"
Team:KIT-Kyoto/Notebook/ATF1/june
From 2013.igem.org
ATF1
June 4th
Minipreped ATF1(prepared on 5/31).
June 6th
Performed PCR to amplify the ATF1 gene.
|
Buffer |
50µL |
|
dNTP |
20µL |
|
Primer Mix |
1µL |
|
Genome DNA |
0.5µL |
|
KOD-FX |
2µL |
|
H2O |
26.5µL |
Forward: TACGCCTCGAGATGAATGAAATCGATGAGAAAAATCAGGCCCC
Reverse: ATATTGCTTAGCAGGGCCTAAAAGGAGAGCTTTGTAAATGGAGCAAAGC
35cycle
June 7th
Electrophoresed PCR products in 1% agarose gel. No DNA was detected.
June 10th
Performed PCR to amplify the ATF1 gene.
|
Buffer |
50µL |
|
dNTP |
20µL |
|
Primer Mix |
1µL |
|
Genome DNA |
0.5µL |
|
KOD-FX |
2µL |
|
H2O |
26.5µL |
Predenature 94˚C 2min
Denature 98˚C 10sec
Annealing 51˚C 30sec
Extension 68˚C 1min30sec
(30 cycles)
June 11th
Electrophoresed PCR products in 1% agarose gel.
We detected the correct size of DNA band.
We performed PCR to amplify the ATF1 gene.
|
Buffer |
50µL |
|
dNTP |
20µL |
|
Primer Mix |
1µL |
|
ATF1(PCR product) |
0.5µL |
|
KOD-FX |
2µL |
|
H2O |
26.5µL |
Predenature 94˚C 2min
Denature 98˚C 10sec
Annealing 51˚C 30sec
Extension 68˚C 1min30sec
(30 cycles)
June 12th
Electrophoresed PCR products in 1% agarose gel.
We detected the correct size of DNA band.
June 13th
Made competent cells.
June 17th
Purified the PCR product.
June 20th
Electrophoresed ATF1(prepared on 6/17) in 1% agarose gel.
Many DNA fragments were detected (failed PCR).
June 21st
PCR was carried out.
|
Buffer |
50µL |
|
dNTP |
20µL |
|
Primer Mix |
1µL |
|
ATF1(PCR product) |
0.5µL |
|
KOD-FX |
2µL |
|
H2O |
26.5µL |
30cycle (Annealing:52˚C)
PCR products were electrophoresed in 1% agarose gel.
Many DNA fragments were detected (failed PCR).
PCR was carried out.
|
Buffer |
50µL |
|
dNTP |
20µL |
|
Primer Mix |
1µL |
|
ATF1(PCR product) |
0.5µL |
|
KOD-FX |
2µL |
|
H2O |
26.5µL |
30cycle (Annealing:53˚C)
June 24th
PCR products were electrophoresed in 1% agarose gel.
Isolated and purified ATF1 from 1% agarose gel.
We performed PCR to amplify the ATF1 gene.
|
Buffer |
50µL |
|
dNTP |
20µL |
|
Primer Mix |
1µL |
|
ATF1(PCR product) |
0.5µL |
|
KOD-FX |
2µL |
|
H2O |
26.5µL |
30cycle (Annealing:52˚C)）
June 27th
PCR products were electrophoresed in 1% agarose gel.
Four DNA fragments were detected
June 28th
We performed PCR to amplify the ATF1 gene.
|
Buffer |
50µL |
|
dNTP |
20µL |
|
Primer Mix |
1µL |
|
ATF1(PCR product) |
0.5µL |
|
KOD-FX |
2µL |
|
H2O |
26.5µL |
30cycle (Annealing:53˚Cand54˚C)
