Team:Newcastle/Notebook/calendar

From 2013.igem.org

(Difference between revisions)
 
(608 intermediate revisions not shown)
Line 3: Line 3:
 +
== 6 ==
 +
=== 10 ===
 +
==== Titles ====
 +
<div>
 +
*Training
 +
*Wiki
 +
</div>
 +
====Details====
 +
<div>
 +
====Training====
 +
The teams split into small groups to discuss individual themes. They did some research into multiple aspects of the project including: wiki layout, t-shirt design and possible team logos. We also looked at past iGEM team wikis for inspirational ideas.
 +
 +
[[File:P1050457.JPG|frameless|300px]],[[File:P1050459.JPG|frameless|300px]]
 +
 +
A talk on Computational Modelling and BioBrick concepts was given. This talk led the team to start building the biophysical model of the lipid membrane of ''Bacillus subtilis'' and modelling of lipid synthetic pathway. Later in the day, the team met to discuss initial aims and progress of our work so far.
 +
 +
[[File:P1050460.JPG|frameless|300px]]
 +
 +
====Wiki====
 +
 +
Initial designs for the wiki have been created and uploaded. Currently all style sheets and javascript pages are stored externally until the design has been ratified by the team. Front-page image carousel has been created and initialised with blank colours to demonstrate what it shall look like until actual photographs have been taken and edited.
 +
</div>
== 6 ==
== 6 ==
-
=== 10 ===
+
=== 11 ===
 +
==== Modelling Training ====
 +
<div>
 +
*Modelling Training
 +
*Wiki
 +
</div>
 +
==== Details ====
 +
<div>
 +
====Modelling Training====
 +
 +
We started off working on a Modelling Exercise to identify components and species of the subtilin biosynthesis pathway. We also sketched down some potential logo ideas and created a shortlist of favorites.
 +
 
 +
[[File:P1050461.JPG|frameless|300px]]
 +
 +
We went on to learn about the differences and similarities between stochastic and deterministic modeling. We also used rule based modeling such as RuleBender and BioNetGen. Using the Michaelis-Menten kinetics model as an example, we alter the parameters and rates of reaction to observe the effects.
 +
 
 +
====Wiki====
 +
The wiki design was agreed upon and further developed. A front-page image display has been created, developed and set up with dummy text and placeholder images. Discussions have been held over the layout for the calendar, the general consensus being that as few a clicks as possible should be needed to switch between and overall summary of what was done and the more detailed view. Designs are started with the idea being to create a large calendar holding daily headlines that spawn a non-obtrusive pop-up window containing more detail.
 +
</div>
 +
 
 +
== 6 ==
 +
=== 12 ===
 +
==== Modelling Training====
 +
<div>
 +
*Modelling Training
 +
*GUS cloning strategy
 +
</div>
 +
==== Details ====
 +
<div>
 +
 
 +
==== Modelling Training====
 +
 
 +
Today we continued learning about stochastic and deterministic modelling and looked at converting the rate parameters in RuleBender. We made the logo more detailed and narrowed it down to two ideas.
 +
 
 +
[[File:Logo2.jpg|frameless|300px]][[File:P1050467.JPG|frameless|300px]]
 +
 
 +
====GUS cloning strategy====
 +
 
 +
We began work on the GUS cloning strategy which we plan to use to create [https://2013.igem.org/Team:Newcastle/Project/plants#Alternative_Methods_Considered Beta-glucuronidase producing L-forms] to grow and visualise L-forms in plants.  The β-glucuronidase produced by the L-forms will cleave the colourless substrate 5-bromo-4-chloro-3-indolyl-β-D-glucuronide (X-Gluc) to produce a blue product allowing the L-form distribution in plant tissue to be observed. This would involve inserting [http://parts.igem.org/Part:BBa_K330002 part:BBa_K330002] into our bacteria. We also started a rough design of the BioBrick, selecting a promoter, Ribosome binding site and antibiotic marker.
 +
 
 +
</div>
 +
 
 +
 
 +
== 6 ==
 +
=== 13 ===
 +
==== Basic Lab Skills ====
 +
<div>
 +
*Basic Lab Skills
 +
</div>
 +
==== Details ====
 +
<div>
 +
====Basic Lab Skills====
 +
 
 +
Before we started work in the lab, we were briefed on various lab health and safety policies to ensure we maintained a safe working environment. We were then given a tour around the lab to inform us of the layout including waste disposal procedures, location of chemicals and use of equipment.
 +
 
 +
We were then taught how to calibrate pipettes and learned how to operate them. We are also shown how to inoculate bacteria to a liquid culture and how to prepare bacteria streak plates.
 +
 
 +
[[File:P1050469.JPG|frameless|260px]] [[File:P1050472.JPG|frameless|260px]] [[File:P1050475.JPG|frameless|260px]]
 +
 
 +
====Transformation of GFP and RFP bricks into E. coli ''Competent Cells''====
 +
 
 +
'''Aim:'''
 +
 
 +
The aim of this experiment is to transform GFP and RFP BioBricks into Escherichia coli.
 +
 
 +
'''Methods:'''
 +
 
 +
Please refer to the [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Escherichia_coli_Competent_Cell_Preparation ''Escherichia coli'' competent cells protocol] and the [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Escherichia_coli_Transformation ''E.coli'' Transformation Protocol ].
 +
 
 +
We then plated those cells onto LB with 5ug/ml chloramphenicol plates.
 +
 
 +
'''Results:'''
 +
 
 +
Please see <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#14/6/13" target="_blank">June 14th</a> </html> for results
 +
 
 +
</div>
 +
 
 +
 
 +
== 6 ==
 +
=== 14 ===
 +
==== Basic Lab Skills 2 ====
 +
<div>
 +
*Transformation of GFP and RFP bricks into E. coli ''Competent Cells'' Results
 +
*Wiki
 +
</div>
 +
==== Details ====
 +
<div>
 +
====Transformation of GFP and RFP bricks into E. coli ''Competent Cells'' Results====
 +
'''Aim:'''
 +
 
 +
Please see <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#14/6/13" target="_blank">June 14th</a> </html> for aim.
 +
 
 +
'''Methods:'''
 +
 
 +
Please see <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#14/6/13" target="_blank">June 14th</a> </html> for methods.
 +
 
 +
'''Results:'''
 +
 
 +
We checked the plates to see if anything grew. The RFP plates showed a lot of colonies, while the GFP plates did not work as expected. The next thing we did was to view the plates under the fluorescent inverted microscope. In the afternoon,we had an introductory lecture on basic molecular biology and biobrick design.
 +
 
 +
[[File:P1050483.JPG|frameless|260px]] [[File:P1050490.JPG|frameless|260px]] [[File:P1050488.JPG|frameless|260px]]
 +
 
 +
====Wiki====
 +
The calendar has now been created, with the emphasis on both user interaction (simple and obvious to use) as well as ease of editing (the members of the team not familiar with HTML and JQuery should easily be able and add to the calendar). A rough JQuery script has been written to convert standard wiki MediaWiki code into the format used by the Calendar. This will need extensive debugging before the Calendar can be put into use.
 +
</div>
 +
 
 +
== 6 ==
 +
=== 16 ===
==== Titles ====
==== Titles ====
<div>
<div>
 +
*Wiki
 +
</div>
 +
==== Details =====
 +
<div>
 +
====Wiki====
 +
The Calendar was fully debugged and deployed over the weekend whilst no one was in the lab. This means that as of tomorrow the entire team will be able to edit and add to the calendar with ease.
 +
A brief document has also been written that will provide details on how to edit some of the more complex sections of the wiki. This document will be added to as more and more functionality is added into the wiki.
 +
</div>
 +
== 6 ==
 +
=== 17 ===
 +
==== Basic Lab Skills 3 ====
 +
<div>
 +
*Basic Lab Skills
 +
*Day Overview
 +
*BioGame
 +
*HBsu BioBrick clonning strategy
</div>
</div>
==== Details ====
==== Details ====
<div>
<div>
-
====Morning====
+
====Basic Lab Skills====
-
We started a discussion of our sub-project, doing some research into project presentation: wiki layout, t-shirt design and possible team logos. We looked at precedents for inspirational ideas.[[File:P1050457.JPG|frameless|left|text-top|"600x400"]],[[File:P1050459.JPG|frameless|left|text-top|"600x400"]]
+
-
====Afternoon====
+
'''Aim:'''
 +
To familiarize with miniprep, nanodrop, restriction digest and gel electrophoresis.
-
Learn about Computational Modelling and BioBrick concepts. Decided to start with biophysical modelling of the lipid membrane of ''Bacillus subtilis'' and modelling of lipid synthetic pathway. Later in the day, we had a team meeting to discuss aims and progress of our work.
+
'''Methods:'''
-
[[File:P1050460.JPG|frameless|left|text-top|"600x400"]]
+
We transfer colonies of bacteria into LB and extracted the plasmids via the [https://2013.igem.org/Team:Newcastle/Notebook/protocols#QIAprep_Spin_Miniprep_Kit miniprep protocol], and checked the concentration of plasmids through the use of [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Nanodrop_quantification_of_DNA_extracts nanodrop spectrophotometry]. We then prepared a 1% Agarose gel and performed a single digest with XbaI and PstI and a double digest with both restriction enzymes. We loaded our samples to the gel with the DNA ladder and control (Figure 1).
 +
 
 +
'''Results:'''
 +
 
 +
[[File:P1050504.JPG|frameless|300px]]
 +
 
 +
Figure 1
 +
 
 +
====Day Overview====
 +
The group started thinking about their cloning strategies for each theme of the project. We also discussed ideas for human practices and came up with the idea of making an educational game based on synthetic biology. At the end of the day we had a group meeting to discuss our progress and our ideas for the modelling workshop for the UCL meet up.
 +
 
 +
====BioGame====
 +
Work began on the [[Team:Newcastle/Outreach/BioGame|BioGame]]. Largely contained to simply choosing the best method of implementation for the game. The following options were considered:
 +
*Android SDK (with no game engine/plug ins)
 +
*LibGDX
 +
*OpenGL
 +
*LWJGL
 +
Ultimately the choice was made to use LibGDX due to the documentation available on it, the ease at which games can be developed and the consistent structure it provides with standard gaming development. After this decision was made, a series of tutorials were found and followed to provide a base of knowledge going into developing the application itself.
 +
 
 +
====HBsu- (x)fp BioBrick Cloning Strategy====
 +
The team has been looking in literature for a protein that binds non-specifically to DNA. This will aid the visualization of Genome Shuffling among L-forms by enabling the team to see sections of DNA that have come from two different Bacteria.
 +
The decision was made to use the HBsu protein which is encoded by the ''hbs'' gene in ''B.subtilis'' because it is well characterised and should remain associated with the DNA for a long period of time.
 +
The HBsu will be conjugated with a florescent protein such as GFP and RFP.
</div>
</div>
 +
== 6 ==
 +
=== 18 ===
 +
==== Basic Lab Skills 3 ====
 +
<div>
 +
*Wiki work
 +
*HBsu BioBrick Cloning Strategy
 +
</div>
 +
==== Details ====
 +
<div>
 +
====Wiki work====
 +
We came up with a script, story board and a list of  materials needed for the introductory video on our wiki. We had fun learning to crochet in order to create characters for the video. Furthermore, we  updated the team profile page on the wiki by adding individual pictures of all team members.
 +
[[File:P1050589.JPG|frameless|300px]]
 +
====HBsu BioBrick Cloning Strategy====
 +
An initial design for the BioBrick has been created. It includes Kanamycin resistance cassette [http://parts.igem.org/Part:BBa_P1003 BBa_P1003], a lacI Promoter under a strong RBS [http://partsregistry.org/Part:BBa_B0034 BBa_B0034], the BioBrick and a double terminator.
 +
Golden Braid assembly is planned to be used to create the HBsu BioBrick.
 +
</div>
 +
== 6 ==
 +
=== 19 ===
 +
==== Cloning strategies 1 ====
 +
<div>
 +
*Gus Reporter BioBrick
 +
*BioGame
 +
*HBsu BioBrick Cloning Strategy
</div>
</div>
 +
==== Details ====
 +
<div>
 +
====Gus Reporter BioBrick====
 +
We began working on the method for creating our construct. This would involve the use of restriction enzymes, primer design and gibson assembly. We also began creating a protocol for [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Production_of_L-form_containing_Plants introducing our L-forms into plants].
 +
 +
====BioGame====
 +
Today the game project was set up, created using the LibGDX-setup GUI in order to make projects for Android, Desktop and HTML deployment, all utilising LibGDX's built in features to run off a single "core" project. This was a big deciding factor in the choice to go with LIBGdx for developing the game as it allows us to quickly deploy across multiple platforms should we wish to do so.
 +
With the project set up, we have started to create assets such as textures and fonts to be loaded in and used within the game.
 +
 +
====HBsu BioBrick Cloning Strategy====
 +
We plan to clone it into [http://parts.igem.org/wiki/index.php/Part:pSB1C3 pSB1C3] then PCR the insert before integrating it into the amyE integration plasmid (pSB<sub>Bs</sub>1C). We discovered that the Kanamycin resistance is an ''E.coli'' version and wouldn't work in the ''B. subtilis''. Different antibiotic markers that would work in ''B.subtilis'' are trying to be found.
 +
</div>
 +
 +
== 6 ==
 +
=== 20 ===
 +
==== Cloning strategies 2 ====
 +
<div>
 +
*GUS Cloning Strategy
 +
*BioGame
 +
*HBsu BioBrick Cloning Strategy
 +
</div>
 +
==== Details ====
 +
<div>
 +
====GUS Cloning Strategy====
 +
We continued work on the cloning strategies as well as starting modelling the gus reporter system using BioNetGen. We produced a preliminary model of the gus reporter system. However, this model needs to be modified by adding parameters. We have also looked through some papers to find parameters required for the model.
 +
 +
[[File:Gus model.png|frameless|600px]]
 +
 +
Figure 1: The framework of the GUS model. The red line indicates the blue product in the GUS reporter system. The blue line represents substrate 5-bromo-4-chloro-3indolyl glucuronide (X-Gluc). The green line represents the beta B-glucuronidase.
 +
 +
====BioGame====
 +
The Asset class has been created and all currently designed assets loaded into the game. A very simple (and temporary) cartoon bacteria has been loaded in and displayed on the screen along with the team logo. The pre-loading screen itself has not yet been developed but all constructs to create it are now in place. The percentage of loading done is simply outputted to the Java console for debugging purposes..
 +
 +
====HBsu BioBrick Cloning Strategy====
 +
Designed Primers to be used in the Golden Braid assembly, and checked the melting temperature and self-annealing to make sure they work perfectly. Uses RFP (BBa_E1010) and GFP (BBa_E0040) to conjugate it to the HBsu protein in order to observe the recombination.
 +
</div>
 +
 +
== 6 ==
 +
=== 21 ===
 +
==== Cloning strategies 3 ====
 +
<div>
 +
*GUS Cloning strategy
 +
*HBsu BioBrick Cloning Strategy
 +
</div>
 +
==== Details ====
 +
<div>
 +
====GUS Reporter Gene Cloning Strategy====
 +
We further developed our cloning strategies and decided on the basic design of our construct. We made a preliminary design of the construct using Gene Designer to give a visual representation of how our construct should look like. From this image (Figure 1), we could see the positioning of all the parts, which will be more convenient for us when we want to devise a method to produce this.
 +
 +
We also improved the logo so it's ready for T-shirt printing. (picture from Alina)
 +
 +
====HBsu BioBrick Cloning Strategy====
 +
A discussion with our supervisor revealed that the assembly system might be very time consuming. So it was decided that  DNA 2.0 would be used to synthesis the HBsu BioBrick.
 +
 +
</div>
 +
 +
== 6 ==
 +
=== 24 ===
 +
==== Progress ====
 +
<div>
 +
*Groningen plasmid Mini-prep
 +
*BioGame
 +
*HBsu BioBrick Cloning Strategy
 +
</div>
 +
==== Details ====
 +
<div>
 +
====Groningen plasmid Mini-prep====
 +
 +
'''Aim:'''
 +
 +
To isolate the groningen plasmid.
 +
 +
'''Methods:'''
 +
 +
We performed a [https://2013.igem.org/Team:Newcastle/Notebook/protocols#QIAprep_Spin_Miniprep_Kit mini prep] of the Groningen 2012 integration plasmid DNA grown in ''E.coli'' overnight at 37  ̊C. The purity was tested using [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Nanodrop_quantification_of_DNA_extracts NanoDrop].
 +
 +
We confirmed the insert size by first cut with fast digest XbaI and BamHI and then running the product on a gel to confirm the presence of the plasmid in the purified pDNA.
 +
 +
'''Results:'''
 +
 +
[[File:Groningen plasmid uncut,xba1,bamh1,both.jpg |frameless|500px]]
 +
 +
Figure 1: Gel electrophoresis of Groningen plasmid.
 +
 +
Lane 1: DNA Ladder
 +
 +
Lane 2: Uncut plasmid
 +
 +
Lane 3: XbaI
 +
 +
Lane 4: BamHI
 +
 +
Lane 5: XbaI and BamHI
 +
 +
'''Discussion:'''
 +
 +
The gel shows that in lane 5 where the plasmid is cut with both XbaI and BamHI, two fragments are present. This is what we expected to have happened as the plasmid is cut at two places, isolating an insert of interest. The smaller fragment is the insert (RFP reporter gene) while the bigger fragment is the plasmid backbone.
 +
 +
====BioGame====
 +
Further work on the game architecture has been done today. The main BioBrick class been created to provide common methods that all BioBricks will use. A very basic BioBrick has been created, and can be added upon touch to the Bacteria. This is simply to demonstrate what will happen when a BioBrick is added and the possibilities therein.
 +
 +
====HBsu BioBrick Cloning Strategy====
 +
Due to the high cost of sequencing, the integration method of the HBsu BioBrick is now to clone the gene construct into the pMutin4 plasmid and use a single cross-over via the amyE gene to integrate it into the bacteria genome. Also the antibiotic marker and promoter is no longer being used because after SCO the whole plasmid will be integrated and as such will contain the promoter Pspac and Kanamycin cassette.
 +
</div>
 +
 +
== 6 ==
 +
=== 25 ===
 +
==== Modelling ====
 +
<div>
 +
*Preparation for UCL
 +
*''B.subtilis'' Transformation
 +
*Microfliuidics Introduction
 +
*HBsu BioBrick Cloning Strategy
 +
</div>
 +
==== Details ====
 +
<div>
 +
====Preparation for UCL====
 +
We started preparing for our project presentation for UCL, and have started to prepare a presentation for our workshop about BioNetGen modelling.
 +
   
