Team:Manchester/LabBooktest
From 2013.igem.org
(Difference between revisions)
Abramov denn (Talk | contribs) |
|||
(33 intermediate revisions not shown) | |||
Line 224: | Line 224: | ||
left:0; | left:0; | ||
padding:10px; | padding:10px; | ||
- | background-color: | + | background-color:#f2f2f2; |
-webkit-box-shadow: 0px 0px 5px 0px rgba(0,0,0,0.75); | -webkit-box-shadow: 0px 0px 5px 0px rgba(0,0,0,0.75); | ||
Line 377: | Line 377: | ||
width:65px; | width:65px; | ||
height:65px; | height:65px; | ||
+ | } | ||
+ | |||
+ | .slider-container | ||
+ | { | ||
+ | margin:10px 0 10px 20px; | ||
+ | width:890px; | ||
+ | height:320px; | ||
+ | background-color:#F2F2F2; | ||
+ | padding:10px; | ||
+ | |||
+ | -webkit-box-shadow: 0px 0px 5px 0px rgba(0,0,0,0.75); | ||
+ | -moz-box-shadow: 0px 0px 5px 0px rgba(0,0,0,0.75); | ||
+ | box-shadow: 0px 0px 5px 0px rgba(0,0,0,0.75); | ||
} | } | ||
Line 424: | Line 437: | ||
display:block; | display:block; | ||
width:900px; | width:900px; | ||
- | |||
text-decoration:none; | text-decoration:none; | ||
margin-bottom:5px; | margin-bottom:5px; | ||
Line 432: | Line 444: | ||
color:white; | color:white; | ||
background-color:#660099; | background-color:#660099; | ||
- | padding | + | padding:7px 5px 5px 5px; |
-webkit-border-radius: 10px; | -webkit-border-radius: 10px; | ||
Line 442: | Line 454: | ||
} | } | ||
- | .menu li a | + | .menu li a #date |
{ | { | ||
margin-left:10px; | margin-left:10px; | ||
- | margin-right: | + | margin-right:10px; |
} | } | ||
- | #text, #text1, #text2, #text3,#text4,#text5,#text6,#text7,#text8,#text9,#text10,#text11,#text12,#text13,#text14,#text15 | + | .menu li a #arrow |
+ | { | ||
+ | margin-left:10px; | ||
+ | } | ||
+ | |||
+ | #text, #text1, #text2, #text3,#text4,#text5,#text6,#text7,#text8,#text9,#text10,#text11,#text12,#text13,#text14,#text15, | ||
+ | #text16, #text17, #text18, #text19,#text20,#text21,#text22,#text23,#text24,#text25,#text26,#text27,#text28,#text29,#text30,#text31,#text32, #text33, #text34, #text35,#text36,#text37,#text38,#text39,#text40,#text41,#text42,#text43,#text44,#text45 | ||
{ | { | ||
margin:0 auto; | margin:0 auto; | ||
Line 458: | Line 476: | ||
color:white; | color:white; | ||
background-color:#BDBDBD; | background-color:#BDBDBD; | ||
- | + | padding:5px; | |
- | + | ||
- | + | ||
-webkit-box-shadow: 0px 0px 5px 0px rgba(0,0,0,0.75); | -webkit-box-shadow: 0px 0px 5px 0px rgba(0,0,0,0.75); | ||
Line 574: | Line 590: | ||
</head> | </head> | ||
- | <body onLoad="blocking('text'); blocking('text1'); blocking('text2');blocking('text4'); blocking('text5'); blocking('text6'); blocking('text7'); blocking('text8'); blocking('text9'); blocking('text10'); blocking('text11'); blocking('text12'); blocking('text13'); blocking('text14');blocking('text15'); hover1(); hover2(); hover3(); hover4(); hover5(); hover6(); hover7(); highlight | + | <body onLoad="showImage(); blocking('text'); blocking('text1'); blocking('text2');blocking('text4'); blocking('text5'); blocking('text6'); blocking('text7'); blocking('text8'); blocking('text9'); blocking('text10'); blocking('text11'); blocking('text12'); blocking('text13'); blocking('text14');blocking('text15'); blocking('text16'); blocking('text17'); blocking('text18'); blocking('text19'); blocking('text20');blocking('text21'); blocking('text22'); blocking('text23');blocking('text24'); blocking('text25'); blocking('text26'); blocking('text27'); blocking('text28'); blocking('text29'); blocking('text30');blocking('text31'); blocking('text32');blocking('text33'); blocking('text34'); blocking('text35'); blocking('text36'); blocking('text37'); blocking('text38'); blocking('text39'); blocking('text40');blocking('text41'); blocking('text42');blocking('text43');blocking('text44');blocking('text45'); |
+ | hover1(); hover2(); hover3(); hover4(); hover5(); hover6(); hover7(); highlight(); "> | ||
<div class="header"> | <div class="header"> | ||
Line 603: | Line 620: | ||
<div id="block"> | <div id="block"> | ||
<img src="https://static.igem.org/mediawiki/2013/7/74/Home.gif" width="50" height="50" id="image1"/> | <img src="https://static.igem.org/mediawiki/2013/7/74/Home.gif" width="50" height="50" id="image1"/> | ||
- | <a href="https://2013.igem.org/Team:Manchester/ | + | <a href="https://2013.igem.org/Team:Manchester/Hometest3" id="link1">Home</a> |
</div> | </div> | ||
Line 639: | Line 656: | ||
<li><a href="https://2013.igem.org/Team:Manchester/Modellingtest" id="link6">Modelling</a> | <li><a href="https://2013.igem.org/Team:Manchester/Modellingtest" id="link6">Modelling</a> | ||
<ul class="submenu"> | <ul class="submenu"> | ||
- | <li><a href="https://2013.igem.org/Team:Manchester/ | + | |
- | + | <li><a href="https://2013.igem.org/Team:Manchester/parametertest" id="link6">Uncertainty Analysis</a></li> | |
+ | <li><a href="https://2013.igem.org/Team:Manchester/fabAmodeltest" id="link6">FabA Dynamics Model</a></li> | ||
+ | <li><a href="https://2013.igem.org/Team:Manchester/popdynamictest" id="link6">Population Dynamics</a></li> | ||
<li><a href="https://2013.igem.org/Team:Manchester/collabtest" id="link6">Modelling Collaboration</a></li> | <li><a href="https://2013.igem.org/Team:Manchester/collabtest" id="link6">Modelling Collaboration</a></li> | ||
</ul> | </ul> | ||
</li> | </li> | ||
</ul> | </ul> | ||
- | </div> | + | </div> |
<div id="block4"> | <div id="block4"> | ||
Line 661: | Line 680: | ||
<ul class="submenu2"> | <ul class="submenu2"> | ||
<li><a href="https://2013.igem.org/Team:Manchester/environmenttest" id="link4">Environmental Impact</a></li> | <li><a href="https://2013.igem.org/Team:Manchester/environmenttest" id="link4">Environmental Impact</a></li> | ||
