Team:Hong Kong HKUST/Project/module2

Overview

In 2009, Prof. James Liao's research group at UCLA published their findings that mice expressing a synthetic glyoxylate shunt had increased resistance to diet-induced obesity. To engineer this behaviour in mice, they introduced glyoxylate shunt genes to mouse liver cells, employing a constitutive promoter for expression of the said genes. The aim of this module is to introduce an inducible system that allows tunable fatty acid uptake by sensing fatty acid concentrations. Such a system would reduce the risk of fatty acid deficiency when fatty acid concentration is below normal.

Four different fatty acid induced promoters were investigated, namely: Liver Fatty Acid Binding Protein 1 (FABP1) promoter, Peroxisome Proliferator-Activated Receptor-alpha (PPAR-alpha) promoter, Glucose Regulated Protein (GRP78) promoter, Fatty Acid Metabolism Regulator Protein (FadR) and pFadBA promoter.

Liver Fatty Acid Binding Protein 1 (FABP1) promoter

Fatty acid binding proteins (FABPs) are lipid-binding proteins that regulate fatty acid uptake and transfer between extra-and intracellular membranes. There are 9 different FABPs identified with tissue-specific distribution, including FABP1 in liver. All FABPs have a similar structure, and the FABP genes consist of 3 introns and 4 exons. Some, such as PPAR, are believed to transport fatty acids from the plasma membrane to intracellular receptors, and as such have a selective cooperation with the receptor.

Experiment flow

FABP1 was cloned from human genomic DNA (gDNA) (see gDNA extraction and PCR protocols) and engineered RFC10 prefixes and suffixes were attached for BioBrick submission. It was then ligated with the coding sequence for enhanced green fluorescence protein (eGFP) from pEGFP-N1 (Addgene), and cloned into BBa_J176171 mammalian backbone. The promoter and eGFP were successfully cloned into BBa_J176171 by digestion and ligation.

The confirmed construct was transfected into both HEK293FT and HepG2 cells. pEGFP-N1 plasmids, which carry eGFP regulated by the constitutive CMV promoter, were also transfected as a positive control. Green fluorescence signals from both the constitutive control and FABP1-regulated cells were compared. However, no such signal could be detected from the latter.

Since the FABP1 promoter contained illegal restriction sites (namely EcoRI and PstI), we conducted multi site-directed mutagenesis to eliminate them from the DNA sequence. (See mutagenesis protocol 1,2 and 3).

The FABP1 promoter was to be characterized by over-expression of eGFP reporter proteins in the presence of high fatty acid concentration in the medium¹. Again, however, no eGFP signal could be detected.

After several attempts of site-mutagenesis of the promoter in FABP1 – eGFP – BBa_J176171 construct, we found that the plasmid degrades at a high temperature. We tested heat sensitivity of the plasmid BBa_J176171 and found that the plasmid degrades during denaturation (95 °C) in the polymerase chain reaction. Then, we took an alternative experiment by cloning FABP1 promoter into pBlueScript KS(+). Due to time constrain, two mutagenesis attempts were taken but both of them were not successful.

Peroxisome Proliferator-Activated Receptor-alpha (PPAR-alpha) Promoter

We planned to clone PPAR-alpha promoter from human genomic DNA using polymerase chain reaction. We designed three sets of primers in upstream and downstream of promoter sequence, for different polymerases and referencing on Pineda Torra team’s experiment². In addition, polymerase chain reaction was conducted at different temperatures, primer concentrations and buffers. However, none of the primers could successfully clone the PPAR-alpha promoter.

Primers used to extract PPAR-alpha promoter from gDNA:
Forward:
GATCATATTAATGAATTCGCGGCCGCTTCTAGAGTTCCCTCACCAAACACAACAGGATGA
Reverse:
GATCATGGATCCTACTAGTAGCGGCCGCTGCAGCGCAAGAGTCCTCGGTGT
Forward:
GATCAT ATTAATGAATTCGCGGCCGCTTCTAGAGGGTATGCCAGGTAATGTCTT
Reverse:
GATCATGGATCCCTGCAGCGGCCGCTACTAGTACAAGAGTCCTCGGTGTGT
Forward from reference paper:

GATCAT ATTAAT GAATTCGCGGCCGCTTCTAGAGGAGCGTCACGGCCCGAACAAAGC
Reverse from reference papers+ RFC10 prefix and suffix:

GATCATGGATCCCTGCAGCGGCCGCTACTAGTAAGTCCTCGGTGTGTGTCCTCGCTCCTC
Since the PPAR-alpha promoter coding sequence could not be obtained from human genomic DNA, further experiment could not be preceded.