 +
====''B.subtilis'' Transformation====
 +
'''Aim:'''
 +
 +
To transform the bacteria with Groningen plasmid.
 +
 +
'''Methods:'''
 +
 +
A single colony of ''B.subtilis'' strain 168 was picked and transferred into [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Bacillus_subtilis_168_Competent_cell_Prep_and_Transformation MM media] and left to grow at 37 ̊C overnight. We continued the protocol on
 +
<html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#26/6/13" target="_blank">June 26th</a> </html>.
 +
 +
====Microfluidics Introduction====
 +
Our iGEM team attended a talk about microfluidics given by Sunny Park. Microfluidics is vital to some of our sub-projects ([https://2013.igem.org/Team:Newcastle/Project/shuffling_endosymbiosis Genome Shuffling] and [https://2013.igem.org/Team:Newcastle/Project/shape_shifting Shape Shifting]), therefore we looked into the mechanism of operation, possible uses and creation of design for master moulds on the silicon wafer.
 +
 +
====HBsu BioBrick Cloning Strategy====
 +
The HBsu-GFP and HBsu-RFP BioBricks were sent off for synthesis. We then created an overnight liquid culture of LR2 rod ''B.subtilis cells'' in [https://2013.igem.org/Team:Newcastle/Notebook/protocols#L-form_Media_Components NB/MSM] media, ready to be used to make L-form plates to obtain microscopic pictures.
 +
</div>
 +
 +
== 6 ==
 +
=== 26 ===
 +
==== Modelling ====
 +
<div>
 +
*Preparation for UCL
 +
*''B.subtilis'' Transformation
 +
</div>
 +
==== Details ====
 +
<div>
 +
====Preparation for UCL====
 +
The team continued work on our modelling presentation for the UCL meetup. We added information about ordinary differential equation vs stochastic modelling and about Markov chain (Figure 1).
 +
 +
[[File:Geoff_working.jpg |frameless|200px]]
 +
 +
[[File:Markov.png |frameless|500px]]
 +
 +
Figure 1: Markov Chain
 +
 +
====''B.subtilis'' Transformation====
 +
 +
'''Aim:'''
 +
 +
To transform the bacteria with Groningen plasmid.
 +
 +
'''Methods:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#25/6/13" target="_blank">June 25th</a> </html> for the first part of the protocol.
 +
 +
We transferred 1ml of the prepared ''B.subtilis'' str. 168 into fresh MM media. We then  tranformed the bacteria with the Groningen plasmid following the [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Bacillus_subtilis_168_Competent_cell_Prep_and_Transformation ''B.subtilis'' str. 168 transformation protocol]. We also made some frozen competent ''B.subtilis'' str. 168 in glycerol.
 +
 +
'''Results:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#27/6/13" target="_blank">June 27th</a> </html>.
 +
 +
 +
</div>
 +
 +
== 6 ==
 +
=== 27 ===
 +
==== Modelling ====
 +
<div>
 +
*Preparation for UCL
 +
*Transformation Prep
 +
</div>
 +
==== Details ====
 +
<div>
 +
====Preparation for UCL ====
 +
We began brainstorming what we should cover in our [https://2013.igem.org/Team:Newcastle/Outreach/Workshop modelling workshop] presentation for the [https://2013.igem.org/Team:Newcastle/Outreach/uk_meet YSB 1.0]. We decided to first describe biological modelling and talk about stochastic vs differential models. Before introducing BioNetGen,talking about it's benefits and covering the basics of this language.
 +
   