- | <li><a href="https://2013.igem.org/Team:Manchester/economytest" id="link4"> | + | <li><a href="https://2013.igem.org/Team:Manchester/economytest" id="link4">Economic Impact</a></li> |
<li><a href="https://2013.igem.org/Team:Manchester/managementtest" id="link4">Impact Management</a></li> | <li><a href="https://2013.igem.org/Team:Manchester/managementtest" id="link4">Impact Management</a></li> | ||
<li><a href="https://2013.igem.org/Team:Manchester/conclusiontest" id="link4">Conclusion</a></li> | <li><a href="https://2013.igem.org/Team:Manchester/conclusiontest" id="link4">Conclusion</a></li> | ||
</ul> | </ul> | ||
</li> | </li> | ||
- | + | <li><a href="https://2013.igem.org/Team:Manchester/businesstest" id="link4">Business Plan</a></li> | |
+ | <li><a href="https://2013.igem.org/Team:Manchester/collabtest" id="link4">Modelling Collaboration</a></li> | ||
<li><a href="https://2013.igem.org/Team:Manchester/knoledgetest" id="link4">Knowledge Deficit Assumption</a></li> | <li><a href="https://2013.igem.org/Team:Manchester/knoledgetest" id="link4">Knowledge Deficit Assumption</a></li> | ||
<li><a href="https://2013.igem.org/Team:Manchester/conferencetest" id="link4">Conferences and Discussions</a></li> | <li><a href="https://2013.igem.org/Team:Manchester/conferencetest" id="link4">Conferences and Discussions</a></li> | ||
Line 683: | Line 703: | ||
<div class="wrapper" > | <div class="wrapper" > | ||
- | <div class="slider"> | + | |
- | <img src="https://static.igem.org/mediawiki/2013/ | + | <div class="slider-container"> |
- | <img src="https://static.igem.org/mediawiki/2013/ | + | <div class="slider"> |
- | <img src="https://static.igem.org/mediawiki/2013/7/ | + | <img src="https://static.igem.org/mediawiki/2013/7/79/Microwave.jpg" id="1"/> |
- | <img src="https://static.igem.org/mediawiki/2013/ | + | <img src="https://static.igem.org/mediawiki/2013/5/51/Flasks.jpg" id="2"/> |
- | <img src="https://static.igem.org/mediawiki/2013/ | + | <img src="https://static.igem.org/mediawiki/2013/7/77/Lab1.jpg" id="3"/> |
- | <img src="https://static.igem.org/mediawiki/2013/ | + | <img src="https://static.igem.org/mediawiki/2013/3/3a/Lab3.jpg" id="4"/> |
- | <img src="https://static.igem.org/mediawiki/2013/ | + | <img src="https://static.igem.org/mediawiki/2013/e/eb/Lab4.jpg" id="5"/> |
- | <img src="https://static.igem.org/mediawiki/2013/ | + | <img src="https://static.igem.org/mediawiki/2013/8/85/GelExtractManc.jpg" id="6"/> |
- | <img src="https://static.igem.org/mediawiki/2013/c/ | + | <img src="https://static.igem.org/mediawiki/2013/c/c9/Lab5.jpg" id="7"/> |
- | </div> | + | <img src="https://static.igem.org/mediawiki/2013/a/a0/DivRalf.jpg" id="8"/> |
+ | <img src="https://static.igem.org/mediawiki/2013/4/42/Lab6.jpg" id="9"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/c/cd/Lab8.png" id="10"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/6/61/Lab24.jpg" id="11"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/1/1f/Lab10.jpg" id="12"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/c/c4/Lab18.jpg" id="13"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/4/40/Lab21.jpg" id="14"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/3/33/Lab7.jpg" id="15"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/e/e2/MancMedia.jpg" id="16"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/5/5f/Electroporation%21.jpg" id="17"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/4/49/Lab9.png" id="18"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/9/91/Lab22.png" id="19"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/8/87/Lab17.jpg" id="20"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/7/73/Lab12.jpg" id="21"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/f/fe/Lab11.jpg" id="22"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/5/55/Robelsatim.jpg" id="23"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/9/95/MancShop.jpg" id="24"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/9/9b/Vials.jpg" id="25"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/a/a1/Lab13.png" id="26"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/a/a9/Whataguy.jpg" id="27"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/d/df/Piclab1.jpg" id="28"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/8/87/Piclab3.jpg" id="29"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/a/a9/Piclab4.jpg" id="30"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/8/84/Piclab7.jpg" id="31"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/8/8c/Piclab5.jpg" id="32"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/8/80/Piclab6.jpg" id="33"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/a/ab/Piclab11.jpg" id="34"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/0/00/Piclab8.jpg" id="35"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/7/76/Piclab9.jpg" id="36"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/2/21/Piclab10.jpg" id="37"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/a/a6/Piclab12.jpg" id="38"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/a/a0/Piclab2.jpg" id="39"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/0/05/Piclab13.jpg" id="40"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/b/b0/Piclab15.jpg" id="41"/> | ||
+ | <img src="https://static.igem.org/mediawiki/2013/6/60/Piclab14.jpg" id="42"/> | ||
+ | </div> | ||
+ | </div> | ||
<ul class="menu"> | <ul class="menu"> | ||