Glucose Regulated Protein (GRP78) Promoter

GRP78 (HSPA5) is involved in the folding and assembly of proteins in the endoplasmic reticulum (ER). The level of GRP78 is believed to be strongly correlated with the amount of secretory proteins (e.g. IgG) within the ER, which suggests its key role in monitoring protein transport through the cell.

High concentration of fatty acids disrupts cell homeostasis, causing endoplasmic reticulum stress (ERS) activating the unfolded protein response (UPR) that consists of 3 transmembrane proteins: IRE1 PERK and ATF6. Three signals constitutively activate the GRP78 promoter with the help of other factors, such as NF-Y, ERSF, YY1 and cleaved ATF6, acquired from the normal stress response followed by UPR.

Experiment Flow

The commercial plasmid pDRIVE_hGRP78 (InvivoGen) was treated following manufacturer instructions (See manufacturer protocol). GRP78 promoter was extracted out by polymerase chain reaction with engineered RFC10 prefix, suffix, AseI upstream of prefix and XhoI in downstream of suffix to facilitate cloning into pEGFP-N1 backbone (Addgene). pEGFP-N1 is a mammalian vector that contains constitutive CMV promoter and enhanced green fluorescence protein (eGFP) as a reporter. We replaced CMV promoter with inducible GFP78 promoter by digestion and ligation. Since GRP78 promoter contained illegal restriction sites, two kinds of mutagenesis were conducted (See Mutagenesis protocol 2 and 3) for the elimination of XbaI. Due to time constrain, promoter activity in mammalian cell could not be characterized.

Fatty Acid Metabolism Regulator Protein (FadR) and pFadBA

A bacterial transcription factor that regulates lipid metabolism of fatty acid biosynthesis and beta-oxidation. The binding of fadR is inhibited by fatty acyl-CoA compounds, which are intermediates of fatty acid degradation. HKUST iGEM group has designed to use this protein in mammalian cell to sense the amount of fatty acid present in the cell.

In terms of promoter efficiency, the difference in prokaryotic and eukaryotic transcription mechanisms gives this protein low possibility to be expressed in mammalian cell. However, HKUST group plans to investigate the efficiency of prokaryotic transcription factor in eukaryotic system and compare efficiency with other sensing mechanisms, which are believed to be present in mammalian cell.

In the absence of fatty acid, a constitutively expressed fatty acid metabolism regulator protein FadR binds to Pfad promoter (pFadBA) and inhibits the expression of aceA and aceB. In our project, we aim to use this sensing mechanism to regulate the transcription of aceA and aceB, genes for glyoxylate shunt. As a regulatory system, when fatty acid is introduced to HepG2 cell, fatty acid is converted into acyl-CoA, which binds to fadR and inhibits repression of PfadBA.

Experiment Flow

The FadR (BBa_K817001) and pFadBA (BBa_K817002) DNA were obtained from 2013 distribution kit, submitted by NTU-Taida 2012 team. For expression in mammalian cells, pFadBA was cloned into mammalian vector (BBa_J176171) with an enhanced green fluorescence protein (eGFP) as reporter. After successful construct of pFadBA – eGFP – BBa_J176171, the plasmid was transfected into HEK293FT cell.

For the promoter regulation, we cloned FadR into BBa_J176171 backbone, with Kozak sequence and Nuclear Leading Sequence (NLS) for transcription and translation efficiency in mammalian cell. After confirmation of the construct, Kozak Sequence – FadR coding sequence – NLS was cloned into pEGFP-N1 that contains mammalian constitutive CMV promoter. The pFadBA promoter and FadR protein constructs were to be co-transfected in HEK293FT cell and selected using different drug selection markers – Puromycin for BBa_J176171 and Neomycin for pEGFP-N1.

After co-transfection of two constructs to HEK cell, no eGFP signal could be detected from fadBA promoter construct. We believed that even though we have introduced Kozak and nuclear leader sequences to protein coding sequence, difference in prokaryotic and eukaryotic transcription mechanism gives fadR protein low possibility to be expressed in mammalian cell.

After transfecting to mammalian cells, these promoters will be induced by Fatty Acids or its oxidation products, leading to expression of eGFP. By comparing the image of the intensity of eGFP using Fluorescent microscopy, we will be able to quantify their expression and determine the desired sensing mechanism which is most efficient for Glyoxylate genes expression.

References

¹ Guzman, Carla et al. "The human liver fatty acid binding protein (FABP1) gene is activated by FOXA1 and PPARα; and repressed by C/EBPα: Implications in FABP1 down-regulation in nonalcoholic fatty liver disease." Biochemica et Biophysica Acta (BBA) - Molecular and Cell Biology. 1831.4 (April 2013): 803-818. Web. 23 Sep. 2013. .

² Ines Pineda Torra et al. “Characterization of the human PPARalpha promoter: Identification of a functional Nuclear Receptor Response Element.”