal
- 16:29, 23 April 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Monday, April 23rd)
- 16:28, 23 April 2013 (diff | hist) N File:TUM13 20130423 RFP Generator RFC25 AgeI NgoMIV.png (top)
- 16:27, 23 April 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal
- 16:17, 23 April 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal
- 16:10, 23 April 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Monday, April 22nd)
- 16:03, 23 April 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal
- 14:06, 23 April 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal
- 14:06, 23 April 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal
- 09:21, 23 April 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Transformation of E.coli XL1 blue with Phytochrome B (2-908 N-terminal amino acids) (BBa_K801031, RFC25, pSB1C3))
- 09:21, 23 April 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Transformation of E.coli XL1 blue with Phytochrome B (2-908 N-terminal amino acids) (BBa_K801031, RFC25, pSB1C3))
- 09:20, 23 April 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal
- 09:17, 23 April 2013 (diff | hist) m Team:TU-Munich/Notebook/Labjournal (→Transformation of E.coli XL1 blue with Phytochrome B (2-908 N-terminal amino acids) (BBa_K801031, RFC25, pSB1C3))
- 09:16, 23 April 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal (→Monday, April 22nd)
- 09:10, 23 April 2013 (diff | hist) Template:Team:TU-Munich/LabHeader
- 09:09, 23 April 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal
- 09:00, 23 April 2013 (diff | hist) Team:TU-Munich/Notebook/Labjournal
- 08:58, 23 April 2013 (diff | hist) Template:Team:TU-Munich/LabHeader
(Latest | Earliest) View (newer 250 | older 250) (20 | 50 | 100 | 250 | 500)