 +
====''B.subtilis'' Transformation====
 +
 +
'''Aim and Methods:'''
 +
 +
For Aim and Protocol, please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#25/6/13" target="_blank">June 25th</a> </html> and <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#26/6/13" target="_blank">June 26th</a> </html>.
 +
 +
'''Results:'''
 +
 +
No growth has been observed on the chloramphenicol plates apart from a single colony which might be just background growth.
 +
 +
</div>
 +
 +
 +
== 6 ==
 +
=== 28 ===
 +
==== Titles ====
 +
<div>
 +
*Transform ''B.subtilis 168'' with Groningen 2012 plasmid and RFP
 +
</div>
 +
==== Details ====
 +
<div>
 +
 +
====Groningen plasmid characterisation====
 +
 +
'''Aim:'''
 +
 +
To characterise the [http://parts.igem.org/wiki/index.php?title=Part:BBa_K818000 Groningen 2012 integration plasmid].
 +
 +
'''Methods:'''
 +
 +
The transformation was done using the [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Bacillus_subtilis_168_Competent_cell_Prep_and_Transformation protocol] for competent ''Bacillus subtilis''.
 +
 +
Positive control: pGFPrrnB plasmid
 +
 +
Negative control: water
 +
 +
We then plated the transformants into LB + 5ug/ml Chloramphenicol plates.
 +
 +
'''Results and Discussion'''
 +
 +
Please refer <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#1/7/13" target="_blank">July 1st</a> </html>.
 +
 +
</div>
 +
 +
== 7 ==
 +
=== 1 ===
 +
==== Titles ====
 +
<div>
 +
*Grow ''B.subtilis 168'' for transformation
 +
*Sucrose test
 +
</div>
 +
 +
==== Details ====
 +
 +
<div>
 +
 +
==== Results from Transformation ====
 +
 +
'''Aim and Methods:'''
 +
 +
Please refer <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#28/6/13" target="_blank">June 28th</a> </html>.
 +
 +
'''Results:'''
 +
 +
We checked the transformation plates from the <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#28/6/13" target="_blank">June 28th</a> </html> and found colonies have grown. We decided to conduct the sucrose test to check whether the cell contained actual Groningen plasmid. (see below)
 +
 +
==== Sucrose test ====
 +
 +
'''Aim:'''
 +
 +
To check whether the colonies on the Cm plate with ''B.subtilis 168'' containing Groningen 2012 integration plasmid actually contained transformant cells rather than a random mutants/contaminant.
 +
 +
'''Methods:'''
 +
 +
Transfer the culture of into LB + 1% sucrose media and leaving it to grow over night. Protocol to be continued on <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#2/7/13" target="_blank">July 2nd</a> </html>.
 +
 +
''' Results and Discussion:'''
 +
 +
Please refer <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#2/7/13" target="_blank">July 2nd</a> </html>.
 +
 +
==== Transform ''B.subtilis 168'' with Groningen 2012 plasmid and RFP====
 +
 +
'''Aim:'''
 +
 +
In case if the transformation of Groningen plasmid into B. subtilis did not work, we decided to inoculated 5 ml of freshly prepared MM media with ''B.subtilis'' str.168 colonies to grow overnight in preparation to repeat the protocol.
 +
 +
'''Methods'''
 +
 +
A single colony of B.subtilis strain 168 was picked and transferred into MM media and left to grow at 37 ̊C overnight. We continued the protocol on <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#2/7/13" target="_blank">July 2nd</a> </html> .
 +
 +
''' Results and Discussion:'''
 +
 +
Please refer <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#3/7/13" target="_blank">July 3rd</a> </html>.
 +
 +
 +
</div>
 +
 +
== 7 ==
 +
=== 2 ===
 +
==== Titles ====
 +
<div>
 +
*Transforming ''B.subtilis 168''
 +
*Results of sucrose test
 +
</div>
 +
==== Details ====
 +
<div>
 +
 +
====Sucrose Test====
 +
 +
'''Aim:'''
 +
 +
To check whether the colonies on the Cm plate with B.subtilis 168 containing Groningen 2012 integration plasmid actually contained transformant cells rather than a random mutants/contaminant.
 +
 +
'''Methods:'''
 +
 +
Following from the protocol indicated on <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#1/7/13" target="_blank">July 1st</a> </html>, we checked the pH of the solution of cells from the Cm plate with Groningen 2012 integration plasmid incubated in sucrose rich media overnight to check for presence of acidic metabolites of sucrose and hence the activity of AmyE.
 +
 +
'''Results'''
 +
 +
The results were as hoped, as the pH of both the samples we prepared was the same as the pH of the +ve control (''Bacillus 168'' cells):4.7, 4.8, 5.04.
 +
 +
====Transformation====
 +
 +
'''Aim:'''
 +
 +
To transform B. subtilis with Groningen 2012 integration plasmid.
 +
 +
'''Methods:'''
 +
 +
We transformed ''B.subtilis 168'' cells with Groningen 2012 integration plasmid and with pGMP (+ve control) and no plasmid at all (-ve control). Plated the colonies out according to the protocol and left to grow over night.
 +
 +
'''Results and Discussion:'''
 +
 +
Please see <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#3/7/13" target="_blank">July 3rd</a> </html> for results and discussion.
 +
 +
</div>
 +
 +
== 7 ==
 +
=== 3 ===
 +
==== Titles ====
 +
<div>
 +
*Check the results of transformation
 +
*Set up the test for Amylase
 +
</div>
 +
==== Details ====
 +
<div>
 +
 +
====Groningen Plasmid Transformation Results====
 +
 +
'''Aim and Methods:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#2/7/13" target="_blank">July 2nd</a> </html>
 +
 +
'''Results:'''
 +
 +
No colonies were found on the chloramphenicol plates ''B.subtilis 168'' with Groningen 2012 plasmid, however there were a few colonies on the positive control, ''B.subtilis 168'' with pGMP (Figure 1) integration plasmid plates and no colonies on ''B.subtilis 168'' LB + chloramphenicol plates.
 +
 +
[[File:P1050607.JPG|frameless|500px]]
 +
 +
Figure 1: ''B. subtilis 168'' + pGMP on LB + Cm plate. Although a few colonies are found, it is not confirmed whether the pGMP insert is present.
 +
 +
====Amylase Test====
 +
 +
'''Aim:'''
 +
 +
To confirm that the pGMP plasmid was integrated in all of the colonies.
 +
 +
'''Methods:'''
 +
 +
Transfer a few colonies onto a freshly made LB + Starch agar plates. Check the amylase function using the iodine test for starch on <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#4/7/13" target="_blank">July 4th</a> </html>.
 +
</div>
 +
 +
'''Results and Discussion'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#4/7/13" target="_blank">July 4th</a> </html>
 +
 +
== 7 ==
 +
=== 4 ===
 +
==== Titles ====
 +
<div>
 +
*Modelling Presentation
 +
*Checking starch plates
 +
</div>
 +
==== Details ====
 +
<div>
 +
====Modelling Presentation====
 +
We made a few changes to our modelling presentation and practised our delivery in preparation for the presentation to members of the school of bioinformatics.
 +
 +
====Amylase Test====
 +
 +
'''Aim and Methods:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#3/7/13" target="_blank">July 3rd</a> </html>
 +
 +
'''Results:'''
 +
 +
The starch plates from yesterday were checked and it was found that they have overgrown.
 +
 +
[[File:P1050610.JPG|frameless|500px]]
 +
 +
Figure 1: Overgrown starch plates.
 +
 +
'''Discussion:'''
 +
 +
The experiment will be repeated.
 +
 +
====Repeating Amylase Test====
 +
 +
'''Aim:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#3/7/13" target="_blank">July 3rd</a> </html>
 +
 +
'''Methods:'''
 +
 +
Starch agar plates were made including the antibiotic chloramphenicol (Cm) in the media. After these plates were made, colonies were transferred directly onto the plates and were left overnight.
 +
 +
'''Results:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#5/7/13" target="_blank">July 5th</a> </html>
 +
 +
</div>
 +
 +
== 7 ==
 +
=== 5 ===
 +
==== Titles ====
 +
<div>
 +
*Workshop Practice Presentation
 +
*Starch test
 +
</div>
 +
==== Details ====
 +
<div>
 +
====Workshop Practice Presentation====
 +
We gave a workshop practice presentation to members of the school of bioinformatics. It was decided that we shouldn't talk about the subtilin two-components system model, because it might be too complex for our workshop.
 +
It was suggested that our workshop needed to be a little less like a presentation, with more interaction for the participants.
 +
 +
====Starch test====
 +
 +
''' Aim and Methods:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#3/7/13" target="_blank">July 3rd</a> </html>
 +
 +
'''Results:'''
 +
The starch plates were checked and a lawn of bacteria was found. The starch test was done anyway using vaporised iodine. The test showed a positive result for pGFP as it turned black (Figure 1: left plate) showing no amylase was present and there for it had transformed. The B.subtilis (positive control) did not go black because the starch was consumed by the bacteria as expected (Figure 1: white plate). Also E.coli was left with the Groningen plasmid in 10ml of LB over the weekend for purification. This was done because stocks of the Groningen plasmid were running low.
 +
 +
[[File:Barecillus IodineTest.jpg|400px]]
 +
 +
Figure 1: Results from Iodine Test. Black plate contains pGFP, white plate contains B. subtilis and crystalized plate is just iodine crystals
 +
 +
'''Discussion'''
 +
 +
From the results, we can confirm that pGFP rrnB has an unfunctional amyE and hence it is unable to digest the starch, resulting in a black plate. The B. subtilis plate is white because there is a functional amyE and therefore the starch has been digested. From this experiment, we can tell that pGFP rrnB has been integrated into the correct region while there is no insert in that region in the B.subtilis plate.
 +
 +
</div>
 +
 +
== 7 ==
 +
=== 8 ===
 +
==== Titles ====
 +
<div>
 +
* Updated SGM tutorial
 +
* Finalized workshop presentation
 +
</div>
 +
==== Details ====
 +
<div>
 +
 +
====SGM tutorial====
 +
We added a modelling section to the SGM tutorial for potential funding. Deciding what information to include was a challenge due to the time constraint. We considered some of the exercises in the workshop for the tutorial.
 +
 +
====UCL Presentation Practice====
 +
We practiced the UCL presentation to everyone on the team before everyone on the team gave feedback and constructive criticism which was recorded and addressed.
 +
 +
[[File:UCLpresentation.jpeg |frameless|400px]]
 +
 +
==== Workshop presentation====
 +
The slides for the workshop were edited according to criticism from the feedback session on the 5th. We also began producing a handout with exercises to complete during the workshop.
 +
 +
</div>
 +
 +
== 7 ==
 +
=== 9 ===
 +
==== Titles ====
 +
<div>
 +
*Modelling Workshop
 +
*Groningen plasmid Mini-prep
 +
*''B.subtilis'' Transformation
 +
</div>
 +
==== Details ====
 +
<div>
 +
====Modelling Workshop Feedback Form====
 +
We produced a feedback form for attendees of our Workshop. This will be useful to access our workshops success and to improve its content for any future occasions we deliver a modelling workshop.
 +
====Groningen plasmid Mini-prep====
 +
 +
'''Aim and Methods:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#24/6/13" target="_blank">June 24th</a> </html>
 +
 +
'''Results:'''
 +
 +
The Groningen plasmid was purified using plasmid [https://2013.igem.org/Team:Newcastle/Notebook/protocols#QIAprep_Spin_Miniprep_Kit Miniprep] of previously prepared ''E.coli''. The purity was checked using the [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Nanodrop_quantification_of_DNA_extracts NanoDrop] and a result of 183.7 was obtained meaning the DNA was usable in subsequent protocols.
 +
 +
====''B.subtilis'' Transformation====
 +
'''Aim:'''
 +
 +
To transform the bacteria with Groningen plasmid.
 +
 +
'''Methods:'''
 +
 +
A single colony of ''B.subtilis'' strain 168 was picked and transferred into [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Bacillus_subtilis_168_Competent_cell_Prep_and_Transformation MM media] and left to grow at 37 ̊C overnight. We continued the protocol on
 +
<html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#10/7/13" target="_blank">July 10th</a> </html>.
 +
 +
 +
</div>
 +
 +
==7==
 +
===10===
 +
====Titles====
 +
<div>
 +
*''B.subtilis'' transformation
 +
*Receiving L-form Strain
 +
</div>
 +
==== Details ====
 +
<div>
 +
====''B.subtilis'' transformation====
 +
 +
'''Aim:'''
 +
 +
To transform the bacteria with Groningen plasmid.
 +
 +
'''Methods:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#9/7/13" target="_blank">July 9th</a> </html> for the first part of the protocol.
 +
 +
The ''B.subtilis'' transformation was carried out again to see if it would successfully integrate the Groningen plasmid when a lower concentration of Cm antibiotic is used in the plates. The plates used include:
 +
*''B.subtilis'' transformed with 10µl Groningen plasmid on 5µg/ml Cm, 12.5µg/ml Cm, Amp and LB
 +
*''B.subtilis'' transformed with 20µl Groningen plasmid on 5µg/ml Cm and 12.5µg/ml Cm
 +
*''B.subtilis'' transformed with 10µl pGFP (positive control) on 5µg/ml Cm, 12.5µg/ml Cm
 +
*''B.subtilis'' with water (negative control) on 5µg/ml Cm, 12.5µg/ml Cm and Amp
 +
 +
'''Results:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#11/7/13" target="_blank">July 11th</a> </html>.
 +
 +
====Receiving ''B.subtilis'' L-Form====
 +
 +
Today we received two plates of ''B.subtilis'' L-Form on a LB + 0.8% Xylose plate, courtesy of [https://2013.igem.org/Team:Newcastle/Team Dr. Ling Juan Wu], which contains the original switch brick(BioBrick incompatable). One of the L-form has a GFP marker on its genome, and the other contain RFP. We also received the sequence of this strains genome.
 +
</div>
 +
 +
 +
==7==
 +
===11===
 +
==== Titles ====
 +
<div>
 +
*''B.subtilis'' transformation
 +
*Sucrose test
 +
*Chromosomal Extraction
 +
</div>
 +
==== Details ====
 +
<div>
 +
====''B.subtilis'' transformation====
 +
 +
'''Aim and Methods:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#9/7/13" target="_blank">July 9th</a> </html> and <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#10/7/13" target="_blank">July 10th</a> </html>.
 +
 +
'''Results:'''
 +
The following are pictures of the plates:
 +
 +
[[File:P1050613.JPG |frameless|500px]]
 +
 +
Figure 1: ''B.subtilis'' transformed with 10µl Groningen plasmid on 5µg/ml Cm, 12.5µg/ml Cm, Amp and LB
 +
 +
[[File:P1050615.JPG |frameless|500px]]
 +
 +
Figure 2: ''B.subtilis'' transformed with 10µl pGFP (positive control) on 5µg/ml Cm, 12.5µg/ml Cm
 +
 +
====Sucrose test====
 +
 +
'''Aim:'''
 +
 +
To check whether the colonies on the Cm plate with ''B.subtilis 168'' containing Groningen 2012 integration plasmid actually contained transformant cells rather than a random mutants/contaminant.
 +
 +
'''Methods:'''
 +
 +
Both sucrose and glucose agar was made, left to cool, plated and left to set. Then the culture was transfered into LB + 1% sucrose media and leaving it to grow over night.
 +
 +
''' Results and Discussion:'''
 +
 +
Please refer <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#16/7/13" target="_blank">July 16th</a> </html>.
 +
 +
 +
====Extracting Chromosome from the ''B. subtilis'' received====
 +
Using the [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Chromosomal_DNA_Extraction protocol] and kit supplied by Qiagen, we extracted the chromosome out of the B. subtilis that contain the Switch Brick in it. The spec reading showed that the DNA is actually present and to prevent the chromosome to be degraded it was stored in -20oC.
 +
</div>
 +
 +
== 7 ==
 +
=== 12 ===
 +
==== Titles ====
 +
<div>
 +
*YSB 1.0 Conference
 +
*Modelling Workshop
 +
</div>
 +
==== Details ====
 +
<div>
 +
==== YSB 1.0 Conference ====
 +
 +
[[File:Newcastle2013ysbgroup.JPG |500px| link=https://2013.igem.org/Team:Newcastle/Outreach/uk_meet|alt=YSB meetup]]
 +
 +
The team travelled down to London for the Young Synthetic Biologists (YSB1.0) conference with the other UK iGEM teams. On arrival at the conference, the team put up their poster for display and proceeded to listen to other teams giving presentations about their projects. After lunch Yana, Geoff, Justas and James gave a modelling workshop on [https://2013.igem.org/Team:Newcastle/Outreach/Workshop Rule Based Modelling with BioNetGen]. During this time other team members attended various workshops about BioArt and public engagement. Discussions were ongoing throughout the day regarding teams posters and our own project.
 +
 +
More details can be found on the [https://2013.igem.org/Team:Newcastle/Outreach/uk_meet YSB1.0 page].
 +
</div>
 +
 +
== 7 ==
 +
=== 13 ===
 +
==== Titles ====
 +
<div>
 +
*YSB 1.0 Conference
 +
*Presentation
 +
</div>
 +
==== Details ====
 +
<div>
 +
==== YSB 1.0 Conference ====
 +
<div style="text-align:center;">
 +
[[File:BareCillus_UCL_Presentation_1.jpg | left | 400px]]
 +
[[File:BareCillus_UCL_Presentation_2.jpg | left | 400px]]
 +
</div>
 +
<div class="clear"></div>
 +
On arrival at the second day of the conference the team had the opportunity to view the posters and projects of other teams. A 10 minute [https://2013.igem.org/Team:Newcastle/Outreach/uk_meet presentation] about our project was also given, followed by 5 minutes of questions. The presentation was very well received, resulting in many interesting questions and generating a lot of interest about the project. The entire conference split into groups after the presentations to discuss topics including modelling, wiki design, parts characterisation, human practices and SynBioSoc.
 +
 +
More details can be found on the [https://2013.igem.org/Team:Newcastle/Outreach/uk_meet YSB1.0 page].
 +
</div>
 +
 +
==7==
 +
===15===
 +
==== Titles ====
 +
<div>
 +
*Sequence Analysis
 +
*Primer design
 +
</div>
 +
==== Details ====
 +
<div>
 +
 +
====Switch Brick Sequence Analysis====
 +
We looked through the chromosomal sequence of the L-form ''B.subtilis'' we acquired from Dr. Ling Juan Wu, and located the region (ranging from the pbpb up to the murE gene) and sequence of the Switch Brick. Inside the strain that we received, the Pxyl and the Chloramphenicol resistance gene were already present in the region so it saved us a bit of work as we didn't have to clone it in. However, the sequence contains multiple illegal restriction sites for the BioBrick (EcoRI and PstI). To fix this issue, we decided to make a to synonymous change (no AA change) to the sequence where the restriction sites are located. The Switch Brick sequence is then sent off to DNA 2.0 for synthesis. Whilst waiting for the synthesised BioBrick to arrive, we will be using the current Switch BioBrick which contain EcoRI and PstI for our experiments.
 +
 +
====Primer design for switch BioBrick====
 +
 +
We designed primers to clone out and amplify the [https://2013.igem.org/Team:Newcastle/Parts/l_form_switch switch BioBrick] from the strain that we received.
 +
 +
The primers were as follows:
 +
 +
BBa_K1185000_1_Forward Primer (20bp + XbaI tag + 'AAA')
 +
 +
5’ AAATTCTAGAGCAAAAGAAAGCAAAAGAGGA 3’
 +
 +
BBa_K1185000_1_Reverse Primer (19bp + SpeI tag + 'AAA')
 +
 +
5’ AAATACTAGTATTGTCCCTGTTATCCCAAT 3’
 +
 +
</div>
 +
 +
== 7 ==
 +
=== 16 ===
 +
==== Titles ====
 +
<div>
 +
*Making Plant Agar Plates
 +
*Sucrose test
 +
</div>
 +
==== Details ====
 +
<div>
 +
====Making Agar Plates for our Plants====
 +
 +
'''Aim:'''
 +
 +
Make some M&S Agar Plates for growing plants.
 +
 +
'''Methods:'''
 +
 +
Some Murashige and Skoog Medium (M&S Medium) was made. This medium was ordered in powder form and water had to be added to it to be made into a solution. The solutions were then autoclaved to be used to make the agar for growing plants.
 +
 +