- | <li id="one"><a href="" onclick="blocking('text'); return false;"><span>14/06/2013</span> | + | <li id="one"><a href="" onclick="blocking('text'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">14/06/2013 </span> Making media</a> |
<div id="text"> | <div id="text"> | ||
<p> | <p> | ||
Line 707: | Line 763: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text1'); return false;"><span> | + | <li id="one"><a href="" onclick="blocking('text1'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">19/06/2013</span> Preparation of Chemically competent Cells</a> |
<div id="text1"> | <div id="text1"> | ||
<p> | <p> | ||
Line 738: | Line 794: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text2'); return false;"><span> | + | <li id="one"><a href="" onclick="blocking('text2'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">20/06/2013</span> FadD Knock Out Part 1 </a> |
<div id="text2"> | <div id="text2"> | ||
<p> | <p> | ||
Line 752: | Line 808: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text4'); return false;"><span> | + | <li id="one"><a href="" onclick="blocking('text4'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">21/06/2013</span> Continued</a> |
<div id="text4"> | <div id="text4"> | ||
<p> | <p> | ||
Line 764: | Line 820: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text5'); return false;"><span> | + | <li id="one"><a href="" onclick="blocking('text5'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">24/06/2013</span> Growing Cells From 21/06/2013 </a> |
<div id="text5"> | <div id="text5"> | ||
<p> | <p> | ||
Line 774: | Line 830: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text6'); return false;"><span> | + | <li id="one"><a href="" onclick="blocking('text6'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">25/06/2013</span> Electrically Competent Cells For Electroporation (E.Coli BL21 DE3) </a> |
<div id="text6"> | <div id="text6"> | ||
<p> | <p> | ||
Line 786: | Line 842: | ||
<p><i>Preparation of cells</i></p> | <p><i>Preparation of cells</i></p> | ||
<p>At an OD of 0.6:</p> | <p>At an OD of 0.6:</p> | ||
- | <p>Centrifuge 1: transfer the cultures to ice-cold centrifuge bottles. Harvest the cells by centrifugation at 2000g for 20 minutes at 4 ⁰C. Decant the | + | <p>Centrifuge 1: transfer the cultures to ice-cold centrifuge bottles. Harvest the cells by centrifugation at 2000g for 20 minutes at 4 ⁰C. Decant the supernatant and resuspend the cell pellet in 50 ml of ice-cold sterilised water.</p> |
<p>Centrifuge 2: harvest the cells by centrifuge at 2000g for 20 minutes at 4⁰C. Decant the supernatant and resuspend the cell pellet in 20 ml ice-cold sterilised water</p> | <p>Centrifuge 2: harvest the cells by centrifuge at 2000g for 20 minutes at 4⁰C. Decant the supernatant and resuspend the cell pellet in 20 ml ice-cold sterilised water</p> | ||
<p>Centrifuge 3: harvest the cells by centrifuge at 2000g for 20 minutes at 4⁰C . Decant the supernatant and resuspend the cell pellet in 1-2 ml ice-cold 10% glycerol. | <p>Centrifuge 3: harvest the cells by centrifuge at 2000g for 20 minutes at 4⁰C . Decant the supernatant and resuspend the cell pellet in 1-2 ml ice-cold 10% glycerol. | ||
Line 794: | Line 850: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text7'); return false;"><span> | + | <li id="one"><a href="" onclick="blocking('text7'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">26/06/2013 </span> Electroporation of PKD46 in E.Coli BL21 DE3 from 25/06/2013</a> |
<div id="text7"> | <div id="text7"> | ||
<p> | <p> | ||
Line 808: | Line 864: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text8'); return false;"><span> | + | <li id="one"><a href="" onclick="blocking('text8'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">27/06/2013</span> Transformation Results </a> |
<div id="text8"> | <div id="text8"> | ||
<p> | <p> | ||
Line 842: | Line 898: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text9'); return false;"><span> | + | <li id="one"><a href="" onclick="blocking('text9'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">28/06/2013</span> Further selection of Transformed cells and verification </a> |
<div id="text9"> | <div id="text9"> | ||
<p> | <p> | ||
Line 850: | Line 906: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text10'); return false;"><span> | + | <li id="one"><a href="" onclick="blocking('text10'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">01/07/2013</span> Continued </a> |
- | <div id="text10"> | + | <div id="text10"> |
<p> | <p> | ||
- | <p> | + | <p>Overnight colonies of plated electroporated cells created. Incubated overnight at 30 C |
- | + | ||
</div> | </div> | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text11'); return false;"><span> | + | <li id="one"><a href="" onclick="blocking('text11'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">02/07/2013</span> Primer ordering </a> |
<div id="text11"> | <div id="text11"> | ||
<p> | <p> | ||
Line 875: | Line 930: | ||
<p>5’ GGGTTGTGGTAATTCGCC 3’</p> | <p>5’ GGGTTGTGGTAATTCGCC 3’</p> | ||
<br> | <br> | ||
- | |||
- | |||
</p> | </p> | ||
</div> | </div> | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text12'); return false;"><span> | + | <li id="one"><a href="" onclick="blocking('text12'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">04/07/2013</span> Induction of Lambda Red Recombinase & Electro-Competency of transformed cells</a> |
<div id="text12"> | <div id="text12"> | ||
<p> | <p> | ||
Line 895: | Line 948: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text13'); return false;"><span> | + | <li id="one"><a href="" onclick="blocking('text13'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">09/07/2013</span> PCR of Chloramphenicol and Homologous regions </a> |
