Team:Heidelberg/Templates/DelH week1
From 2013.igem.org
(Difference between revisions)
Nils.kurzawa (Talk | contribs) m (Created page with " == 29-04 - 05-05-13 == ===Generation of Plasmid Backbones=== ====Transformation of Biobricks==== {| class="wikitable" |- ! Part of the registry !! Plate of 2012 !! Well !! Res...") |
|||
Line 41: | Line 41: | ||
! Identifier !! Order date !! Note !! Sequence | ! Identifier !! Order date !! Note !! Sequence | ||
|- | |- | ||
- | | DN01:DelH_f1_PacI_fw || 03-05-2013 || Amplification of DelH F1, with RBS and adding PacI restriction site || | + | | DN01:DelH_f1_PacI_fw || 03-05-2013 || Amplification of DelH F1, with RBS and adding PacI restriction site || TTTT TTAATTAA TCACACAGGAAAGTACTAG ATGGACCGTGGCCGCCTGC GCCAAATCG |
|- | |- | ||
- | | DN02:DelH_f1_SalI_rev || 03-05-2013 || Amplification of DelH F1 until SalI restriction site || | + | | DN02:DelH_f1_SalI_rev || 03-05-2013 || Amplification of DelH F1 until SalI restriction site || TTTT GTCGACCAACACCTGTGCCTGC |
|- | |- | ||
- | | DN03:DelH_f2_SalI_fw || 03-05-2013 || Amplification of DelH F2 starting at SalI restriction site|| | + | | DN03:DelH_f2_SalI_fw || 03-05-2013 || Amplification of DelH F2 starting at SalI restriction site|| TTTT GTCGACTGGATGGAGCCTGGTGAAAG |
|- | |- | ||
- | | DN04:DelH_f2_KpnI_rev || 03-05-2013 || Amplification of DelH F2, adding KpnII restriction site || | + | | DN04:DelH_f2_KpnI_rev || 03-05-2013 || Amplification of DelH F2, adding KpnII restriction site || TTTT GGTACC TCAGTCCAGCGCGTACTCCAG |
|- | |- | ||
- | | DN05:AraCbb_KpnI_fw || 03-05-2013 || Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding KpnI site || | + | | DN05:AraCbb_KpnI_fw || 03-05-2013 || Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding KpnI site || TTTT GGTACC AAAGAGGAGAAATACTAGATGACCATG |
|- | |- | ||
- | | DN08:AraCbb_PacI_rev || 03-05-2013 || Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding PacI site || | + | | DN08:AraCbb_PacI_rev || 03-05-2013 || Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding PacI site || TTTT TTAATTAA GCTAGCCCAAAAAAACGGGTATG |
|} | |} | ||
<br/> | <br/> |
Latest revision as of 11:21, 23 October 2013
Contents |
29-04 - 05-05-13
Generation of Plasmid Backbones
Transformation of Biobricks
Part of the registry | Plate of 2012 | Well | Resistance |
---|---|---|---|
pSB4K5 (insert=J04450) | 1 | 5G | Kanamycin |
pSB6A1 (insert=J04450) | 1 | 1K | Ampicillin |
lacZ (I732019) in pSB1AK3 | 4 | 12G | Kanamycin, Ampicillin |
AraC (I0500) in pSB2K3 | 1 | 14N | Kanamycin |
pSB1C3 (insert=J04450) | 1 | 3A | Chloramphenicol |
- Added 10 µl H2O to each well
- Incubated for 10 min at RT
- Thawed 5x chemical competent E.coli Top10
- 3 µl of plasmid DNA were added
- Incubated for 10 min on ice
- Heat shock for 40 s at 42.2°C
- Incubated for 10 min on ice
- Added 500 µl LB Medium
- Incubated at 37°C for 40 min
- Centrifuged 120 at 5,000 rpm, supernatant discarded
- Pellet resuspended in remaining medium
- Plated on plates with the corresponding antibiotics (as shown in the table above, section: resistances)
- Incubated for 2 days at RT
- One colony was picked from each plate and incubated over night at 37°C in LB medium with the antibiotic listed above
Result
All 5 parts from the Registry Distribution 2012 were successfully transformed in E.coli Top10 except for the one containing the AraC promotor.
Amplification of DelH Fragments
Design of Primers
Identifier | Order date | Note | Sequence |
---|---|---|---|
DN01:DelH_f1_PacI_fw | 03-05-2013 | Amplification of DelH F1, with RBS and adding PacI restriction site | TTTT TTAATTAA TCACACAGGAAAGTACTAG ATGGACCGTGGCCGCCTGC GCCAAATCG |
DN02:DelH_f1_SalI_rev | 03-05-2013 | Amplification of DelH F1 until SalI restriction site | TTTT GTCGACCAACACCTGTGCCTGC |
DN03:DelH_f2_SalI_fw | 03-05-2013 | Amplification of DelH F2 starting at SalI restriction site | TTTT GTCGACTGGATGGAGCCTGGTGAAAG |
DN04:DelH_f2_KpnI_rev | 03-05-2013 | Amplification of DelH F2, adding KpnII restriction site | TTTT GGTACC TCAGTCCAGCGCGTACTCCAG |
DN05:AraCbb_KpnI_fw | 03-05-2013 | Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding KpnI site | TTTT GGTACC AAAGAGGAGAAATACTAGATGACCATG |
DN08:AraCbb_PacI_rev | 03-05-2013 | Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding PacI site | TTTT TTAATTAA GCTAGCCCAAAAAAACGGGTATG |