After the solutions have been autoclaved, we made some agar with the M&S Medium. We weighed out 3.0g of agar no.2 into 2x500mL bottles. 250mL of M&S Medium was then added and mixed. The agar was then autoclaved and then cooled at 50 ̊C. When it is ready to be poured, we poured the agar onto 25 plates and left it to set.
 +
 +
[[File:BareCillus MandS.jpg | 300px]]
 +
 +
 +
====Sucrose test====
 +
 +
'''Aim and Methods:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#11/7/13" target="_blank">July 11th</a> </html>.
 +
 +
'''Results and Discussion:'''
 +
 +
Inconclusive results were found as the agar was cloudy and individual colonies were not clear. For this reason a sucrose test was set up to see if the cells containing the Groningen plasmid from the plates had integrated the plasmid, consequently interrupting the sacA gene and so failing to metabolise sucrose and showing as more basic. For a positive control we used ''B.subtilis'' and sucrose (this was expected to be acidic) and our negative control was LB and sucrose (this was expected to be more basic as no metabolism). These cultures were left overnight. To see results please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#17/7/13" target="_blank">July 17th</a> </html>.
 +
 +
</div>
 +
 +
 +
==7==
 +
===17===
 +
==== Titles ====
 +
<div>
 +
*Sucrose test
 +
*Transforming ''B.subtilis 168''
 +
*Planting Seeds
 +
*Shape-shifting modelling
 +
</div>
 +
==== Details ====
 +
<div>
 +
====Sucrose test====
 +
 +
'''Aim and Method:
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#11/7/13" target="_blank">July 11th</a> </html>.
 +
 +
'''Results and Discussion:'''
 +
The sucrose test was carried out on the cultures using a PH meter. The results observed were as follows:
 +
 +
*LB + sucrose + ''B.subtilis'' = 5.15
 +
*LB + ''B.subtilis'' = 6.77
 +
*LB + Groningen plasmid + sucrose = 4.23
 +
*LB + Groningen plasmid = 6.75
 +
*LB + sucrose = 7.07
 +
 +
These results show that cells with the Groningen plasmid had functional sucrase showing the plasmid has not been integrated so colonies must have been contaminants.
 +
 +
====Transforming ''B.subtilis 168''====
 +
 +
'''Aim:'''
 +
 +
To transform B. subtilis with Groningen 2012 integration plasmid.
 +
 +
'''Methods:'''
 +
 +
Preparation for ''B.subtilis'' transformation was carried out; 5 ml of freshly prepared MM media was inoculated with ''B.subtilis'' 168 colonies to grow overnight. Also E.coli with Groningen plasmid was put in LB media and left to grow overnight. Protocol continued on <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#18/7/13" target="_blank">July 18th</a> </html>.
 +
 +
'''Results and Discussion:'''
 +
 +
Please see <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#19/7/13" target="_blank">July 19th</a> </html> for results and discussion.
 +
 +
 +
==== Planting Chinese Cabbage Seeds ====
 +
 +
'''Aim:'''
 +
 +
Plant some Chinese Cabbage seeds to prepare for washing with L-forms.
 +
 +
'''Methods:'''
 +
 +
We washed and planted cabbage and french dwarf bean seeds in preparation for the introduction of L-forms into seedlings following the [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Production_of_L-form_containing_Plants Production of L-form containing Plants protocol] up to and including step four. The seeds were planted in Murishage and Skoog containing petri dishes and placed in a dark cupboard to germinate.
 +
 +
The washing of plant seeds with L-forms will be done on <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#18/7/13" target="_blank">July 18th</a> </html>.
 +
 +
[[File:Bare_Cillus_seedz.jpg | 400px]]
 +
 +
==== Shape-Shifting modelling ====
 +
 +
Modelling tasks for the shape-shifting team were identified:
 +
 +
#Model cell shape using cytoskeleton structure
 +
#Model cell growth
 +
#Limit the growth of the cell by a certain shape (star or triangle)
 +
# OPTIONAL Change the membrane rigidity parameters and run the simulation again.
 +
 +
The shape of the cell is influenced by membrane fluidity and structure of the cytoskeleton. As cytoskeleton is present in both eukaryotic and prokaryotic cells. The former cells have no cell wall, so it is reasonable to assume that the shape of the L-form cell would obey similar rules as eukaryotic cell would. It has been determined that cytoskeleton behaves as an isotropic fluid. Therefore it's realsonable to rely on two-phase flow modelling frame (Holmes, Edelstein-Keshet, 2012).
 +
</div>
 +
 +
== 7 ==
 +
=== 18 ===
 +
==== Titles ====
 +
<div>
 +
*Innoculating Plants with L-forms
 +
*Groningen Plasmid Mini-prep
 +
*''B.subtilis'' Transformation
 +
</div>
 +
==== Details ====
 +
<div>
 +
==== Innoculating Plants with L-forms ====
 +
 +
'''Aim and Methods:'''
 +
 +
The seeds that were planted on <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#17/7/13" target="_blank">July 17th</a> </html> were checked and it was observed that the cabbage seeds had begun to germinate. This meant that they were ready to absorb L-forms. We soaked 5 cabbage seeds for 3 hours in 5ml of L-form solution and another 5 seeds in 5%(w/v) mannitol solution to act as a control. The seeds were then washed with distilled water (to lyse extracellular L-forms) and replated on Murishage and Skoog agar plates. This was done following the [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Production_of_L-form_containing_Plants Production of L-form containing Plants protocol] from stage five onwards.
 +
 +
[[File:BareCillusL-forms n seeds.jpg|200px]]
 +
 +
====Groningen Plasmid Mini-prep====
 +
 +
'''Aim:'''
 +
 +
To isolate the groningen plasmid.
 +
 +
'''Methods:'''
 +
 +
We performed a [https://2013.igem.org/Team:Newcastle/Notebook/protocols#QIAprep_Spin_Miniprep_Kit mini prep] of the Groningen 2012 integration plasmid DNA grown in ''E.coli'' overnight at 37  ̊C. The purity was tested using [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Nanodrop_quantification_of_DNA_extracts NanoDrop]. We confirmed the insert size by first cut with fast digest XbaI and BamHI and then running the product on a gel to confirm the presence of the plasmid in the purified pDNA.
 +
 +
'''Results'''
 +
 +
This was done in 8 micro centrifuge tubes. The purity of each was tested using a NanoDrop.The average purity of the 8 tubes was 324ng/µl.
 +
 +
====''B.subtilis'' Transformation====
 +
 +
'''Aim:'''
 +
 +
To transform B. subtilis with Groningen 2012 integration plasmid.
 +
 +
'''Methods:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#17/7/13" target="_blank">July 17th</a> </html> for the first part of the protocol. The B.subtilis transformation was carried out again to see if it would successfully integrate the Groningen plasmid when a higher concentration of the plasmid was used. The plates used include:
 +
 +
*pGFP (positive control)on 5µg/ml Cm and 12.5µg/ml Cm
 +
 +
*Groningen plasmid 30 µl on 5µg/ml Cm and 12.5µg/ml Cm
 +
 +
*Groningen plasmid 45 µl on 5µg/ml Cm and 12.5µg/ml Cm
 +
 +
*Groningen plasmid 60 µl on 5µg/ml Cm and 12.5µg/ml Cm
 +
 +
*Water (negative control) on 5µg/ml Cm and 12.5µg/ml Cm
 +
 +
'''Results and Discussion:'''
 +
 +
Please see <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#19/7/13" target="_blank">July 19th</a> </html> for results and discussion.
 +
 +
 +
</div>
 +
 +
== 7 ==
 +
=== 19 ===
 +
==== Titles ====
 +
<div>
 +
*''B.subtilis'' Transformation
 +
*Modelling
 +
</div>
 +
==== Details ====
 +
<div>
 +
====''B.subtilis'' Transformation====
 +
 +
'''Aim and Methods:'''
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#17/7/13" target="_blank">July 17th</a> </html>.
 +
 +
'''Results and Discussion:'''
 +
 +
The results of the last transformation of ''B.subtilis'' with Groningen 2012 integration plasmid look promising. Everything has worked as expected. The insignificant difference in the number of colonies grown on plate with cells inoculated with different amount of plasmid indicates that the transformation occurred as efficiently as it could at around 9ug of DNA per reaction tube. The reason why nothing grew on the plates with 12.5ug/ml of chloramphenicol may be the inefficiency of the promoter used. The colony counts are recorded in a table below.
 +
 +
{| border="1" class="data"
 +
<!--|-
 +
| colspan="6" style="color: black; align: centre" | '''Transformation Results'''-->
 +
|- 
 +
! Agar/Transformants
 +
! pGFP (positive control)
 +
! Groningen plasmid 30 µl
 +
! Groningen plasmid 45 µl
 +
! Groningen plasmid 60 µl
 +
! Water
 +
|- class="even"
 +
! Nutrient Agar + 5µg/ml Cm
 +
| 134 Colonies
 +
| 9 Colonies
 +
| 12 Colonies
 +
| 7 Colonies
 +
| 0 Colonies
 +
|- align='centre' class="odd"
 +
! LB Agar = 12.5µg/ml Cm
 +
| 142 Colonies
 +
| 1 Colonies
 +
| 2 Colonies
 +
| 3 Colonies
 +
| 0 Colonies
 +
|}
 +
 +
[[File:Untitled-3.jpg|200px]]
 +
 +
To confirm the integration of the plasmid the test for sucrose metabolism will be carried out on Monday.
 +
 +
====Modelling====
 +
 +
Preparation work for modelling, learning to use VCell software. We started working our way through simple tutorials to get more familiar with the program before doing "real work".
 +
 +
;Cell Shape model :The structure and function of cytoskeleton were studied. The cell behaves like an isotropic fluid in terms of shape and movement, therefore some of the factors which influence the shape could be identified: Cell Volume, surface area, surface tension, hydrostatic pressure.
 +
 +
:It turns out that eukaryotic cytoskeleton is characterised as a two-phase viscous, responsive and contractile liquid. If bacterial cytoskeleton is similar, it would complicate the modelling by a fair bit. More insight into the structure and physical properties of bacterial cytoskeleton is needed. In terms of cell growth and division it will be useful to look into the properties of ''FtsZ'' and ''MreB'' as well as properties of the vesicular membrane and physical triggers of the process of 'blebbing'. So that's a job for Monday.
 +
</div>
 +
 +
== 7 ==
 +
=== 22 ===
 +
==== Titles ====
 +
<div>
 +
*Made SMM media
 +
*Made sucrose and glucose agar
 +
*Creating L-forms
 +
*BioGame
 +
</div>
 +
==== Details ====
 +
<div>
 +
====Made SMM media====
 +
More SMM media was made, in order to make the sucrose and glucose plates which will be used to test if the Groningen plasmid has been integrated.
 +
 +
====First trial on creating ''B.subtilis'' L-form====
 +
 +
'''Aim:'''
 +
 +
To create L-forms.
 +
 +
'''Methods:'''
 +
 +
We used the plate of B.subtilis rod cells (containg the switch BioBrick) that [https://2013.igem.org/Team:Newcastle/Team Dr. Ling Juan Wu] provided us on the 15th July. This was carried out using both; [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Creating_L-forms Direct Method] and [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Protoplasting_to_generate_L-form Protoplasting to generate L-form].
 +
 +
'''Results:'''
 +
 +
Both protocols were successful in creating L-forms.
 +
 +
[[File:IMG-20130727-WA0000.jpg|200px]]
 +
 +
====Made sucrose and glucose agar====
 +
 +
Both sucrose and glucose agar was made, and sent for auto claving
 +
 +
[[File:P1050679.JPG|200px]]
 +
 +
 +
 +
====BioGame====
 +
Work restarted on the BioGame. The Sprite class has been extended to cope with both static and animated Sprites utilising Sprite Sheets. An animated background has been created for the game and further work is planned on the user interface in the coming days.
 +
 +
</div>
 +
 +
== 7 ==
 +
=== 23 ===
 +
==== Titles ====
 +
<div>
 +
*Tested the Lysozyme Protoplast Formation Protocol
 +
*Sucrose and Glucose test
 +
*Improving the poster design
 +
</div>
 +
==== Details ====
 +
<div>
 +
====Tested the Lysozyme Protoplast Formation Protocol====
 +
The rest of the team members tested the protocol and further suggestions for improvement were made. Despite the suggestion, all teams were successful in creating L-forms. (microscope picture)
 +
 +
[[File:L-form (growth curve).jpg|200px]]
 +
 +
====Sucrose and Glucose test====
 +
 +
'''Aim:'''
 +
 +
To check whether the colonies on the Cm plate with B.subtilis 168 containing Groningen 2012 integration plasmid actually contained transformed cells rather than a random mutants/contaminant.
 +
 +
'''Methods:'''
 +
 +
The agar was melted on heat plates for half an hour, left to cool, plated and left to set in the fume cupboard. Then the colonies from the transformation plates were plated out onto the agar. Both ''B.subtilis'' with the Groningen plasmid at concentrations of 30, 45 and 60 µl and ''B.subtilis'' alone (negative control) were put onto both sucrose and glucose plates.
 +
 +
'''Results:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#23/7/13" target="_blank">July 23th</a> </html>.
 +
 +
====Improving the poster design====
 +
 +
Progress on the poster design was made by thinking of different alterations to the layout to make the poster more readable. The favorite was selected as a starting point for the final design.
 +
</div>
 +
 +
== 7 ==
 +
=== 24 ===
 +
==== Titles ====
 +
<div>
 +
*Sucrose and Glucose plates
 +
*Poster design
 +
*Wiki
 +
*BioGame
 +
</div>
 +
==== Details ====
 +
<div>
 +
====Sucrose and Glucose plates====
 +
 +
'''Aim and Methods:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#23/7/13" target="_blank">July 23th</a> </html>.
 +
 +
'''Results:'''
 +
 +
Both the Sucrose and Glucose plates overgrew which means that the Groningen plasmid is not integrated. our next step is to consider whether to sequence the plasmid using the BioBrick primers.
 +
 +
[[File:24th.jpg|500px]]
 +
 +
====Poster Design====
 +
Today, the layout was developed further and shown to the group. The next steps would be to introduce the text, logos and illustrations.
 +
 +
[[File:New poster layout.jpg|500px]]
 +
====BioGame====
 +
A loading bar has now been added for the BioGame, providing the user graphical representation of how long they will be waiting for the game to load. This then opens into the main game screen where your Bacterium can be seen. The next stage is to add the User Interface allowing the user to &quot;take care&quot; of their Bacterium and install BioBricks.
 +
</div>
 +
 +
== 7 ==
 +
=== 25 ===
 +
==== Titles ====
 +
<div>
 +
*PCR Switch BioBrick
 +
*Planting Seeds
 +
</div>
 +
==== Details ====
 +
<div>
 +
 +
====PCR Switch BioBrick====
 +
The Primers ordered to clone the Switch BioBrick arrived. Using the chromosome extracted from the ''B. subtilis'' which contain the Switch BioBrick we perform PCR to amplify the BioBrick. The spectophotometer reading for the PCR product showed good results (Figure 1) , however when running it on agarose gel to check for the size it didn't show (expected product around 2,666bp)(Figure 2).
 +
 +
[[File:Swirtch_Brick.jpg|frameless|500px]]
 +
 +
Figure 1: DNA concentration reading by conducting Nanodrop spectrophotometry
 +
 +
[[File:IspA_current_version_all_can%27t_see_2.jpg|frameless||500px]]
 +
 +
Figure 2:Gel to check the size of the BioBrick (To label)
 +
 +
====Planting Seeds====
 +
 +
'''Aim:'''
 +
 +
To plant seeds in order to wash them with L-forms and visualized by confocal microscopy.
 +
 +
'''Methods:'''
 +
 +
We washed and planted chinese cabbage seeds in preparation for the introduction of L-forms into seedlings following the [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Production_of_L-form_containing_Plants Production of L-form containing Plants protocol] up to and including step four. The seeds were planted in Murishage and Skoog containing petri dishes and placed in a dark cupboard to germinate.
 +
 +
'''Results:'''
 +
Due to contamination did not get results. Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#26/7/13" target="_blank">July 26th</a> </html> for more detail
 +
 +
 +
</div>
 +
 +
== 7 ==
 +
=== 26 ===
 +
==== Titles ====
 +
<div>
 +
*Cloning Switch Brick via PCR
 +
*Travel Arrangements
 +
*L-form culture contaminate
 +
*Treating Plants with L-forms
 +
</div>
 +
==== Details ====
 +
<div>
 +
 +
====PCR Switch Brick====
 +
 +
'''Aim:''
 +
 +
To confirm the size of the switch brick.
 +
 +
'''Methods:'''
 +
 +
We performed another round of PCR to amplify the Switch BioBrick from the extracted chromosome. The spec reading show good results (Figure 1), and we run an agarose gel to confirm its present. From the gel we can see a ban around 2,000-3,000bp region (Figure 2), and our BioBrick is around 2,600bp this conclude that we have successfully amplified our BioBrick.
 +
 +
[[File:Switch_brick-PCR_2.jpg|500px]]
 +
 +
Figure 1: Switch brick spectrophotometer reading with Nanodrop
 +
 +
[[File:IspA_its_there.jpg|500px]]
 +
 +
Figure 2: Gel electrophoresis to confirm size of switch brick size(To label)
 +
 +
====Travel Arrangements====
 +
Research was done into the most convenient way to travel to the regional jamboree in Lyon in October. A spread sheet was made of the different travel options so a balance could be found between cost and time efficiency. This included timings, prices and duration of trains, flights and buses.
 +
 +
====Contamination by ''Staphylococcus aureus''====
 +
We checked our stocks L-form culture under the inverted microscopes and found out that all of the culture have been contaminated by ''S. aureus''.
 +
 +
====Treating Plants with L-forms====
 +
The above mentioned ''S. aureus'' contamination means we do not have any L-forms to wash our seedlings in and so cannot continue with the [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Production_of_L-form_containing_Plants Production of L-form containing Plants protocol]. We will have to grow new seedlings once we have some L-forms free from contamination.
 +
</div>
 +
 +
== 7 ==
 +
=== 29 ===
 +
==== Titles ====
 +
<div>
 +
*Creating L-form
 +
*Transformation of ''B. subtilis'' with the switch biobrick
 +
*MM media innoculation
 +
*Cell wall synthesis modelling
 +
</div>
 +
====Details====
 +
<div>
 +
====Creating L-form culture====
 +
 +
'''Aim:'''
 +
 +
To make an L-form culture.
 +
 +
'''Methods:'''
 +
 +
Using the [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Protoplasting_to_generate_L-form Protoplasting protocol], we converted both of the L-form strains we possess (GFP and RFP marker) into L-form. We left them to grow for 2 days in 30 ̊C incubator.
 +
 +
====Transformation of ''B. subtilis'' with the switch biobrick====
 +
 +
'''Aim:'''
 +
 +
To transform ''B.subtilis'' str.168 with the switch brick.
 +
 +
'''Methods:'''
 +
 +
Inoculate 10ml of MM medium with ''B.subtilis'' str.168 and left to grow overnight in 37 ̊C for preparation of Transformation.
 +
 +
The protocol to be continued on <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#30/7/13" target="_blank">July 30th</a> </html>
 +
 +
'''Results:'''
 +
 +
<html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#31/7/13" target="_blank">July 31st</a> </html>
 +
 +
====Cell wall synthesis modelling====
 +
 +
Found a model of Peptidoglycan biosynthesis in ''B.subtilis'' on the BioModels Database. Generated automatically from the Kegg pathway, so the model is quite complicated and unclear. We plan on converting the SBML to bngl (i.e. useable in BioNetGen and adding the ability to switch the cell wall on and off- simulating our main BioBrick 
 +
</div>
 +
 +
 +
== 7 ==
 +
=== 30 ===
 +
==== Titles ====
 +
<div>
 +
*Cell Shape Model
 +
*Transformation of ''B. subtilis'' with the switch biobrick
 +
</div>
 +
==== Details ====
 +
<div>
 +
====Cell Shape Model====
 +
Substantial progress was made towards the understanding of fundamental approaches to mathematical modelling. Dr. David Swailes from the Department of Mechanical Engineering has kindly agreed to help us with our task. It was thought sensible to divide the project into three parts. First model the growth of the vesicle which is not limited by anything, then model the process of growth in a confined environment from the time just after the vesicle grows to touch the sides of the chamber, followed by a model of the transition between the two phases. Tasks for Wednesday: research more on the physiology of the vesicle growth.