<div id="text13"> | <div id="text13"> | ||
<p> | <p> | ||
Line 997: | Line 1,050: | ||
</li> | </li> | ||
- | <li id="one"><a href="" onclick="blocking('text14'); return false;"><span> | + | <li id="one"><a href="" onclick="blocking('text14'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">10/07/2013</span> Agarose Gel Electrophoresis of PCR product from 09/07</a> |
<div id="text14"> | <div id="text14"> | ||
<p> | <p> | ||
Line 1,010: | Line 1,063: | ||
<p>Result of PCR: FAILURE</p> | <p>Result of PCR: FAILURE</p> | ||
- | |||
<br> | <br> | ||
</p> | </p> | ||
</div> | </div> | ||
- | </li> | + | </li> |
- | + | <li id="one"><a href="" onclick="blocking('text15'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">11/07/2013 </span> Received FAS Module - Plating up</a> | |
- | + | ||
<div id="text15"> | <div id="text15"> | ||
- | + | <p> | |
+ | <p>2 vials of stab culture received from Prof Mattheos Koffas of the Rensselaer Polytechnic Institute, NY, USA (2x DH5α w/pETM6-CnFatB2-fabAH<sup>*</sup>GI in Amp80</p> | ||
+ | <p>1 vial kept at 4 ºC and other vial plated on LB with Amp100</p> | ||
+ | <p>Left on bench for 3 hours and then placed in a 30 ºC incubator</p> | ||
+ | <p>Second plate, Amp 50µg/ml, plated w/DH5α w/pETM6-CnFatB2-fabAH<sup>*</sup>GI and placed in 30 ºC incubator</p> | ||
+ | <p>Both plates removed and left on bench overnight</p> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
- | + | <li id="one"><a href="" onclick="blocking('text16'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">15/07/2013 </span> Stock of FAS cells for freezer</a> | |
+ | <div id="text16"> | ||
+ | <p> | ||
+ | <p>Successful growth found on the plates over the weekend. Stock made using the following protocol:</p> | ||
+ | <p>1) Make 10 ml of LB and 100 µg/ml of Ampicillin</p> | ||
+ | <p>2) Inoculate media with cells on plates w/FAS</p> | ||
+ | <p>3) Grow at 37 ºC for 5 hours</p> | ||
+ | <p>4) Spin cells down in centrifuge</p> | ||
+ | <p>5) Resuspend in 700 µl of LB and glycerol</p> | ||
+ | <br> | ||
+ | <p><b>18/07/2013: Growing up DH5α for plasmid extraction</b></p> | ||
+ | <p>1) 100 ml of LB w/100 µg/ml Ampicillin</p> | ||
+ | <p>2) Inoculate with cells</p> | ||
+ | <p>3) Leave to grow at 37 ºC overnight</p> | ||
+ | <br> | ||
+ | <p><b>18/07/2013: Extraction of FAS module</b></p> | ||
+ | <p>FAS module successfully extracted using plasmid purification kit</p> | ||
+ | <center><img src="https://static.igem.org/mediawiki/2013/0/02/GEL1807.jpeg" width="500" height="365" /></center> | ||
+ | <p><b>19/07/2013-24th July: New Primers</b></p> | ||
+ | <p>Found that the PCR from 9/7/2013 failed due to incorrect primers (H1catF and H2catR). New primers were ordered:</p> | ||
+ | <p><i>H1catF_2a</i></p> | ||
+ | <p>CGGCATGTATATCATTTGGGGTTGCGATGACGACGAACACGCATT</p> | ||
+ | <p><i>H1catR_2a</i></p> | ||
+ | <p>CTCTTTAGTGGGCGTCAAAAAAAACGCCGGATTAACCGGCGTCTG</p> | ||
</div> | </div> | ||
- | </li | + | </li> |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | <li id="one"><a href="" onclick="blocking('text17'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">24/07/2013 </span> Knockout Take II PCR of Chloramphenicol (New primers)</a> | |
- | + | <div id="text17"> | |
- | + | <p> | |
- | + | <p>PCR ran with new primers. To be on the safe side we ran a PCR gradient in order to find the best annealing temperature. A rough estimate of the optimum T<sub>m</sub> was made using the T<sub>m</sub> calculator on the NEB site</p> | |
- | + | </div> | |
- | + | </li> | |
- | + | ||
- | + | <li id="one"><a href="" onclick="blocking('text18'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">25/07/2013 </span> Knockout Take II PCR of Chloramphenicol (New primers)</a> | |
- | + | <div id="text18"> | |
- | + | <p><b>25/7/2013 - Results of PCR</b></p> | |
+ | <table border="1" bordercolor="#000000" style="background-color:#FFFFFF" width="100%" cellpadding="3" cellspacing="3"> | ||
+ | <tr> | ||
+ | <td>Sample Number</td> | ||
+ | <td>Temperature (ºC)</td> | ||
+ | <td>Band?</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>1</td> | ||
+ | <td>49.8</td> | ||
+ | <td>No</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>2</td> | ||
+ | <td>50.2</td> | ||
+ | <td>No</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>3</td> | ||
+ | <td>51.4</td> | ||
+ | <td>Yes (with mystery product)</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>4</td> | ||
+ | <td>53.5</td> | ||
+ | <td>Yes</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>5</td> | ||
+ | <td>56.4</td> | ||
+ | <td>No</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>6</td> | ||
+ | <td>58.5</td> | ||
+ | <td>No</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>7</td> | ||
+ | <td>59.6</td> | ||
+ | <td>No</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>8</td> | ||
+ | <td>59.7</td> | ||
+ | <td>No</td> | ||
+ | </tr> | ||
+ | </table> | ||
+ | </div> | ||
+ | </li> | ||
- | + | <li id="one"><a href="" onclick="blocking('text19'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">26/07/2013 </span> Chloramphenicol resistance gene extraction</a> | |
- | + | <div id="text19"> | |
- | + | <p> | |
+ | <p>Tuc01 strain of <i>E. coli</i> used for third attempt at fadD knockout</p> | ||
+ | <p>Method used was the QIAGEN method for genome extraction</p> | ||
+ | <p>Analysis using nanodrop: 480 ng/µl of DNA</p> | ||
+ | </div> | ||
+ | </li> | ||
- | + | <li id="one"><a href="" onclick="blocking('text20'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">29/07/2013 </span> Knockout Take II PCR of Chloramphenicol (New primers)</a> | |
- | + | <div id="text20"> | |
- | + | <p>Want a 34 mg/ml stock in 100% ethanol: 0.34 g in 10 ml of ethanol</p> | |
+ | <p><i>Making a subculture of Tuc01 strain for DNA extraction:</i><p> | ||
+ | <p>1. Add 600 µl of Tuc01 in 5ml of Cm<sub>10</sub> and LB</p> | ||
+ | <p>2. Put the tube in 37 ºC shaking incubation</p> | ||
+ | <p>3. After 5 hours, transfer 1 ml from the tube to 9 ml LB Cm <sub>10</sub> | ||
+ | <p>4. Culture overnight</p> | ||
+ | </div> | ||
+ | </li> | ||
- | + | <li id="one"><a href="" onclick="blocking('text21'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">01/08/2013 </span> Making FAS module media</a> | |
- | + | <div id="text21"> | |
- | + | <p>Due to the high levels of fatty acid production in bacteria containing the FAS module, a new media is required to keep the cells alive:</p> | |
+ | <p><i>1. Making the growth media (without Glucose stock)</i></p> | ||
+ | <p>10 g Yeast Extract | ||
+ | <p>4 g (NH<sub>4</sub>)2HPO<sub>4</sub> - Diammonium Phosphate | ||
+ | <p>13.5 g KH2PO4 -Mono potassium phosphate</p> | ||
+ | <p>1.7 g Citric Acid</p> | ||
+ | <p>Dissolve in approx 300ml DI water, add more if required. </p> | ||
+ | <p>Send for Auto-Clave</p> | ||
+ | <p>*Also send water for autoclave as this will be required in the later step if there is not sufficient water autoclaved. You will need approx 700 ml water max</p> | ||
+ | <p><i>2. Making the glucose stock</i></p> | ||
+ | <p>20 g glucose dissolved in approx 100ml DI water, add more if required.</p> | ||
+ | <p><i>3. Prepare the trace metal stock</i></p> | ||
+ | <p>You will eventually add 10 ml of this stock, these volumes are required to make a 100 ml stock.<p> | ||
+ | <p>1.0 g FeSO<sub>4</sub>.7H<sub>2</sub>O</p> | ||
+ | <p>0.2 g CaCl<sub>2</sub></p> | ||
+ | <p>0.22 g ZnSO<sub>4</sub>.7H<sub>2</sub>O</p> | ||
+ | <p>0.05 g MnSO<sub>4</sub>.4H<sub>2</sub>O</p> | ||
+ | <p>0.1 g CuSO<sub>4</sub>.5H<sub>2</sub>O</p> | ||
+ | <p>0.01 g (NH<sub>4</sub>)6Mo<sub>7</sub>O<sub>2</sub>4.4H<sub>2</sub>O - Ammonium molybdate hydrate</p> | ||
+ | <p>0.002 g Na<sub>2</sub>B<sub>4</sub>O<sub>7</sub>.10H<sub>2</sub>O (BORAX) - Sodium Borate</p> | ||
+ | <p>4. Filter sterilisation of metal stock and glucose stock (separately)</p> | ||
+ | <p>5. Mix filtered stocks with autoclaved growth media.</p> | ||
+ | <p>6. Add NaOH to make to pH6.8</p> | ||
+ | <p>7. Make up to 1 Litre with sterilised water</p> | ||
+ | <br> | ||
+ | <p>Ran a gel of chloramphenicol resistance gene: successful band</p> | ||
+ | <center><img src="https://static.igem.org/mediawiki/2013/8/8f/GEL1008.jpeg" width="500" height="365" /></center> | ||
+ | <p>However gel extraction failed: 5ng/ul, 280/260 of 6. Ran an overnight repeat PCR</p> | ||
+ | </div> | ||
+ | </li> | ||
- | + | <li id="one"><a href="" onclick="blocking('text22'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">02/08/2013-05/08/2013 </span> Chloramphenicol PCRs</a> | |
- | + | <div id="text22"> | |
- | + | <p> Repeated PCR described previously another two times, both failed. Discovered incorrect PCR settings. Repeated and got successful band:</p> | |
- | + | <center><img src="https://static.igem.org/mediawiki/2013/a/ac/GEL5008.jpeg" width="500" height="365" /></center> | |
+ | <p>Performed PCR purification (QIAGEN). Resulted in 16.9ng/ul of DNA. Electroporated cells and plated. Cells failed to grow</p> | ||
+ | </div> | ||
+ | </li> | ||
+ | |||
+ | <li id="one"><a href="" onclick="blocking('text23'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">08/08/2013 </span> Cell growth curve</a> | ||
+ | <div id="text23"> | ||
+ | <p><b>A cell growth curve was created in order to determine if FAS media gives better growth than normal LB media. It appeared to do so, but not significantly. Will repeat at a later date </b></p> | ||
+ | <br> | ||
+ | </div> | ||
+ | </li> | ||
+ | |||
+ | <li id="one"><a href="" onclick="blocking('text24'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">12/08/2013 </span> RBS Biobrick Hydration</a> | ||
+ | <div id="text24"> | ||
+ | <p>Hydrated 3 ribosomal binding site biobricks: BBa_B0034, BBa_B0034, BBa_B0032, and transformed into chemically competent NovaBlue cells. They were plated on LB-AMP plates</p> | ||
+ | </div> | ||
+ | </li> | ||
+ | |||
+ | <li id="one"><a href="" onclick="blocking('text25'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">09/08/2013 </span> Primers recieved for FabA</a> | ||
+ | <div id="text25"> | ||
+ | <p><b>9/08/13 Primers recieved for FabA</b></p> | ||
+ | <p>FabA_Fwd_EcoRI</p> | ||
+ | <p>CTAGTAGAATTCATGGTAGATAAACGCGAATCCT</p> | ||
+ | <p>FabA_Rev_Spe1</p> | ||
+ | <p>CTAGTACTGCAGTTATTAGAAGGCAGACGTATCCTGG</p> | ||
+ | <p>FabA_Fwd_Prefix</p> | ||
+ | <p>GAATTCGCGGCCGCTTCTAGATGGTAGATAAACGCGAATCCT</p> | ||
+ | <p>FabA_Rev_Suffix</p> | ||
+ | <p>CTGCAGCGGCCGCTACTAGTATTATTAGAAGGCAGACGTATCCTG</p> | ||
+ | <p>FabA_Fwd_Prefix_N-His</p> | ||
+ | <p>GAATTCGCGGCCGCTTCTAGATGCATCATCACCACCACCATGTAGATAAACGCGAATCCT</p | ||
+ | <p>FabA_Rev_Suffix_C-His</p> | ||
+ | <p>CTGCAGCGGCCGCTACTAGTATTATTAATGGTGGTGGTGATGATGGAAGGCAGACGTATCCTGG</p> | ||
+ | </div> | ||
+ | </li> | ||
+ | |||
+ | <li id="one"><a href="" onclick="blocking('text26'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">13/08/2013 </span> Finding the failure for the FadD knockout</a> | ||
+ | <div id="text26"> | ||
+ | <p>Agarose Gel for confirmation the presence of DNA in pKD46</p> | ||
+ | <p>RESULT: Success</p> | ||