 +
 +
====Transformation of ''B. subtilis'' with the switch biobrick====
 +
 +
'''Aim:'''
 +
 +
To transform ''B.subtilis'' str.168 with the switch brick.
 +
 +
'''Methods:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#29/7/13" target="_blank">July 29th</a> </html> for the start of the protocol. Using the overnight ''B.subtilis'' strain.168 grown in MM media we carried out the [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Bacillus_subtilis_168_Competent_cell_Prep_and_Transformation transformation protocol] and transformed them with our naked PCR switch brick product and pGFPrrnb (as a control). We then plated the ''B.subtilis'' transformed with pGFPrrnb onto LB agar + Chloramphenicol (5ug/ml) plates, and plated out the B.subtilis with the switch brick onto LB agar + Chloramphenicol (5ug/ml) + Xyl 0.8% plates.
 +
 +
 +
'''Results:'''
 +
Please refer to  <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#31/7/13" target="_blank">July 31th</a> </html>.
 +
 +
 +
</div>
 +
 +
== 7 ==
 +
=== 31 ===
 +
==== Titles ====
 +
<div>
 +
*Transformation of ''B. subtilis'' with the switch biobrick
 +
*Visualising L-forms under Microfluidics
 +
*Translating the cell wall model
 +
</div>
 +
==== Details ====
 +
<div>
 +
 +
====Transformation of ''B. subtilis'' with the switch biobrick====
 +
 +
'''Aims and Methods:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#29/7/13" target="_blank">July 29th</a> </html> and <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#30/7/13" target="_blank">July 30th</a> </html>
 +
 +
'''Results and Discussion:'''
 +
 +
As it turns out the naked PCR product Switch BioBrick failed to be transformed, whilst the positive control worked. We found out that the efficiency and probability of transformation to works with just naked PCR product is very low. So, we then planned to clone it into a plasmid first before transforming it into our ''Bacillus subtilis''.
 +
 +
[[File:168%2BispA%3DLB%2BCm.jpg|frameless|'1000x900']] [[File:168%2Brrnb%3DLB%2BCM.jpg|frameless|'1000x900']]
 +
 +
====Visualising L-forms under Microfluidics====
 +
We created a silicon wafer of the mother machine using the master mold courtesy of [https://2013.igem.org/Team:Newcastle/Team Sunny Park]. Once the wafer set we removed any impurities using a combination of dd.H2O, acetone, and isopropanol. In order to let the silicon wafer hold together we heated with plasma under vacuum condition. We then load L-forms with two different tags on them (GFP and mCherry expression). The results showed potential endosymbiosis or cell fusion between the L-forms.
 +
 +
====Cell wall modelling====
 +
Opened the peptidoglycan biosynthesis model in copasi, to try and understand what was happening. The species names were particularly complicated so we attempted to simplify them, whilst making clear what was being referred to. There are 54 species so this took some time.
 +
</div>
 +
 +
== 8 ==
 +
=== 1 ===
 +
==== Titles ====
 +
<div>
 +
*Plasmid (pGFPrrnb) amplification
 +
*L-Form simulation
 +
</div>
 +
==== Details ====
 +
<div>
 +
====Plasmid (pGFPrrnb) Amplification====
 +
 +
'''Aims:'''
 +
 +
Amplify the pGFPrrnB.
 +
 +
'''Methods:'''
 +
 +
We transformed the competent ''E.coli'' strain DH5alpha with plasmid pGFPrrnB taken from the spring 2013 BioBrick distribution kit using the [''E.coli'' transformation protocol]. We then innoculated ''B. subtilis'', from the yesterdays transformation plate, which contained pGFPrrnb into LB + Chloramphenicol (5ug/ml).
 +
 +
==== L-Form simulation ====
 +
Started working on Java based application to simulate L-form behavior. Current goal is to make something simple, maybe moving circles?
 +
</div>
 +
 +
== 8 ==
 +
=== 2 ===
 +
==== Titles ====
 +
<div>
 +
*L-Form simulation
 +
*''E.coli'' Innoculation
 +
*Cloning switch brick
 +
</div>
 +
==== Details ====
 +
<div>
 +
==== L-Form simulation ====
 +
Started programming L-form genomic fusion simulation using Java. So far everything went smoothly, we have some bacteria basic movement mechanics, and soon will be looking into how to make two bacteria fuse when they meet together.
 +
====''E.coli'' Innoculation====
 +
We innoculated the transformed E.coli (pGFPrrnb) that we did yesterday into LB.
 +
 +
====Cloning switch brick====
 +
 +
'''Aim:'''
 +
 +
Cloning the switch brick into pSB1C3.
 +
 +
'''Methods:'''
 +
 +
We extracted our pSB1C3 plasmid from the BioBrick distribution kit. Through the use of restriction enzymes (XbaI and SpeI) we cut out the RFP insert from the MCS of the plasmid. We ran the digested product on a 0.8% agarose gel and purified the DNA (plasmid backbone) through the use of [gel extraction purification].
 +
 +
[[File:BarecillusgelelectrophoresisImage.jpeg|300px]]
 +
 +
 +
We checked the concentration of the purified DNA through nanodrop (spectrophotometer).
 +
 +
'''Results and Discussion:'''
 +
 +
It turned out that no DNA was present in the solution. This was due to too much elution buffer that was added to elute the DNA. This resulted in a very low concentration, and we will not be able to continue the [ligation protocol]. This protocol will need to be repeated the next day. Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#5/8/13" target="_blank">August 5th</a> </html>
 +
 +
[[File:BarecillusFail gel extraction pSB1C3.jpg|500px]]
 +
</div>
 +
 +
== 8 ==
 +
=== 5 ===
 +
==== Titles ====
 +
<div>
 +
*Cloning Switch Brick
 +
*Transforming HBsu-(x)fp BioBrick
 +
*BioGame
 +
</div>
 +
====Details====
 +
<div>
 +
====Cloning Switch Brick====
 +
 +
'''Aim:'''
 +
 +
Cloning the switch brick into pSB1C3
 +
 +
'''Methods:'''
 +
 +
We started off by extracting the [http://parts.igem.org/wiki/index.php/Part:pSB1C3 pSB1C3] plasmid with RFP marker through [https://2013.igem.org/Team:Newcastle/Notebook/protocols#QIAprep_Spin_Miniprep_Kit Miniprep] from the ''E.coli'' liquid broth. We performed a double digest using XbaI and SpeI to isolate the insert from the plasmid backbone. We then ran the digested sample through gel electrophoresis to separate out the different parts. Through the use of gel extraction kit and protocol, we cut out the band of interest which was around 2000bp (the backbone). We then ligate the backbone with predigested switch brick through the use of T4 ligase via sticky end ligation in a 1:3 ratio. We left the ligated product in the 4 ̊C fridge.
 +
 +
[[File:BareCillus Psb1c3 restrictyion purification.jpg|500px]]
 +
 +
Figure 1: Performed gel electrophoresis to confirm the size of the clone product.
 +
 +
====Transforming [https://2013.igem.org/Team:Newcastle/Parts/HBsu-fp HBsu-(x)fp] BioBrick====
 +
The synthesised construct arrived fully cloned into the pMutin4 plasmid from DNA2.0 and we rehydrated the DNA by adding 10ul of elution buffer. We transformed the plasmid into competent ''E.coli'' DH5-alpha and plated it out on LB + Amp plate.
 +
 +
====BioGame====
 +
Work recommenced on the BioGame with the beginning of the User Interface creation for the main game screen. This began by simply designing some basic sprite sheets for the button states, and then moved on to creating the button class. The button class started off by extending my own Sprite class, choosing to not use LibGDX's built in sprite or button class. I feel this would give me more control over the functionality of the objects, also as some of the documentation on the built in button class is a little light, it means I know exactly what it is doing.
 +
 +
</div>
 +
 +
 +
== 8 ==
 +
=== 6 ===
 +
==== Titles ====
 +
<div>
 +
*Amplifying Switch Brick
 +
*HBsu-(x)FP BioBrick Extraction
 +
*BioGame
 +
*L-Form simulation
 +
</div>
 +
==== Details ====
 +
<div>
 +
====Amplifying Switch Brick====
 +
 +
'''Aim:'''
 +
 +
To amplify the switch brick.
 +
 +
'''Methods:''
 +
 +
We transformed the pre-prepared competent ''E. coli'' DH5&alpha; cells with the Switch Brick that we have cloned in to the psB1C3 plasmid yesterday. These were then plated on to LB+chloramphenicol 5&mu;m/ml and incubated at 37 ̊C;
 +
 +
'''Results:'''
 +
 +
Detail needed!!
 +
 +
====HBsu-(x)FP BioBrick Extraction====
 +
 +
'''Aim:'''
 +
 +
To extract the HBsu-RFP & HBsuGF BioBricks from the ''E.coli''.
 +
 +
 +
'''Methods:'''
 +
 +
We took ''E. coli'' DH5&alpha; that has been transformed with HBsu-GFP/HBsu-RFP BioBrick from the plate that was made yesterday and inoculated them onto LB to let them grow before extracting the plasmid out.
 +
 +
Protocol to be continued on <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#7/8/13" target="_blank">August 7th</a> </html>
 +
 +
'''Results:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#7/8/13" target="_blank">August 7th</a> </html>
 +
 +
====BioGame====
 +
Further work has gone into developing the buttons, having now written the code for hit testing the clicks on the button. This code is a little buggy but will be improved as the program is progressed. Started to create the sub-menu that will appear when the "Install BioBrick" button is clicked. Currently this is just a blue box that will eventually contain a list of installable BioBricks.
 +
 +
==== L-Form simulation ====
 +
It's starting to look good, as a base for our L-Form simulation Ball game [http://www.ntu.edu.sg/home/ehchua/programming/java/J8a_GameIntro-BouncingBalls.html tutorial] was used. We managed to get couple balls moving around and colliding with each other.
 +
</div>
 +
 +
 +
== 8 ==
 +
=== 7 ===
 +
==== Titles ====
 +
<div>
 +
*HBsu-(x)FP BioBrick Extraction
 +
*Cloning HBsu-(x)FP BioBrick into pSB1C3 Plasmid
 +
*''B. subtilis'' str.168 Competent Cell Prep
 +
*Inoculating Chinese Cabbage with L-forms
 +
*BioGame
 +
</div>
 +
==== Details ====
 +
<div>
 +
====HBsu-(x)FP BioBrick Extraction====
 +
 +
'''Aims:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#6/8/13" target="_blank">August 6th</a> </html>
 +
 +
'''Methods:'''
 +
 +
Continued protocol from <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#6/6/13" target="_blank">August 6th</a> </html>
 +
 +
Using the [https://2013.igem.org/Team:Newcastle/Notebook/protocols#QIAprep_Spin_Miniprep_Kit QIAgen Mini-Prep protocol] we extracted the HBsu-RFP &amp; HBsu-GFP BioBricks from the ''E. coli''. We checked the concentration &amp; quality of the plasmid using a [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Nanodrop_quantification_of_DNA_extracts spectophotometer].
 +
 +
'''Results:'''
 +
 +
The DNA concentration reading was the following
 +
 +
HBsu-GFP: 67.5 ng/&mu;l
 +
HBsu-RFP: 55.5 ng/&mu;l
 +
 +
This is of good quality and will be used for cloning in the pSB1C3 plasmid on the same day.
 +
 +
====Coloning HBsu-(x)FP BioBrick into psB1C3 Plasmid====
 +
 +
'''Aim:'''
 +
 +
Clone the HBsu(x)FP BioBrick into pSB1C3 so it can be submitted to the repository.
 +
 +
'''Methods:'''
 +
 +
The HBsu-(x)FP BioBrick and the linearised pSB1C3 plasmid was cut using EcoRI and PstI. We then attempted to purify the BioBrick using the [https://2013.igem.org/Team:Newcastle/Notebook/protocols#QIAquick_Gel_Extraction_Protocol gel extraction protocol]
 +
 +
'''Results:'''
 +
 +
No bands were found after we have conducted the protocol. The protocol will be repeated on the next day.
 +
 +
====''B. subtilis'' str.168 Competent Cell Prep====
 +
Detail needed!!
 +
 +
====Inoculating Chinese Cabbage with L-forms====
 +
 +
'''Aims:'''
 +
 +
To plant Chinese Cabbage seeds on petri dishes so it can germinate and can be inoculated with L-forms.
 +
 +
'''Methods:'''
 +
 +
We washed and planted chinese cabbage seeds in preparation for the introduction of L-forms into seedlings following the [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Production_of_L-form_containing_Plants Production of L-form containing Plants protocol] up to and including step four. The seeds were planted in Murishage and Skoog containing petri dishes and placed in a dark cupboard to germinate.
 +
 +
The protocol was continued on <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#8/8/13" target="_blank">August 8th</a> </html>
 +
 +
'''Results:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#9/8/13" target="_blank">August 9th</a> </html>
 +
 +
====BioGame====
 +
Upon adding buttons into the Install BioBrick sub-menu, it was noted that any button placed over the top of the clicked button on the parent menu is started off in the "over" position and as such is automatically registering a hit. To solve this the hit test code as been completely refactored for a more accurate hit test. To aid this, ActionListeners have been added into the Button class so as to handle the desire events upon click. This will enable coders to write anonymous classes for attaching to individual buttons.
 +
</div>
 +
 +
== 8 ==
 +
=== 8 ===
 +
==== Titles ====
 +
<div>
 +
*Inoculating Plants with L-forms
 +
*''B. subtilis'' Transformation of HBsu-(x)FP
 +
*Digest pMutin4 HBsu-GFP and HBsu-RFP
 +
</div>
 +
==== Details ====
 +
<div>
 +
====''B. subtilis'' Transformation of HBsu-(x)FP====
 +
 +
'''Aim:'''
 +
 +
To transform ''B.subtilis'' with the HBsu-(x)FP biobrick into pMutin 4.
 +
 +
'''Methods:'''
 +
 +
We followed the [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Bacillus_subtilis_168_Competent_cell_Prep_and_Transformation bacillus transformation protocol]. We then  plated it out on LB + ery (5ug/ml) plates that were made earlier today.
 +
 +
Plates:
 +
 +
HBsu-GFP on LB + ery (5ug/ml) plates x2
 +
 +
HBsu-RFP on LB + ery (5ug/ml) plates x2
 +
 +
rrnB on LB + ery (5ug/ml) plates x2 (positive control)
 +
 +
Water on LB + ery (5ug/ml) plates x2 (negative control)
 +
 +
Cell in LB x2 (to check viability of cells)
 +
 +
'''Results:'''
 +
 +
Please refer to  <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#9/8/13" target="_blank">August 9th</a> </html>.
 +
 +
====Digest pMutin4 HBsu-GFP and HBsu-RFP====
 +
 +
'''Aim:'''
 +
 +
To digeste the pMutin4 HBsu-GFP and HBsu-RFP by fast digest from promega.
 +
 +
'''Methods:'''
 +
 +
The reaction we ran was:
 +
 +
45ul DNA
 +
 +
1ul 10x fast digest buffer
 +
 +
1ul PstI
 +
 +
1ul EcoRI
 +
 +
2ul Water
 +
 +
Total: 50ul
 +
 +
We left this at 37  ̊C for 3 hours.
 +
 +
Then we also cut the linearised pSB1C3 backbone that was sent from iGEM using the same restriction enzyme.
 +
The reaction used is:
 +
 +
4ul of DNA (25ng/ul)
 +
 +
4ul of master mix (Contains restriction enzyme EcoRI and PstI)
 +
 +
After the digest we kept it in the -20  ̊C freezer.
 +
 +
'''Results:'''
 +
 +
Detail needed!!
 +
 +
====Inoculating Plants with L-forms====
 +
 +
'''Aim:'''
 +
 +
To plant Chinese Cabbage seeds on petri dishes so it can germinate and can be inoculated with L-forms.
 +
 +
'''Methods:'''
 +
 +
For the first part of the protocol please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#7/8/13" target="_blank">August 7th</a> </html>.
 +
We checked the seeds we planted yesterday and observed that the chinese cabbage seeds had begun to germinate. This meant that they were ready to absorb L-forms. We soaked 20 cabbage seeds for 3 hours in 5ml of L-form solution and another 20 seeds in 5%(w/v) mannitol solution to act as a control. The seeds were then washed with distilled water (to lyse extracellular L-forms) and replated on Murishage and Skoog agar plates. This was done following the [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Production_of_L-form_containing_Plants Production of L-form containing Plants protocol] from stage five onwards.
 +
 +
'''Results:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#9/8/13" target="_blank">August 9th</a> </html>.
 +
 +
 +
 +
</div>
 +
 +
== 8 ==
 +
=== 9 ===
 +
==== Titles ====
 +
<div>
 +
*L-form Protocol
 +
*''B. subtilis'' Transformation of HBsu-(x)FP
 +
*Plant Microscopy
 +
*<span style="color:red">Project Description Due</span>
 +
</div>
 +
==== Details ====
 +
<div>
 +
====Wiki====
 +
We finalized the project description and put it onto the wiki page.
 +
====L-form Protocol====
 +
We did the [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Protoplasting_to_generate_L-form L-form protocol] to create more L-forms. Using this protocol, we created 4 flasks of L-forms which has HBsu-GFP tag on them.
 +
 +
====''B. subtilis'' Transformation of HBsu-(x)FP====
 +
 +
'''Aim and Methods:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#8/8/13" target="_blank">August 8th</a> </html>.
 +
 +
'''Results:'''
 +
 +
The transformation conducted yesterday did not work after checking the plates. Only thing that grew was control in normal LB.
 +
 +
[[File:LB ery 168H20 0908.jpg|frameless|300px]]
 +
 +
[[File:Barecillus LB ery 168rrnB 0908.jpg|frameless|300px]]
 +
 +
[[File:Barecillus LB ery HBsu-GFP 0908.jpg|frameless|300px]]
 +
 +
[[File:Barecillus LB ery HBsu-RFP 0908.jpg|frameless|300px]]
 +
 +
====Plant microscopy====
 +
 +
'''Aim and Methods:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#7/8/13" target="_blank">August 7th</a> </html> and <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#8/8/13" target="_blank">August 8th</a> </html>.
 +
 +
'''Results and Discussion:'''
 +
 +
Today we viewed the seedlings, that we had washed with L-forms yesterday,using bright field and fluorescence microscopy. When viewing an L-form washed seedling using fluorescence microscopy we noticed clearly defined green circles in several different areas of the plant. These were of the correct size (about 0.5um) to correspond to our GFP labelled L-forms. No such green circles were found in our control that had been washed in mannitol solution instead of L-form solution. These results are encouraging as they indicate we may have successfully inoculated plants with L-forms, although more evidence is needed. We also decided that when we next grow L-forms in plants, we should wash some seedlings in a solution of bacteria with cell walls to see if these can be taken up by plants.
 +
</div>
 +
 +
== 8 ==
 +
=== 12 ===
 +
==== Titles ====
 +
<div>
 +
*Transformation of HBsu-(x)FP into ''B. subtilis''
 +
*L-form Growth Curve
 +
*Planting Chinese Cabbage Seeds
 +
*L-Form simulation
 +
</div>
 +
==== Details ====
 +
<div>
 +
====Transformation of HBsu-(x)FP into ''B. subtilis''====
 +
 +
'''Aim:'''
 +
 +
To transform ''B. subtilis'' with HBsu-(x)FP.
 +
 +
'''Methods:'''
 +
 +
Prepared [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Bacillus_subtilis_168_Competent_cell_Prep_and_Transformation competent cells] by putting ''B. subtilis'' 168 in 10ml MM Media and left it to grow overnight. For the next part of the protocol please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#13/8/13" target="_blank">August 13th</a> </html>.
 +
 +
'''Results:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#13/8/13" target="_blank">August 13th</a> </html>.
 +
 +
====L-form Growth Curve====
 +
 +
'''Aim:'''
 +
 +
To establish a growth curve for L-forms.
 +
 +
'''Methods:'''
 +
 +
We started doing the L-form growth curve. Initially we took OD reading of the  L-form we grew over the weekend with a spectrophotometer.
 +
 +
'''Results:'''
 +
 +
The OD obtained was 0.246. We then diluted the solution down to get an OD of 0.05. That solution was then used to create the L-form growth curve. The initial readings of the two L-form samples were 0.05 and 0.046.
 +
 +
====Planting Chinese Cabbage Seeds====
 +
 +
'''Aim:'''
 +
 +
To plant seeds in order to wash them with L-forms and visualize them by confocal microscopy.
 +
 +
'''Methods:'''
 +
 +