+ | <center><img src="https://static.igem.org/mediawiki/2013/7/73/GEL1308.JPG" width="500" height="365" /></center> | ||
+ | <p>Conclusion: Electrocompetent cells are no longer competent</p> | ||
+ | <p><b>FadD knockout all over again</b></p> | ||
+ | <p>Result PCR of Chloramphenicol DNA</p><p>RESULT: Obtained the desired band. Non-template control was contaminated, showing a band same the chloramphenicol gene</p> | ||
+ | <center><img src="https://static.igem.org/mediawiki/2013/d/df/GEL1308B.JPG" width="500" height="365" /></center> | ||
+ | </div> | ||
+ | </li> | ||
+ | |||
+ | |||
+ | <li id="one"><a href="" onclick="blocking('text27'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">14/08/2013 </span> Primers received</a> | ||
+ | <div id="text27"> | ||
+ | <p>Delta9_Rev</p> | ||
+ | <p>CTGCAGCGGCCGCTACTAGTATTATTAGGCTTTGTTGGCCATCGCAGTT (49) </p> | ||
+ | <p>Delta12_Rev</p> | ||
+ | <p>CTGCAGCGGCCGCTACTAGTATTATTAAACTTTTTTCAGGGAGCCGAAG (49)</p> | ||
+ | <p>Delta9 & Delta12_F</p> | ||
+ | <p>GAATTCGCGGCCGCTTCTA (19)</p> | ||
+ | <p>sSB1C3_VF2</p> | ||
+ | <p>TGCCACCTGACGTCTAAGAA (20)</p> | ||
+ | <p>sSB1C3_VR</p> | ||
+ | <p>ATTACCGCCTTTGAGTGAGC (20)</p> | ||
+ | <p>FabA_Fwd</p> | ||
+ | <p>TGGTAGATAAACGCGAATCCT (21)</p> | ||
+ | <p>FabA_Rev</p> | ||
+ | <p>TTATTAGAAGGCAGACGTATCCTGG (25)</p> | ||
+ | <p><b>PCR for FabA</b></p> | ||
+ | |||
+ | <p>A full scale 3 hour PCR was run after the confirmation of the product. The primers used in this PCR contained His-tags.</p> | ||
+ | <p><b>FadD knockout Continued</b></p> | ||
+ | <p>Transforming pKD46 in BL21(DE3)</p> | ||
+ | |||
+ | <p>1.Overnight culture at 30°C</p> | ||
+ | <p>2.Measure the OD<sub>600</sub>. It was in the range of 0-0-1</p> | ||
+ | <p>3.Keep in 30°C shaking incubator for 2 hrs</p> | ||
+ | <p>4.Measure the OD again and were in the range of 0.2-0.6</p> | ||
+ | <p>5.Store in 4°C</p> | ||
+ | <p>6.Follow the protocol for making the cells Electrocompetent as on 25/6/13</p> | ||
+ | <br> | ||
+ | <p><b>DNA precipitation of chloramphenicol gene product on 13/8/13</b></p> | ||
+ | <p>Ethanol precipitation | ||
+ | <p>1. 2 volumes absolute ethanol (ice cold) and 1/10 volumes sodium acetate (pH 5.2)</p> | ||
+ | <p>2. Keep for an hour at -80°C</p> | ||
+ | <p>3. Centrifuge at 5417 rpm for 30 minutes at 4°C</p> | ||
+ | <p>4. Wash with 70% ethanol</p> | ||
+ | <p>5. Repeat the centrifuge as step 3</p> | ||
+ | <p>6. Nanodrop was performed scaling up to 52 ng/ul</p> | ||
+ | <br> | ||
+ | <p><b>Restriction digest of chloramphenicol gene</b></p> | ||
+ | <p> The restriction digestion was performed using the enzyme EcoRI.</p> | ||
+ | <table border="1" bordercolor="#FFCC00" style="background-color:#FFFFFF" width="100%" cellpadding="3" cellspacing="3"> | ||
+ | <tr> | ||
+ | <td><b>Item</b></td> | ||
+ | <td><b>Sample</b></td> | ||
+ | <td></td> | ||
+ | <td></td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td></td> | ||
+ | <td>1</td> | ||
+ | <td>2</td> | ||
+ | <td>3</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>DNA</td> | ||
+ | <td>4µl</td> | ||
+ | <td>1.2µl</td> | ||
+ | <td>2µl</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>Buffer</td> | ||
+ | <td>1µl</td> | ||
+ | <td>1µl</td> | ||
+ | <td>1µl</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>EcoRI</td> | ||
+ | <td>0.5µl</td> | ||
+ | <td>0.5µll</td> | ||
+ | <td>0.5µl</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>Water</td> | ||
+ | <td>4.5µl</td> | ||
+ | <td>7.3µl</td> | ||
+ | <td>6.5µl</td> | ||
+ | </tr> | ||
+ | </table> | ||
+ | |||
+ | <p>The samples were run on 2% gel</p> | ||
+ | <p> RESULT: Success</p> | ||
+ | <center><img src="https://static.igem.org/mediawiki/2013/6/66/GEL1408.JPG" width="500" height="365" /></center> | ||
+ | </div> | ||
+ | </li> | ||
+ | |||
+ | |||
+ | <li id="one"><a href="" onclick="blocking('text28'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">15/08/2013 </span> Result of FabA PCR of 14/8/13</a> | ||
+ | <div id="text28"> | ||
+ | <img src="" width="" height="" /> | ||
+ | <p>RESULT: Successful. Band size 600bp</p> | ||
+ | |||
+ | <p>FabA restriction digestion</p> | ||
+ | <p> Enzyme used Apo1</p> | ||
+ | <p>The restriction digest was performed at 50°C for an hour</p> | ||
+ | <p>RESULT: Successful. Bands size were 400 and 200 bp respectively</p> | ||
+ | <center><img src="https://static.igem.org/mediawiki/2013/6/6f/GEL1508.JPG" width="500" height="365" /></center> | ||
+ | |||
+ | <p> FadD knockout continued</p> | ||
+ | <p> Followed the protocol as on 25/08/13</p> | ||
+ | </div> | ||
+ | </li> | ||
+ | |||
+ | <li id="one"><a href="" onclick="blocking('text29'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">16/09/2013 </span> Induction of lamda red recombinase and making competent cells</a> | ||
+ | <div id="text29"> | ||
+ | <p>Followed the protocol as on 04/07/13</p> | ||
+ | </div> | ||
+ | </li> | ||
+ | |||
+ | <li id="one"><a href="" onclick="blocking('text30'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">19/08/2013 </span> Electroporation of choramphenicol gene in BL21(DE) with lamda red</a> | ||
+ | <div id="text30"> | ||
+ | <p>Followed the protcol as on 25/08/13</p> | ||
+ | <p> RESULT: FadD knockout failed.</p> | ||
+ | </div> | ||
+ | </li> | ||
+ | |||
+ | |||
+ | <li id="one"><a href="" onclick="blocking('text31'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">20/08/2013 </span> Electroporation of RBS Biobricks and RBS+ Constitutive promoter</a> | ||
+ | <div id="text31"> | ||
+ | We decided to use existing BioBrick parts for our Ribosomal Binding sites for FabA, Delta 9, Delta 12 - and also the RBS and promoter Biobrick. We intend on using the RBS+Promoter biobrick for expression of our FabA, Delta9 and Delta 12 genes in our lab work <br> | ||