We washed and planted chinese cabbage seeds in preparation for the introduction of L-forms into seedlings following the [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Production_of_L-form_containing_Plants Production of L-form containing Plants protocol] up to and including step four. The seeds were planted in Murishage and Skoog containing petri dishes and placed in a dark cuboard to germinate. The washing part of the protocol will be done on <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#13/8/13" target="_blank">August 13th</a> </html>.
 +
 +
 +
'''Results:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#14/8/13" target="_blank">August 14th</a> </html>.
 +
 +
==== L-Form simulation ====
 +
In last couple days we tried adding fusion, which was kind of hard to do, but in the end we succeeded doing that(although it still has couple of bugs, we will fix them asap).
 +
</div>
 +
 +
== 8 ==
 +
=== 13 ===
 +
==== Titles ====
 +
<div>
 +
*Transformation of HBsu-(x)FP into ''B. subtilis''
 +
*Cloning HBsu-GFP and HBsu-RFP into pSB1C3
 +
*Inoculating L-forms into Chinese Cabbage
 +
*L-form Growth Curve
 +
*Anything
 +
</div>
 +
==== Details ====
 +
<div>
 +
====Transformation of HBsu-(x)FP into ''B. subtilis''====
 +
 +
'''Aim:'''
 +
 +
To transform ''B. subtilis'' with HBsu-(x)FP.
 +
 +
'''Methods:'''
 +
 +
For the first part of the protocol please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#12/8/13" target="_blank">August 12th</a> </html>. We followed the [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Bacillus_subtilis_168_Competent_cell_Prep_and_Transformation B. subtilis transformation protocol].
 +
 +
Plates:
 +
 +
HBsu-GFP on LB + ery (5ug/ml) plates x2
 +
 +
HBsu-RFP on LB + ery (5ug/ml) plates x2
 +
 +
rrnB on LB + ery (5ug/ml) plates x2 (positive control)
 +
 +
Water on LB + ery (5ug/ml) plates x2 (negative control)
 +
 +
Water on LB + Cm (5ug/ml) plates x2 (negative control)
 +
 +
Cell in LB x2 (to check viability of cells)
 +
 +
[[File:Barecillus LB ery HBsu-GFP 1308.jpg|frameless|400px]]
 +
 +
Figure 1: HBsu-GFP on LB + ery (5ug/ml) plates
 +
 +
[[File:Barecillus LB ery HBsu-RFP 1308.jpg|frameless|400px]]
 +
 +
Figure 2: HBsu-RFP on LB + ery (5ug/ml) plates
 +
 +
[[File:Barecillus LB ery 168rrnB 1308.jpg|frameless|400px]]
 +
 +
Figure 3: rrnB on LB + ery (5ug/ml) plates x2 (positive control)
 +
 +
[[File:Barecillus LB ery 168H20 1308.jpg|frameless|400px]]
 +
 +
Figure 4: Water on LB + ery (5ug/ml) plates x2 (negative control)
 +
 +
'''Results:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#14/8/13" target="_blank">August 14th</a> </html>.
 +
 +
 +
 +
====Digest pMutin4 HBsu-GFP and HBsu-RFP====
 +
 +
'''Aim:'''
 +
 +
To digeste the pMutin4 HBsu-GFP and HBsu-RFP by fast digest from promega.
 +
 +
'''Methods:'''
 +
 +
The reaction we ran was:
 +
 +
45ul DNA
 +
 +
1ul  10x fast digest buffer
 +
 +
1ul  PstI
 +
 +
1ul  EcoRI
 +
 +
2ul  Water
 +
 +
Total: 50ul
 +
 +
We left this at 37  ̊C for 3 hours.
 +
 +
After we linearized the plasmid, we ran 8ul digest reaction on a gel to confirm the size of the fragments (Figure 5).
 +
 +
'''Results and Discussion:'''
 +
 +
[[File:Barecillus august22 cloning(pMutin4).jpg|frameless|800px]]
 +
 +
Figure 5: Gel to confirm size of HBsu-GFP and HBsu-RFP in pMutin4
 +
 +
Lane 1: 10kB DNA Ladder
 +
 +
Lane 2-3: Empty
 +
 +
Lane 4: HBsu-RFP
 +
 +
Lane 5-6: Empty
 +
 +
Lane 7: Hbsu-GFP
 +
 +
Lane 8:Empty
 +
 +
Lane 9: 10kB DNA Ladder
 +
 +
Lane 10: Empty
 +
 +
Lane 11: 10kB DNA Ladder
 +
 +
 +
After we have confirmed the size, we ran a 80ul digest and cut out the fragment of interest of HBsu-RFP and HBsu-GFP using the transilluminator and performed the [https://2013.igem.org/Team:Newcastle/Notebook/protocols#QIAquick_Gel_Extraction_Protocol gel extraction protocol].
 +
 +
[[File:Barecillus august11 transilluminator(80).jpg|frameless|800px]]
 +
 +
Figure 6
 +
 +
Lane 1: 10kB DNA Ladder
 +
 +
Lane 2-4: Empty
 +
 +
Lane 5: HBsu-RFP
 +
 +
Lane 6-7: Empty
 +
 +
Lane 8: 10kB DNA Ladder
 +
 +
Lane 9-11:Empty
 +
 +
Lane 12: Hbsu-GFP
 +
 +
After this was conducted we checked the nanodrop reading to find out the concentration of DNA which turned out to be for 20ng/ul HBsu-RFP and 17 ng/ul for HBsu-GFP). We then ligated them to the cut backbone that was done on the august 17th. Using the T4 ligase we ran a 1:1, 1:3, 1:5 and control for each sample. We then let it react in the thermocycler at 22  ̊C for an hour and stored at 4  ̊C overnight.
 +
 +
====Inoculating L-forms into Chinese Cabbage====
 +
 +
'''Aim and Methods:'''
 +
 +
We checked the seeds we planted on <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#12/8/13" target="_blank">August 12th</a> </html> and observed that the chinese cabbage seeds had begun to germinate. This meant that they were ready to absorb L-forms. We soaked 20 cabbage seeds for 3 hours in 5ml of L-form solution and another 20 seeds in 5%(w/v) mannitol solution to act as a control.  We also created another control by soaking 20 seeds in ''B. subtilis'' rod cells. The seeds were then washed with distilled water (to lyse extracellular L-forms) and replated on Murishage and Skoog agar plates. This was done following the [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Production_of_L-form_containing_Plants Production of L-form containing Plants protocol] from stage five onwards.
 +
 +
'''Results:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#14/8/13" target="_blank">August 14th</a> </html>.
 +
 +
 +
====L-form Growth Curve====
 +
 +
'''Aim and Methods:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#12/8/13" target="_blank">August 12th</a> </html>.
 +
 +
'''Results:'''
 +
 +
An OD of 0.08 and 0.09 was obtained.
 +
 +
</div>
 +
== 8 ==
 +
=== 14 ===
 +
==== Titles ====
 +
<div>
 +
*Transformation of HBsu-(x)FP into ''B. subtilis''
 +
*Competent Cells Preparation
 +
*L-form Growth Curve
 +
*Plant Confocal Microscopy
 +
</div>
 +
==== Details ====
 +
<div>
 +
====Transformation of HBsu-(x)FP into ''B. subtilis''====
 +
 +
'''Aim and Methods:'''
 +
 +
Please refer to  <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#12/8/13" target="_blank">August 12th</a> </html> and  <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#13/8/13" target="_blank">August 13th</a> </html>.
 +
 +
'''Results and Discussion:'''
 +
 +
The transformation conducted on August 13th worked. We took some colonies and plated it on a [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Making_Starch_Agar_Plates starch plate] we made earlier so the iodine test could be performed to confirm that HBsu-RFP and HBsu-GFP has integrated into the amyE region (Figure 1-3).
 +
 +
Plates:
 +
 +
HBsu-RFP
 +
 +
HBsu-GFP
 +
 +
168 BSB1 (negative control)
 +
 +
pGFP-rrnB (positive control)
 +
 +
[[File:Barecillus august14 frontview.jpg| 800px]]
 +
 +
Figure 1: Iodine Test (Front View of Plate 1)
 +
 +
[[File:Barecillus august14 backview.jpg| 800px]]
 +
 +
Figure 2: Iodine Test (Back View of Plate 1)
 +
 +
[[File:Barecillus august14 plate2.jpg| 800px]]
 +
 +
Figure 3: Iodine Test (Front View of Plate 2)
 +
 +
====Competent Cells Preparation====
 +
 +
'''Aim:'''
 +
 +
To make competent ''E.coli''
 +
 +
'''Methods:'''
 +
 +
We inoculated some XL1-B in 10ml of LB overnight to use in the next day to prepare competent ''E.coli'' cells. Method continued on <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#15/8/13" target="_blank">August 15th</a> </html>.
 +
 +
'''Results:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#15/8/13" target="_blank">August 15th</a> </html>.
 +
 +
====L-form Growth Curve====
 +
 +
'''Aim and Methods:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#12/8/13" target="_blank">August 12th</a> </html>.
 +
 +
'''Results:'''
 +
 +
An OD of 0.1 and 0.12 was obtained
 +
 +
====Plant Confocal microscopy====
 +
 +
'''Aim and Methods:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#12/8/13" target="_blank">August 12th</a> </html> and <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#13/8/13" target="_blank">August 13th</a> </html>.
 +
 +
'''Results:'''
 +
 +
Today we viewed our plants using confocal microscopy to try and detect any GFP-labelled bacteria. After viewing a few seeds washed in L-form solution under the microscope, we found a green fluorescing dot in the correct size range to be an L-form. No green dots were found in the rod cell or mannitol controls. Following these results we have decided to use confocal microscopy four days after washing our plants in L-form solution, rather than after one. As this co-insides with when [http://www.ncbi.nlm.nih.gov/pubmed/12859751 Tsomlexoglou et al.] used PCR to detect L-forms in their chinese cabbage.
 +
 +
[[File:BareCillusSeedptcl+GFP140813.jpg| 400px]]
 +
 +
Figure 1. Possible L-form inside Chinese cabbage. The bright green dot is the correct size to be an L-form. The green fluorescence image used to detect the L-form is superimposed onto a bright-field image of plant matter.
 +
 +
[[File:L-forms in sol1.jpg| 400px]]
 +
 +
Figure 2. L-forms from the solution used to wash the Chinese cabbage.
 +
 +
</div>
 +
 +
== 8 ==
 +
=== 15 ===
 +
==== Titles ====
 +
<div>
 +
*Iodine Test
 +
*Making Competent ''E.coli''
 +
*Preparation of IPTG reaction and ''B. subtilis'' Transformation
 +
*L-form Growth Curve
 +
</div>
 +
==== Details ====
 +
<div>
 +
====Iodine Test====
 +
 +
'''Aim:'''
 +
 +
To carry out the iodine test to show... Detail needed!!
 +
 +
'''Methods:'''
 +
 +
Detail needed!!
 +
 +
'''Results and Discussion:'''
 +
 +
''B. Subtilis'' 168 (Negative control): Halo
 +
 +
''B. Subtilis'' BSB1 (Negative control): Halo
 +
 +
pGFP rrnB (Positive control): No Halo
 +
 +
HBsu-RFP: No Halo
 +
 +
HBsu-GFP: No Halo
 +
 +
When a halo is found, this shows that amyE is functional as it digests the starch around it. When a halo is not found, this means the amyE is non-functional. In this case, it means that the gene fragment has integrated into the amyE region causing it to be non-functional.
 +
 +
====Making Competent ''E.coli''====
 +
 +
'''Aim:'''
 +
 +
To make competent ''E.coli'' for use on  <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#21/8/13" target="_blank">August 21th</a> </html>.
 +
 +
'''Methods:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#14/8/13" target="_blank">August 14th</a> </html> for the first part of the protocol. We followed the Competent ''E. coli'' protocol.
 +
 +
'''Results:'''
 +
 +
We yielded around 200 aliquots of E. coli competent cells.
 +
 +
====Preparation of IPTG reaction and ''B. subtilis'' Transformation====
 +
We inoculated 2ml NB with ''B. subtilis'' 168 that is tagged with HBsu-GFP and another 2ml of NB with ''B. subtilis'' that is tagged with HBsu-RFP. This is then incubated at 37  ̊C to use for IPTG reaction. We also prepared 10ml of MM media and inoculated it with some ''B. subtilis'' 168.
 +
 +
====L-form Growth Curve====
 +
 +
'''Aim and Methods:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#12/8/13" target="_blank">August 12th</a> </html>.
 +
 +
'''Results:'''
 +
 +
An OD of 0.06 and 0.07 was obtained.
 +
 +
</div>
 +
 +
== 8 ==
 +
=== 16 ===
 +
==== Titles ====
 +
<div>
 +
*Transformation of Switch Brick into ''B. subtilis''
 +
*L-form Growth Curve
 +
*L-Form simulation
 +
</div>
 +
==== Details ====
 +
<div>
 +
====Transformation of Switch Brick into ''B. subtilis''====
 +
 +
'''Aim:'''
 +
 +
To transform the switch biobrick into ''Bacillus subtilis'' 168 strain.
 +
 +
'''Methods:'''
 +
 +
We followed the [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Bacillus_subtilis_168_Competent_cell_Prep_and_Transformation B. subtilis transformation protocol] and plated it out on LB + Cm (5ug/ml) + Xyl (0.8%) plates that were made earlier today.
 +
 +
Plates:
 +
 +
Switch BioBrick on LB + Cm (5ug/ml)+ Xyl (0.8%) plates x1
 +
 +
rrnB on LB + Cm (5ug/ml)+ Xyl (0.8%) x1 (positive control)
 +
 +
''B. subtilis'' 168 + Water on LB + Cm (5ug/ml)+ Xyl (0.8%) plates x1 (negative control)
 +
 +
''B. subtilis'' 168 in LB x1 (to check viability of cells)
 +
 +
We left the plates to grow over the weekend.
 +
 +
'''Results:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#19/8/13" target="_blank">August 19th</a> </html>.
 +
 +
 +
====L-form Growth Curve====
 +
 +
'''Aim and Methods:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#12/8/13" target="_blank">August 12th</a> </html>.
 +
 +
'''Results:'''
 +
 +
An OD of 0.03 and 0.05 was obtained.
 +
 +
==== L-Form simulation ====
 +
After fixing bugs with L-Form fusion, simulation is starting to look very good. Next step would be to add L-Form division, which might get complicated, because we will need to have additional objects which would serve as another L-Form.
 +
 +
</div>
 +
 +
== 8 ==
 +
=== 19 ===
 +
==== Titles ====
 +
<div>
 +
*Transformation of Switch Brick into ''B. subtilis''
 +
*L-form Growth Curve
 +
*Lyon Presentation
 +
*Planting Chinese Cabbage Seeds
 +
</div>
 +
====Details====
 +
<div>
 +
====Transformation of Switch Brick into ''B. subtilis''====
 +
 +
'''Aim and Methods:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#16/8/13" target="_blank">August 16th</a> </html>.
 +
 +
'''Results:'''
 +
 +
We checked the transformation plate and it worked as expected.
 +
 +
Switch BioBrick on LB + Cm (5ug/ml)+ Xyl (0.8%) plates x1: Colonies Found
 +
 +
rrnB on LB + Cm (5ug/ml)+ Xyl (0.8%) x1 (positive control): Colonies Found
 +
 +
168 +Water on LB + + Cm (5ug/ml)+ Xyl (0.8%) plates x1 (negative control): No Colonies Found
 +
 +
Cell in LB x1 (to check viability of cells): Colonies Found
 +
 +
This was done to confirm the characterization of our BioBrick.
 +
 +
[[File:Barecillus Switch brick 1908.jpg|frameless|300px]]
 +
 +
====L-form Growth Curve====
 +
 +
'''Aim and Methods:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#12/8/13" target="_blank">August 12th</a> </html>.
 +
 +
'''Results:'''
 +
 +
An OD of 0.008 and 0.005 was obtained.
 +
 +
====Lyon Presentation====
 +
Started working on the presentation layout for Lyon using [http://www.http://prezi.com/ Prezi]. The team feels this will enable us to create a much more visually appealing presentation, giving us not only the best chance of captivating our audience and conveying our findings, but also winning at the Jamboree.
 +
 +
Initial design ideas have begun along the line of a microfluidics chip being used as a back-drop, with chambers used to contain relevant information (acting as &quot;slides&quot; as such). Along with the design ideas we have also started to compile a list of what information we want to have in the presentation, and how best to present this.
 +
 +
====Planting Chinese Cabbage Seeds====
 +
 +
'''Aim:'''
 +
 +
To plant seeds in order to wash them with L-forms and visualize them by confocal microscopy.
 +
 +
'''Methods:'''
 +
 +
We washed and planted chinese cabbage seeds in preparation for the introduction of L-forms into seedlings following the [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Production_of_L-form_containing_Plants Production of L-form containing Plants protocol] up to and including step four. The seeds were planted in Murishage and Skoog containing petri dishes and placed in a dark cupboard to germinate.
 +
 +
'''Results:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#23/8/13" target="_blank">August 23th</a> </html>.
 +
 +
</div>
 +
 +
== 8 ==
 +
=== 20 ===
 +
==== Titles ====
 +
<div>
 +
*Lyon Presentation
 +
*Inoculating L-forms into Chinese Cabbage
 +
*L-form Growth Curve
 +
*L-Form simulation
 +
</div>
 +
====Details====
 +
<div>
 +
====Lyon Presentation====
 +
The presentation team has started getting to grips with Prezi and trying to find out exactly what it is capable of. We have discovered that the easiest way of creating animations is to create .swf files using Adobe Flash which, luckily, one of our members has a decent amount of experience with. Unfortunately it has also come to light that Prezi does not handle interactive animations well, meaning that animations will work much better if they loop endlessly. Whilst it is possibly to build simply interactivity into the animation, it requires and ActionScript 3.0 &quot;hack&quot; that could result in some unpredictable behavior. In the interest of reliability and owing to not wanting any unexpected events whilst giving the presentation, the interactive elements have been dropped out of the design.
 +
 +
Due to this the microfluidics theme has come under question, as the complexity of it may outweigh the overall result. One team member has, as such, come up with a preliminary design along a different theme. This can be seen in the image below and also by clicking [http://prezi.com/4jcdd8as8qrm/?utm_campaign=share&utm_medium=copy this link].
 +
[[File:BareCillus_Pres1.jpg | 700px]]
 +
 +
====Inoculating L-forms into Chinese Cabbage====
 +
 +
'''Aim and Methods:'''
 +
 +
We checked the seeds we planted on <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#19/8/13" target="_blank">August 19th</a> </html> and observed that the chinese cabbage seeds had begun to germinate. This meant that they were ready to absorb L-forms. We soaked 20 cabbage seeds for 3 hours in 5ml of L-form solution. We created 5%(w/v) mannitol, ''B. subtilis'' rod and ''E.coli'' rod controls. The seeds were then washed with distilled water (to lyse extracellular L-forms) and replated on Murishage and Skoog agar plates. This was done following the [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Production_of_L-form_containing_Plants Production of L-form containing Plants protocol] from stage five onwards.
 +
 +
'''Results:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#23/8/13" target="_blank">August 23th</a> </html>.
 +
 +
====L-form Growth Curve====
 +
 +
'''Aim and Methods:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#12/8/13" target="_blank">August 12th</a> </html>.
 +
 +
'''Results:'''
 +
 +
An OD of 0.00 and 0.00 was obtained. For unknown circumstances, the L-form growth curve instead of increasing steadily throughout the week, it increased during the first 48hrs and then decreased throughout the rest of the week. We will reattempt to construct the L-form growth curve again at a later date.
 +
 +
==== L-Form simulation ====
 +
Last couple days were quite busy in terms of L-Form simulation, was trying different ways to make L-Forms divide. Found a quite neat solution which required me to create another list, with empty objects (when L-Forms fuse, 1 of the previous L-Forms become redunandt), but using this method number of L-forms in simulation won't exceed initial number of balls.
 +
</div>
 +
 +
== 8 ==
 +
=== 21 ===
 +
==== Titles ====
 +
<div>
 +
*Characterisation of Switch Brick
 +
*Cloning of HBsu-(x)fp pSB1C3 into ''E. coli'' XL1-B
 +
*Lyon Presentation
 +
</div>
 +
====Details====
 +
<div>
 +
====Characterization of switch brick====
 +
 +
'''Aim:'''
 +
 +
To characterize the switch brick.
 +
 +
'''Methods:'''
 +
 +
We took some colonies that grew on <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#19/8/13" target="_blank">August 19th</a> </html> and put it in NB/MSM + xyl. We altered the xylose concentration between the range of 0-0.8% by increments of 0.2%. We then left it to grow for 12 hours before checking them under the microscope.
 +
 +
'''Results:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#22/8/13" target="_blank">August 22nd</a> </html>.
 +
 +
====Cloning of HBsu-(x)fp pSB1C3 into E.coli XL1-B====
 +
 +
'''Aim:'''
 +
 +
To clone the ligation product that was obtained from  <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#13/8/13" target="_blank">August 13th</a> </html> into competent E.coli XL1-B that was prepared on the  <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#15/8/13" target="_blank">August 15th</a> </html>.
 +
 +
'''Methods:'''
 +
 +
Plates:
 +
 +
XL1B + 1:1 HBsu-GFP pSB1C3 on LB + Cm (5ug/ml)
 +
 +
XL1B + 1:3 HBsu-GFP pSB1C3 on LB + Cm (5ug/ml)
 +
 +
XL1B + 1:5 HBsu-GFP pSB1C3 on LB + Cm (5ug/ml)
 +
 +
XL1B + 1:1 HBsu-RFP pSB1C3 on LB + Cm (5ug/ml)
 +
 +
XL1B + 1:3 HBsu-RFP pSB1C3 on LB + Cm (5ug/ml)
 +
 +
XL1B + 1:5 HBsu-RFP pSB1C3 on LB + Cm (5ug/ml)
 +
 +
XL1B + No insert pSB1C3 on LB + Cm (5ug/ml)
 +
 +
'''Results:'''
 +
 +
Please refer to  <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#22/8/13" target="_blank">August 22nd</a> </html>.
 +
 +
====Lyon Presentation====
 +
The design idea created yesterday has been scrapped to further pursue the microfluidics theme less the abundance of animation &amp; interactivity. Designs are currently being worked on.
 +
</div>
 +
 +
== 8 ==
 +
=== 22 ===
 +
==== Titles ====
 +
<div>
 +
*Characterization of Switch Brick Results
 +
*Cloning of HBsu-(x)fp pSB1C3 into E.coli XL1-B Results
 +
</div>
 +
==== Details ====
 +
<div>
 +
====Characterization of Switch Brick Results====
 +
 +
'''Aim and Methods:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#21/8/13" target="_blank">August 21st</a> </html>.
 +
 +
'''Results:'''
 +
 +
The samples that had been growing for 12 hours were put under the microscope.
 +
 +
No xylose: All L-forms
 +
 +
0.2 xylose: Most L-forms but a few rod cells
 +
 +
0.4 xylose: Few L-forms more rod cells
 +
 +
0.8 xylose: All rod cells
 +
 +
From this result, we can tell that our switch brick works as expected. When xylose is not present, almost all cells are L-forms. When more xylose is present, more rod cells survive.
 +
 +
====Cloning of HBsu-(x)fp pSB1C3 into E.coli XL1-B Results====
 +
 +
'''Aim and Methods:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#21/8/13" target="_blank">August 21st</a> </html>.
 +
 +
 +
'''Results and Discussion:'''
 +
 +
There were colonies for all of the plates except for the negative control.
 +
 +
[[File:Barecillus LB HBsuGFP 1,1 2108.jpg|frameless|400px]]
 +
 +
Figure 1: XL1B + 1:1 HBsu-GFP pSB1C3 on LB + Cm (5ug/ml)
 +
 +
[[File:Barecillus LB HBsuGFP 1,3 2108.jpg|frameless|400px]]
 +
 +
Figure 2: XL1B + 1:3 HBsu-GFP pSB1C3 on LB + Cm (5ug/ml)
 +
 +
[[File:Barecillus LB HBsuGFP 1,5 2108.jpg|frameless|400px]]
 +
 +
Figure 3: XL1B + 1:5 HBsu-GFP pSB1C3 on LB + Cm (5ug/ml)
 +
 +
[[File:Barecillus LB HBsuRFP 1,1 2108.jpg|frameless|400px]]
 +
 +
Figure 4: XL1B + 1:1 HBsu-RFP pSB1C3 on LB + Cm (5ug/ml)
 +
 +
[[File:Barecillus LB HBsuRFP 1,3 2108.jpg|frameless|400px]]
 +
 +
Figure 5: XL1B + 1:3 HBsu-RFP pSB1C3 on LB + Cm (5ug/ml)
 +
 +
[[File:Barecillus LB HBsuRFP 1,5 2108.jpg|frameless|400px]]
 +
 +
Figure 6: XL1B + 1:5 HBsu-RFP pSB1C3 on LB + Cm (5ug/ml)
 +
 +
[[File:Barecillus LB control 2108.jpg|frameless|400px]]
 +
 +
Figure 7: XL1B + No insert pSB1C3 on LB + Cm (5ug/ml)
 +
 +
We then inoculate one colony from each sample in to LB and let it grow overnight in order to harvest the plasmid. With the amplified plasmid we could then check that it is the correct size and confirm that cloning has worked (Figure 8). The HBsu-GFP and HBsu-RFP insert was confirmed to be the correct size of 1379bp and 1339bp respectively. However the switch brick has not been cut properly. Therefore, the protocol will be repeated.
 +
 +
[[File:Barecillus august22 cloning HBsu(pSB1C3).jpg|frameless|800px]]
 +
 +
Figure 8: Gel to Confirm Size of HBsu-GFP and HBsu-RFP insert size
 +
 +
Lane 1: 1kB Ladder
 +
 +
Lane 2: HBsu-GFP PstI
 +
 +
Lane 3: Hbsu-GFP EcoRI
 +
 +
Lane 4: HBsu-GFP PstI and EcoRI
 +
 +
Lane 5: HBsu-GFP Uncut
 +
 +
Lane 6: 1kB Ladder
 +
 +
Lane 7: HBsu-RFP PstI
 +
 +
Lane 8: Hbsu-RFP EcoRI
 +
 +
Lane 9: HBsu-RFP PstI and EcoRI
 +
 +
Lane 10: HBsu-RFP Uncut
 +
 +
Lane 11: 1kB Ladder
 +
 +
Lane 12: Switch Brick PstI
 +
 +
Lane 13: Switch Brick EcoRI
 +
 +
Lane 14: Switch Brick PstI and EcoRI
 +
 +
Lane 15: Switch Brick Uncut
 +
</div>
 +
 +
== 8 ==
 +
=== 23 ===
 +
==== Titles ====
 +
<div>
 +
*<span style="color:red">Lyon Jamboree Attendance Fee Due</span>
 +
*Plant Confocal Microscopy
 +
</div>
 +
==== Details ====
 +
<div>
 +
====Safety Form====
 +
We worked on the safety form that was due in for <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#30/8/13" target="_blank">August 30th</a> </html>. To complete the safety forms, we referred back to some COSHH forms and BioCOSHH forms of the lab for help. We also had to look up some of the bacterial strains we were using. This was to confirm the risk group and possible threats it may pose to the members of the lab, environment, general public and security through misuse.  For more information on the safety form please refer to the following link.
 +
 +
====Plant Confocal Microscopy====
 +
 +
'''Aim and Methods:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#19/8/13" target="_blank">August 19th</a> </html> and <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#20/8/13" target="_blank">August 20th</a> </html>
 +
 +
'''Results:'''
 +
 +
We viewed 7 different Chinese cabbage seedlings washed with L-forms under the confocal microscope. In three of these plants we found clusters of green fluorescent dots about 0.5µm in diameter. We found no clusters of green fluorescent dots in three seedlings soaked in the mannitol control.
 +
 +
[[File:BareCilluspos.Lf.in.C.C.2230813.jpg| 400px]]
 +
 +
Figure 1. Cluster of L-forms inside a Chinese cabbage seedling.
 +
 +
[[File:BareCilluscontrolAF.plant cells.jpg| 400px]]
 +
 +
Figure 2. Image of mannitol-soaked control exhibiting faint green auto-fluorescence, allowing us to see the outline of plant cells.
 +
 +
</div>
 +
 +
== 8 ==
 +
=== 26 ===
 +
==== Titles ====
 +
<div>
 +
*Miniprep on XL1-B cells with clone product
 +
*Planting Chinese Cabbage Seeds
 +
 +
</div>
 +
==== Details ====
 +
<div>
 +
====Miniprep on XL1-B cells with clone product====
 +
 +
'''Aim:'''
 +
 +
We conducted a miniprep on XL1-B cells containing the clone product from <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#22/8/13" target="_blank">August 22nd</a> </html>.
 +
 +
'''Methods:'''
 +
 +
*link to mini-prep protocol*
 +
 +
'''Results:'''
 +
 +
The spectrophotometer readings were:
 +
 +
HBsu-GFP pSB1C3: 80.7ng/ul
 +
 +
HBsu-RFP pSB1C3: 95.6ng/ul
 +
 +
We then digest the plasmid using EcoRI and PstI fast digest on a 10ul reaction.
 +
 +
8ul of DNA
 +
 +
0.5ul of PstI Fast Digest
 +
 +
0.5ul of EcoRI Fast Digest
 +
 +
1ul of 10x Fast Digest Buffer
 +
 +
Total: 10ul
 +
 +
We let the reaction run at 37  ̊C for 2 hours and ran the digest on a 0.7% agarose gel. After the gel has finished running, we viewed the gel under the transilluminator to check the size of the fragments. The fragments were all of the correct sizes so the cloning was successful.
 +
 +
====Planting Chinese Cabbage Seeds====
 +
 +
'''Aim:'''
 +
 +
To plant seeds in order to wash them with L-forms and visualize them by confocal microscopy.
 +
 +
'''Methods:'''
 +
 +
We washed and planted chinese cabbage seeds in preparation for the introduction of L-forms into seedlings following the [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Production_of_L-form_containing_Plants Production of L-form containing Plants protocol] up to and including step four. The seeds were planted in Murishage and Skoog containing petri dishes and placed in a dark cuboard to germinate.
 +
 +
'''Results:'''
 +
 +
Please refer to ??
 +
 +
</div>
 +
 +
== 8 ==
 +
=== 27 ===
 +
==== Titles ====
 +
<div>
 +
*L-Form simulation
 +
*Characterisation of the HBsu-(x)fp
 +
*Transformation of ''B. subtilis'' that contained HBsu-(x)FP with Switch Brick
 +
</div>
 +
==== Details ====
 +
<div>
 +
==== L-Form simulation ====
 +
Simulation is nearly done, just giving finishing touches. One of them is improving movement of L-forms, so it's more realistic. Although it took a while to figure out the best movement algorithm, at first we tried doing it completely random, but it didn't work out quite well, so in the end we decided it to make not as random. So what we did is that let's say L-form moves 1px in x and y axis per second, so our algorithm would then generate random number from [-2;2] and then would add it up to the current speed. But, because of nature of randomness balls would move too fast or too slow, so we had to make "limits" so it doesn't get too fast or too slow.
 +
 +
====Characterisation of the HBsu-(x)fp====
 +
 +
'''Aim:'''
 +
 +
To characterize the HBsu-(x)FP BioBrick. From our cloning strategy, we planned to conduct a single cross over so the whole pMutin4 plasmid including the insert is integrated into the ''B. subtilis'' chromosomal DNA. After it has been integrated, our biobrick will be under the control of Pspac promoter. Pspac promoter is an IPTG inducible promoter.
 +
 +
'''Methods:'''
 +
 +
The ''B. subtilis'' 168 strain that has been transformed with HBsu-GFP and HBsu-RFP was inoculated on <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#15/8/13" target="_blank">August 15th</a> </html> to characterise the HBsu-(x)fp biobrick.
 +
 +
The concentration of IPTG was varied from a range of 0.05 – 0.8 mM to observe the conditions that yield the maximum concentration of product. We checked the fluorescence of this fusion protein at 10mins, 30mins, 60mins and 120mins after addition of IPTG to see how long it takes to get the maximum signal.
 +
 +
'''Results:'''
 +
 +
The results of this first trial were not very conclusive as there were cross contamination between samples with IPTG and the control.
 +
 +
====Transformation of ''B. subtilis'' that contained HBsu-(x)FP with Switch Brick====
 +
 +
'''Aim:'''
 +
 +
To transform ''B. subtilis'' that contained HBsu-(x)FP with Switch Brick as well.
 +
 +
'''Methods:'''
 +
 +
The the MM Media was inoculated with ''B. subtilis'' that was transformed with HBsu-GFP and HBsu-RFP and was left to grow overnight at 37  ̊C. This is to prepare for transformation with switch brick on <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#28/8/13" target="_blank">August 28th</a> </html>.
 +
 +
'''Results:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#29/8/13" target="_blank">August 29th</a> </html>
 +
</div>
 +
 +
 +
== 8 ==
 +
=== 28 ===
 +
==== Titles ====
 +
<div>
 +
*Transformation of ''B. subtilis'' that contained HBsu-(x)FP with Switch Brick
 +
*Safety Page
 +
</div>
 +
==== Details ====
 +
<div>
 +
==== Transforming Switch BioBrick into HBsu-(x)fp ''B. subtilis''====
 +
 +
'''Aim:'''
 +
 +
To transform ''B. subtilis'' that contained HBsu-(x)FP with Switch Brick as well.
 +
 +
'''Methods:'''
 +
 +
The protocol was continued from <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#27/8/13" target="_blank">August 27th</a> </html>
 +
 +
The switch biobrick was transformed into ''Bacillus subtilis'' 168 strain which already contained the HBsu-(x)fp. The [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Bacillus_subtilis_168_Competent_cell_Prep_and_Transformation B. subtilis transformation protocol] was followed and samples were plated out on LB + Ery (5ug/ml)+ Cm (5ug/ml) + Xyl (0.8%) plates that were made earlier today.
 +
 +
Plates:
 +
 +
168 HBsu-RFP + Switch BioBrick on LB + Ery (5ug/ml) + Cm (5ug/ml) + Xyl (0.8%) plates x1
 +
 +
168 HBsu-GFP + Switch BioBrick on LB + Ery (5ug/ml) + Cm (5ug/ml) + Xyl (0.8%)  plates x1
 +
 +
168 HBsu-RFP + water on LB + Ery (5ug/ml) + Cm (5ug/ml) + Xyl (0.8%)  plates x1
 +
 +
168 HBsu-GFP + water on LB + Ery (5ug/ml) + Cm (5ug/ml) + Xyl (0.8%) plates x1
 +
 +
168 HBsu-RFP + Switch BioBrick on LBx1
 +
 +
168 HBsu-GFP + Switch BioBrick on LB x1
 +
 +
The plates were left to grow for the next two days.
 +
 +
'''Results:'''
 +
 +
Please refer to <html>
 +
<a href="https://2013.igem.org/Team:Newcastle/Notebook/calendar#29/8/13" target="_blank">August 29th</a> </html>.
 +
 +
====Safety Page====
 +
Having completed the safety form on August 23rd, we started to work on the safety page of the wiki. On the safety page, we included everything in the safety form but in more detail. We also included a detailed account of the lan training program and safety precautions. For more detail, please visit the [https://2013.igem.org/Team:Newcastle/HP/Safety safety page]
 +
 +
</div>
 +
 +
== 8 ==
 +
=== 29 ===
 +
==== Titles ====
 +
<div>
 +
*Transformation of ''B. subtilis'' that contained HBsu-(x)FP with Switch Brick
 +
*Part submission
 +
 +
</div>
 +
==== Details ====
 +
<div>
 +
==== Transformation of ''B. subtilis'' that contained HBsu-(x)FP with Switch Brick====
 +
 +
We checked the transformation that we did previously and the results are the following:
 +
 +
Plates:
 +
168 HBsu-RFP + Switch BioBrick on LB + Ery (5ug/ml)+ Cm (5ug/ml) + Xyl (0.8%) plates x1: Colonies
 +
 +
168 HBsu-GFP + Switch BioBrick on LB + Ery (5ug/ml)+ Cm (5ug/ml) + Xyl (0.8%)  plates x1: No Colonies
 +
 +
168 HBsu-RFP + water on LB + Ery (5ug/ml)+ Cm (5ug/ml) + Xyl (0.8%)  plates x1: No Colonies
 +
 +
168 HBsu-GFP + water BioBrick on LB + Ery (5ug/ml)+ Cm (5ug/ml) + Xyl (0.8%) plates x1: No Colonies
 +
 +
168 HBsu-RFP + Switch BioBrick on LBx1: Colonies
 +
 +
168 HBsu-GFP + Switch BioBrick on LB x1: Colonies
 +
 +
To check that the transformation with the switch brick works we inoculate some of the cells on the plate into NB/MSM + xyl (0.8%) and NB/MSM only.
 +
 +
====Part submission====
 +
We worked on submitting three of our BioBrick to the iGEM registry. We put all the basic information about the part including the sequences.
 +
 +
Here are the parts:
 +
 +
[http://parts.igem.org/Part:BBa_K1185000 Switch BioBrick]
 +
 +
[http://parts.igem.org/Part:BBa_K1185001 HBsu-GFP]
 +
 +
[http://parts.igem.org/Part:BBa_K1185002 HBsu-RFP]
 +
 +
</div>
 +
 +
== 8 ==
 +
=== 30 ===
 +
==== Titles ====
 +
<div>
 +
*Confirming Transforming Switch BioBrick into HBsu-(x)fp ''B. subtilis'' Has Worked
 +
*L-form Protocol
 +
*Preparing 168 with HBsu-GFP and HBsu-RFP for IPTG check
 +
*L-form Conversion Time Lapse
 +
 +
</div>
 +
==== Details ====
 +
<div>
 +
 +
==== Confirming Transforming Switch BioBrick into HBsu-(x)fp ''B. subtilis'' has Worked====
 +
 +
'''Aim:'''
 +
 +
To confirm that the switch BioBrick has transformed into ''B. subtilis'' containing HBsu-(x)FP.
 +
 +
'''Methods:''
 +
 +
Cells from the NB/MSM xyl (0.8%) and NB/MSM only plates were inoculated into a solution and the solution was checked.
 +
 +
'''Results:'''
 +
 +
NB/MSM + xyl: Stay as rod cells
 +
 +
NB/MSM only: L-forms
 +
 +
This suggests that the switch biobrick works even when we transform it into ''B. subtilis'' 168 with HBsu-(x)fp biobrick in it.
 +
 +
====L-form Protocol====
 +
 +
'''Aim:'''
 +
 +
To produce more L-form culture.
 +
 +
'''Methods:'''
 +
 +
The [https://2013.igem.org/Team:Newcastle/Notebook/protocols#Protoplasting_to_generate_L-form L-form Protocol] was followed to obtain more L-forms.
 +
 +
'''Results:'''
 +
 +
The L-form protocol was successful and new L-forms were obtained.
 +
 +
====IPTG check for ''B. subtilis'' 168 containing HBsu-GFP and HBsu-RFP====
 +
 +
'''Aim:'''
 +
 +
To check that HBsu-GFP and HBsu-RFP was controlled by IPTG.
 +
 +
Detail needed!!
 +
 +
'''Methods:'''
 +
 +
''B. subtilis'' 168 with HBsu-GFP and HBsu-RFP was inoculated into LB+ery solution in preparation for IPTG check.
 +
 +
'''Results:'''
 +
Details needed!!
 +
 +
====L-form Conversion Time Lapse====
 +
Set up microscope to do time lapse photography to see the conversion of ''B. subtilis'' rod cell to L-forms.
 +
 +
</div>
 +
 +
== 9 ==
 +
=== 2 ===
 +
==== Titles ====
 +
<div>
 +
*Wiki Design Plan
 +
</div>
 +
==== Details ====
 +
<div>
 +
====Wiki Design Plan====
 +
We made rough sketches of adaptations to the front page of the wiki to make it more user friendly with less text and more symbols. This will make the wiki more visually appealing, directing readers to the overview page where the information will be found. There was also talk of redesigning the overview page to make it clearer where individual sub-project information could be found.
 +
</div>
 +
 +
== 9 ==
 +
=== 3 ===
 +
==== Titles ====
 +
<div>
 +
*Poster Text
 +
</div>
 +
==== Details ====
 +
<div>
 +
==== Poster Text====
 +
We changed and adapted the poster text from the YSB1.0 conference according to feedback given, to make the format more visual and a clear. This included adding pictures, labels, captions and results for the Lyon Jamboree.
 +
</div>
 +
 +
== 9 ==
 +
=== 4 ===
 +
==== Titles ====
 +
<div>
 +
*Skype Conference with Edinburgh Team and Dr. Jane Calvert
 +
</div>
 +
==== Details ====
 +
<div>
 +
====Skype Conference with Edinburgh Team and Jane Calvert====
 +
 +
We had a conference call via skype to the Edinburgh iGEM team and Dr. Jane Calvert who works in the Science Technology and Innovation Studies, School of Social and Political Science at the University of Edinburgh. The aim of this conference was to gain ideas about how to approach the ethical concerns related to our project and possibly highlight opinions that haven't yet been considered. The call was very successful and there were multiple points made that we could consider and expand on for the ethics section of our project.
 +
 +
[[File:JaneCalvert_Edinburgh2.jpg|frameless|400px]]
 +
 +
[[File:JaneCalvert_Edinburgh.jpg|frameless|400px]]
 +
 +
</div>
 +
== 9 ==
 +
=== 6 ===
 +
==== Titles ====
 +
<div>
 +
*Switch BioBrick pre-submission check
 +
*Creating L-form
 +
</div>
 +
====Details====
 +
<div>
 +
====Switch BioBrick Digest====
 +
We have characterize the Switch BioBrick and shown that it works as expected. Now we are preparing sample for submission, just to make sure that the Switch BioBrick size is correct and has been cloned into pSB1C3 we digested the Switch BioBrick.
 +
 +
We performed 4 digest reactions, first is an uncut plasmid, second and third is a single digest with EcoRI, PstI in this order, and last one is the Double Digest with both enzymes. After leaving the reaction to run at 37oC for 3 hours, we then load them into 0.7% Agarose gel.
 +
 +
The results of the gel revealed that the Switch BioBrick is indeed the correct size and been cloned into pSB1C3 backbone.
 +
 +
[[File:BareCillus_Switch_BioBrick_Digest.jpg]]
 +
 +
Figure 1: Switch BioBrick digest product on a 0.7% agarose.
 +
 +
Lane 1: Uncut plasmid
 +
 +
Lane 2: Switch BioBrick Single Digest with EcoRI
 +
 +
Lane 3: Switch BioBrick Single Digest with PstI
 +
 +
Lane 4: Double Digest with EcoRI and PstI
 +
 +
We then picked the Switch BioBrick transformed ''E.coli'' XL1B colonies from the plate and inoculate 4 bottles of 10ml LB with it. This is to amplify the plasmid, and so will be able to do Plasmid Extraction MiniPrep to extract large quantities of plamid and ready for submission.
 +
 +
====Making L-form====
 +
We picked ''B. subtilis'' str. 168 with HBsu-GFP + Switch BioBrick and HBsu-RFP  + Switch BioBrick transformed into them from the LB+Cm+Ery+0.8%Xylose plate and innoculate them into 12 bottles of 10ml LB. Let them grew for 3 hours before applying lysosyme onto them to get L-form. These L-forms were then incubated at 30oC over the weekend, before being used on Monday to prove that they are unstable outside osmotically balance environment.
 +
</div>
 +
 +
== 9 ==
 +
=== 18 ===
 +
==== Titles ====
 +
<div>
 +
*<span style="color:red">BioBrick DNA Due</span>
 +
</div>
 +
==== Details ====
 +
<div>
 +
 +
<span style="color:red">The DNA of our BioBricks needs to be submitted to the registry by this date.</span>
 +
 +
</div>
<!-- BELOW IS A TEMPLATE FOR NEW DATES/ACTIVITIES LEAVE ALL <div> & </div> in place
<!-- BELOW IS A TEMPLATE FOR NEW DATES/ACTIVITIES LEAVE ALL <div> & </div> in place
-
== NUMBER OF MONTH (AKA June = 6) ==
+
 