+ | <br><b>Batches </b><br><br> | ||
+ | RBS 1 = BBa_B0034<br> | ||
+ | RBS 2 = BBa_B0030 <br> | ||
+ | RBS 3= BBa_B0032 <br> | ||
+ | RBS + P = BBa_K608002<br> | ||
+ | <br> | ||
+ | |||
+ | <table border="1" bordercolor="#FFCC00" style="background-color:#FFFFFF" width="100%" cellpadding="3" cellspacing="3"> | ||
+ | <tr> | ||
+ | <td><b>Batch</b>/td> | ||
+ | <td><b>Electrode Values</b></td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>RBS1</td> | ||
+ | <td>4.6</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>RBS1 Control (No DNA)</td> | ||
+ | <td>5.1</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>RBS2</td> | ||
+ | <td>5.2</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>RBS2 Control</td> | ||
+ | <td>5.2</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>RBS3</td> | ||
+ | <td>5.0</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>RBS3</td> | ||
+ | <td>5.4</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>RBS/Promotor</td> | ||
+ | <td>5.2</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>RBS/Promotor Control</td> | ||
+ | <td>5.2</td> | ||
+ | </tr> | ||
+ | </table> | ||
+ | |||
+ | Cells then left to recover for 3 hours at 37 degrees Celcius and then plated on appropriate marker plates (LB+Chromamphenicol at a concentration of 10 µg/ml) and left overnight<br> <br> | ||
+ | </div> | ||
+ | </li> | ||
+ | |||
+ | |||
+ | <li id="one"><a href="" onclick="blocking('text32'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">20/08/2013 </span> FabA PCR Products (from 15/08/2013) - Blunt End Ligation </a> | ||
+ | <div id="text32"> | ||
+ | We performed a blunt end ligation on the FabA PCR Products from 15/08/2013 using the Thermo Scientific CloneJET PCR Cloning Kit, and transformed chemically competent NovaBlue Cells at 37 degrees celsius for 2 minutes. The cells were left to recover for 3 hours at 37 degress celcius and plated on appropriate antibiotic plates (LB + Ampicillin 100µg/ml) overnight at 37 degrees celcius. <br> | ||
+ | </div> | ||
+ | </li> | ||
+ | |||
+ | |||
+ | <li id="one"><a href="" onclick="blocking('text33'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">21/08/2013 </span> Growing up of FabA Clone Jet Transformed cells in media & Mini Prep</a> | ||
+ | <div id="text33"> | ||
+ | <b>21/08/2013 - Growing up of FabA Clone Jet Transformed cells in media & Mini Prep performed </b><br> | ||
+ | 1.The CloneJet Transformed cells were selected and grown up in LB + Ampicillin for 6 hours. <br> | ||
+ | 2.A miniprep was performed using Qiagen Miniprep Kit. <br> | ||
+ | 3. We completed a test digestion with ApoI, EcoR1 and Pst1 - same protocol as 15/08/13 confirming the identity of FabA His tag in the N Terminus<br> | ||
+ | <center><img src="https://static.igem.org/mediawiki/2013/c/c2/GEL2108.JPG" width="500" height="365" /></center> | ||
+ | </div> | ||
+ | </li> | ||
+ | |||
+ | <li id="one"><a href="" onclick="blocking('text34'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">27/08/2013 </span> Transformation of Delta9 and Delta 12 synthesised plasmids</a> | ||
+ | <div id="text34"> | ||
+ | 1.The Delta 9 and Delta 12 Synthesised genes arrived, and were transformed using NEB High Efficiency DH5 alpha chemically competent cells. *37 Degrees Celcius for 2 minutes* <br> | ||
+ | 2. FabA Blunting reaction with CloneJet was repeated and also transformed with NEB DH5 alpha cells. *37 Degrees Celcius for 2 minutes* <br> | ||
+ | 3. All of the transformed cells were left to recover for 3 hours and then plated on appropriate LB plates<br> | ||
+ | </div> | ||
+ | </li> | ||
+ | |||
+ | <li id="one"><a href="" onclick="blocking('text35'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">28/08/2013 </span> Inoculation of LB + AMP with transformants from 27/08/2013 </a> | ||
+ | <div id="text35"> | ||
+ | <b> 28/08/2013 - Inoculation of LB + AMP with transformants from 27/08/2013 </b> | ||
+ | 1. Inoculation in preparation for MiniPrep the following day<br> | ||
+ | </div> | ||
+ | </li> | ||
+ | |||
+ | <li id="one"><a href="" onclick="blocking('text36'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">29/08/2013 </span> Miniprep of FabA, D9, D12</a> | ||
+ | <div id="text36"> | ||
+ | 1. Miniprep on the three grown up cell colonies from 28/08/2013 was carried out. <br> | ||
+ | 2. Test digestion was completed with EcoR1 and Pst1 to confirm identity.<br> | ||
+ | <center><img src="https://static.igem.org/mediawiki/2013/e/e5/GEL2908.jpeg" width="500" height="365" /></center> | ||
+ | 3. Large scale overnight digestion was carried out with EcoR1 and Pst1 to obtain the DNA for Submission Vector and RBS + P biobrick ligation for experimental work. <br> | ||
+ | </div> | ||
+ | </li> | ||
+ | |||
+ | <li id="one"><a href="" onclick="blocking('text37'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">03/09/2013 </span> Transformation of NEB-5a with BBA_K608002</a> | ||
+ | <div id="text37"> | ||
+ | <b> 03/09/2013 - Transformation of NEB-5a with BBA_K608002. </b> <br> | ||
+ | 1. Cells were transformed and plated on LB + Chloramphenicol 10 microgram/ml <br> | ||
+ | 2. Single colonies taken and inoculated the next day in preparation for miniprep <br> | ||
+ | </div> | ||
+ | </li> | ||
+ | |||
+ | <li id="one"><a href="" onclick="blocking('text38'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">05/09/2013 </span> Miniprep of Colonies in LB from 04/09/2013 and digestion</a> | ||
+ | <div id="text38"> | ||
+ | 1. A Miniprep was carried out using the Qiagen MiniPrep Kit <br> | ||
+ | 2. A digestion using EcoR1 and Pst1 was completed on the BioBrick Vector to linearise the fragment for ligation with D9/D12 and FabA and gel ran to confirm the correct size fragments were obtained. Result - Success. <br> | ||
+ | <center><img src="https://static.igem.org/mediawiki/2013/e/ed/GEL0609.JPG" width="500" height="365" /></center> | ||
+ | </div> | ||
+ | </li> | ||
+ | |||
+ | <li id="one"><a href="" onclick="blocking('text39'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">06/09/2013 </span> Gel Extraction of digested BBa_K608002 (RBS + P) from 05/09/2013</a> | ||
+ | <div id="text39"> | ||
+ | Products from digestion from 05/09/2013 were run on a Gel and Extracted using the Qiagen QiaQuick Gel Extraction Kit. The Elution buffer used was heated to 40 degrees celsius to improve eluted DNA concentration. <br> | ||
+ | </div> | ||
+ | </li> | ||
+ | |||
+ | <li id="one"><a href="" onclick="blocking('text40'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">09/09/2013 </span> Gel Extraction of digestion products from 29/08/2013</a> | ||
+ | <div id="text40"> | ||
+ | 1. A gel was run with the products from the digestion on 29/08/2013 to confirm the size of the required products<br> | ||
+ | <center><img src="https://static.igem.org/mediawiki/2013/a/a0/GEL0909.JPG" width="500" height="365" /></center> | ||
+ | 2. A gel extraction was then performed to extract the D9, D12, FabA fragments using the Qiagen Qiaquick Gel Extraction kit.<br> | ||
+ | <br> | ||
+ | </div> | ||
+ | </li> | ||
+ | |||
+ | <li id="one"><a href="" onclick="blocking('text41'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">12/09/2013 </span> Ligation of D9, D12, FabA into Submission Vector</a> | ||
+ | <div id="text41"> | ||
+ | The Extracted products from 09/02/2013 and digested Submission Vectors were ligated using NEB T4 DNA Ligase protocol. 2ul of ligation mix was used to transform NEB-5 alpha cells <br> | ||
+ | <center><img src="https://static.igem.org/mediawiki/2013/d/dc/GEL1209.JPG" width="500" height="365" /></center> | ||
+ | <br> | ||
+ | </div> | ||
+ | </li> | ||
+ | |||
+ | <li id="one"><a href="" onclick="blocking('text42'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">13/09/2013 </span> Test digestion of Submission vector with D9, D12</a> | ||
+ | <div id="text42"> | ||
+ | Following Ligation of 09/0/2013 a test digestion was carried out as a preliminary method of confirming the constructs produced.<br> | ||
+ | 1. D9+SUBMISSION VECTOR was digested with BamHI and EcoRV. Result - Anticipated fragments present, Success. <br> | ||
+ | 2. D12+SUBMISSION VECTOR was Digestions with BamHI and Pvu1 - Failed digestion, this was a result of the wrong Enzyme buffer used.<br> | ||
+ | 3. D12+SUBMISSION VECTOR Digestion repeated with correct restriction enzyme buffers and new restriction enzymes (BamHI, EcoR1, Pst1 )and gel repeated - Gel confirmed correct fragment size, Success. <br> | ||
+ | <center><img src="https://static.igem.org/mediawiki/2013/0/0a/GEL1309.jpeg" width="500" height="365" /></center> | ||
+ | 4. As our Submission Vectors with D9 and D12 constructs appeared to be present these plasmids were sent for sequencing with the iGEM Verification primers. <br> | ||
+ | </div> | ||
+ | </li> | ||
+ | |||
+ | <li id="one"><a href="" onclick="blocking('text43'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">20/09/2013 </span> FabA test digestion</a> | ||
+ | <div id="text43"> | ||
+ | 1. NEB Enzymes EcoRV and Pst1 were used to digest the FabA and submission vector ligation from 13/09/2013 - Results proved this to be successful. <br> | ||
+ | <center><img src="https://static.igem.org/mediawiki/2013/7/77/GEL2009.jpeg" width="500" height="365" /></center> | ||
+ | 2. FabA construct sent for sequencing <br> | ||
+ | </div> | ||
+ | </li> | ||
+ | |||
+ | <li id="one"><a href="" onclick="blocking('text44'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">22/09/2013 </span> Ligation of Into RBS + P (BBa_K608002) vector from 05/09/2013</a> | ||
+ | <div id="text44"> | ||
+ | The extracted delta 9, 12 and fabA products from 09/09/2013 were ligated into the RBS + P biobrick vectors and then transformed into NEB-5 alpha cells for expression in the laboratory experiments. <br> | ||
+ | <b>23/09/2013 - Test digestion to confirm correct ligations from 22/09/2013 </b> <br> | ||
+ | 1. Digestions were carried out to confirm the identity of the Expression vectors with our D9/D12/FabA inserts using NEB restriction enzymes - <br> | ||
+ | (D9 - EcoRV and BamHI) -> Success<br> | ||
+ | (D12 - BamHI, Pst1, Xba1) -> Success<br> | ||
+ | (FabA - EcoRV and Pst1) -> Success <br> | ||
+ | <center><img src="https://static.igem.org/mediawiki/2013/b/b9/GEL2309.JPG" width="500" height="365" /></center> | ||
+ | Samples sent to LC-MS for characterisation | ||
+ | </div> | ||
+ | </li> | ||
+ | |||
+ | <li id="one"><a id="mlink2" href="" onclick="blocking('text45'); return false;"><span id="arrow"><img src="https://static.igem.org/mediawiki/2013/e/ee/DownArrow2.png" width="30" height="30"/></span><span id="date">23/09/2013-03/10/2013 </span> Characterisation</a> | ||
+ | <div id="text45"> | ||
+ | Orbitrap LC-MS was carried out on the samples for analysis. For complete detail, click <a href="https://static.igem.org/mediawiki/2013/6/6d/MancLCMS.pdf" target="_blank">here</a> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | |||
</div> | </div> | ||
</body> | </body> | ||
</html> | </html> |
Latest revision as of 13:33, 26 October 2013