-
=== NUMBER OF DAY ===
+
== MONTH (numerical value) ==
 +
=== DAY (numerical value) ===
==== Titles ====
==== Titles ====
<div>
<div>
-
Put your titles IN LIST FORM here
+
*Write your titles
-
aka:
+
*Anything
-
*list item one
+
-
*list item two
+
</div>
</div>
==== Details ====
==== Details ====
Line 43: Line 2,896:
Put any details you want here. Paragraphs... Lists... Images... Go nuts :)
Put any details you want here. Paragraphs... Lists... Images... Go nuts :)
</div>
</div>
 +
 +
-->
-->
 +
 +
 +
 +
</div>
 +
{{Team:Newcastle/Sponsors}}

Latest revision as of 14:46, 30 September 2013

 
X
 
IGEM Home Newcastle University

June

Sun Mon Tue Wed Thu Fri Sat
 
 
 
 
 
 
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
 
 
 
 
 
 

July

Sun Mon Tue Wed Thu Fri Sat
 
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
 
 
 

August

Sun Mon Tue Wed Thu Fri Sat
 
 
 
 
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31

September

Sun Mon Tue Wed Thu Fri Sat
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
 
 
 
 
 


Contents

6

10

Titles

  • Training
  • Wiki

Details

Training

The teams split into small groups to discuss individual themes. They did some research into multiple aspects of the project including: wiki layout, t-shirt design and possible team logos. We also looked at past iGEM team wikis for inspirational ideas.

P1050457.JPG,P1050459.JPG

A talk on Computational Modelling and BioBrick concepts was given. This talk led the team to start building the biophysical model of the lipid membrane of Bacillus subtilis and modelling of lipid synthetic pathway. Later in the day, the team met to discuss initial aims and progress of our work so far.

P1050460.JPG

Wiki

Initial designs for the wiki have been created and uploaded. Currently all style sheets and javascript pages are stored externally until the design has been ratified by the team. Front-page image carousel has been created and initialised with blank colours to demonstrate what it shall look like until actual photographs have been taken and edited.

6

11

Modelling Training

  • Modelling Training
  • Wiki

Details

Modelling Training

We started off working on a Modelling Exercise to identify components and species of the subtilin biosynthesis pathway. We also sketched down some potential logo ideas and created a shortlist of favorites.

P1050461.JPG

We went on to learn about the differences and similarities between stochastic and deterministic modeling. We also used rule based modeling such as RuleBender and BioNetGen. Using the Michaelis-Menten kinetics model as an example, we alter the parameters and rates of reaction to observe the effects.

Wiki

The wiki design was agreed upon and further developed. A front-page image display has been created, developed and set up with dummy text and placeholder images. Discussions have been held over the layout for the calendar, the general consensus being that as few a clicks as possible should be needed to switch between and overall summary of what was done and the more detailed view. Designs are started with the idea being to create a large calendar holding daily headlines that spawn a non-obtrusive pop-up window containing more detail.

6

12

Modelling Training

  • Modelling Training
  • GUS cloning strategy

Details

Modelling Training

Today we continued learning about stochastic and deterministic modelling and looked at converting the rate parameters in RuleBender. We made the logo more detailed and narrowed it down to two ideas.

Logo2.jpgP1050467.JPG

GUS cloning strategy

We began work on the GUS cloning strategy which we plan to use to create Beta-glucuronidase producing L-forms to grow and visualise L-forms in plants. The β-glucuronidase produced by the L-forms will cleave the colourless substrate 5-bromo-4-chloro-3-indolyl-β-D-glucuronide (X-Gluc) to produce a blue product allowing the L-form distribution in plant tissue to be observed. This would involve inserting [http://parts.igem.org/Part:BBa_K330002 part:BBa_K330002] into our bacteria. We also started a rough design of the BioBrick, selecting a promoter, Ribosome binding site and antibiotic marker.


6

13

Basic Lab Skills

  • Basic Lab Skills

Details

Basic Lab Skills

Before we started work in the lab, we were briefed on various lab health and safety policies to ensure we maintained a safe working environment. We were then given a tour around the lab to inform us of the layout including waste disposal procedures, location of chemicals and use of equipment.

We were then taught how to calibrate pipettes and learned how to operate them. We are also shown how to inoculate bacteria to a liquid culture and how to prepare bacteria streak plates.

P1050469.JPG P1050472.JPG P1050475.JPG

Transformation of GFP and RFP bricks into E. coli Competent Cells

Aim:

The aim of this experiment is to transform GFP and RFP BioBricks into Escherichia coli.

Methods:

Please refer to the Escherichia coli competent cells protocol and the E.coli Transformation Protocol .

We then plated those cells onto LB with 5ug/ml chloramphenicol plates.

Results:

Please see June 14th for results


6

14

Basic Lab Skills 2

  • Transformation of GFP and RFP bricks into E. coli Competent Cells Results
  • Wiki

Details

Transformation of GFP and RFP bricks into E. coli Competent Cells Results

Aim:

Please see June 14th for aim.

Methods:

Please see June 14th for methods.

Results:

We checked the plates to see if anything grew. The RFP plates showed a lot of colonies, while the GFP plates did not work as expected. The next thing we did was to view the plates under the fluorescent inverted microscope. In the afternoon,we had an introductory lecture on basic molecular biology and biobrick design.

P1050483.JPG P1050490.JPG P1050488.JPG

Wiki

The calendar has now been created, with the emphasis on both user interaction (simple and obvious to use) as well as ease of editing (the members of the team not familiar with HTML and JQuery should easily be able and add to the calendar). A rough JQuery script has been written to convert standard wiki MediaWiki code into the format used by the Calendar. This will need extensive debugging before the Calendar can be put into use.

6

16

Titles

  • Wiki

Details =

Wiki

The Calendar was fully debugged and deployed over the weekend whilst no one was in the lab. This means that as of tomorrow the entire team will be able to edit and add to the calendar with ease. A brief document has also been written that will provide details on how to edit some of the more complex sections of the wiki. This document will be added to as more and more functionality is added into the wiki.

6

17

Basic Lab Skills 3

  • Basic Lab Skills
  • Day Overview
  • BioGame
  • HBsu BioBrick clonning strategy

Details

Basic Lab Skills

Aim: To familiarize with miniprep, nanodrop, restriction digest and gel electrophoresis.

Methods:

We transfer colonies of bacteria into LB and extracted the plasmids via the miniprep protocol, and checked the concentration of plasmids through the use of nanodrop spectrophotometry. We then prepared a 1% Agarose gel and performed a single digest with XbaI and PstI and a double digest with both restriction enzymes. We loaded our samples to the gel with the DNA ladder and control (Figure 1).

Results:

P1050504.JPG

Figure 1

Day Overview

The group started thinking about their cloning strategies for each theme of the project. We also discussed ideas for human practices and came up with the idea of making an educational game based on synthetic biology. At the end of the day we had a group meeting to discuss our progress and our ideas for the modelling workshop for the UCL meet up.

BioGame

Work began on the BioGame. Largely contained to simply choosing the best method of implementation for the game. The following options were considered:

  • Android SDK (with no game engine/plug ins)
  • LibGDX
  • OpenGL
  • LWJGL

Ultimately the choice was made to use LibGDX due to the documentation available on it, the ease at which games can be developed and the consistent structure it provides with standard gaming development. After this decision was made, a series of tutorials were found and followed to provide a base of knowledge going into developing the application itself.

HBsu- (x)fp BioBrick Cloning Strategy

The team has been looking in literature for a protein that binds non-specifically to DNA. This will aid the visualization of Genome Shuffling among L-forms by enabling the team to see sections of DNA that have come from two different Bacteria. The decision was made to use the HBsu protein which is encoded by the hbs gene in B.subtilis because it is well characterised and should remain associated with the DNA for a long period of time. The HBsu will be conjugated with a florescent protein such as GFP and RFP.

6

18

Basic Lab Skills 3

  • Wiki work
  • HBsu BioBrick Cloning Strategy

Details

Wiki work

We came up with a script, story board and a list of materials needed for the introductory video on our wiki. We had fun learning to crochet in order to create characters for the video. Furthermore, we updated the team profile page on the wiki by adding individual pictures of all team members.

P1050589.JPG

HBsu BioBrick Cloning Strategy

An initial design for the BioBrick has been created. It includes Kanamycin resistance cassette [http://parts.igem.org/Part:BBa_P1003 BBa_P1003], a lacI Promoter under a strong RBS [http://partsregistry.org/Part:BBa_B0034 BBa_B0034], the BioBrick and a double terminator. Golden Braid assembly is planned to be used to create the HBsu BioBrick.

6

19

Cloning strategies 1

  • Gus Reporter BioBrick
  • BioGame
  • HBsu BioBrick Cloning Strategy

Details

Gus Reporter BioBrick

We began working on the method for creating our construct. This would involve the use of restriction enzymes, primer design and gibson assembly. We also began creating a protocol for introducing our L-forms into plants.

BioGame

Today the game project was set up, created using the LibGDX-setup GUI in order to make projects for Android, Desktop and HTML deployment, all utilising LibGDX's built in features to run off a single "core" project. This was a big deciding factor in the choice to go with LIBGdx for developing the game as it allows us to quickly deploy across multiple platforms should we wish to do so. With the project set up, we have started to create assets such as textures and fonts to be loaded in and used within the game.

HBsu BioBrick Cloning Strategy

We plan to clone it into [http://parts.igem.org/wiki/index.php/Part:pSB1C3 pSB1C3] then PCR the insert before integrating it into the amyE integration plasmid (pSBBs1C). We discovered that the Kanamycin resistance is an E.coli version and wouldn't work in the B. subtilis. Different antibiotic markers that would work in B.subtilis are trying to be found.

6

20

Cloning strategies 2

  • GUS Cloning Strategy
  • BioGame
  • HBsu BioBrick Cloning Strategy

Details

GUS Cloning Strategy

We continued work on the cloning strategies as well as starting modelling the gus reporter system using BioNetGen. We produced a preliminary model of the gus reporter system. However, this model needs to be modified by adding parameters. We have also looked through some papers to find parameters required for the model.

Gus model.png

Figure 1: The framework of the GUS model. The red line indicates the blue product in the GUS reporter system. The blue line represents substrate 5-bromo-4-chloro-3indolyl glucuronide (X-Gluc). The green line represents the beta B-glucuronidase.

BioGame

The Asset class has been created and all currently designed assets loaded into the game. A very simple (and temporary) cartoon bacteria has been loaded in and displayed on the screen along with the team logo. The pre-loading screen itself has not yet been developed but all constructs to create it are now in place. The percentage of loading done is simply outputted to the Java console for debugging purposes..

HBsu BioBrick Cloning Strategy

Designed Primers to be used in the Golden Braid assembly, and checked the melting temperature and self-annealing to make sure they work perfectly. Uses RFP (BBa_E1010) and GFP (BBa_E0040) to conjugate it to the HBsu protein in order to observe the recombination.

6

21

Cloning strategies 3

  • GUS Cloning strategy
  • HBsu BioBrick Cloning Strategy

Details

GUS Reporter Gene Cloning Strategy

We further developed our cloning strategies and decided on the basic design of our construct. We made a preliminary design of the construct using Gene Designer to give a visual representation of how our construct should look like. From this image (Figure 1), we could see the positioning of all the parts, which will be more convenient for us when we want to devise a method to produce this.

We also improved the logo so it's ready for T-shirt printing. (picture from Alina)

HBsu BioBrick Cloning Strategy

A discussion with our supervisor revealed that the assembly system might be very time consuming. So it was decided that DNA 2.0 would be used to synthesis the HBsu BioBrick.

6

24

Progress

  • Groningen plasmid Mini-prep
  • BioGame
  • HBsu BioBrick Cloning Strategy

Details

Groningen plasmid Mini-prep

Aim:

To isolate the groningen plasmid.

Methods:

We performed a mini prep of the Groningen 2012 integration plasmid DNA grown in E.coli overnight at 37 ̊C. The purity was tested using NanoDrop.

We confirmed the insert size by first cut with fast digest XbaI and BamHI and then running the product on a gel to confirm the presence of the plasmid in the purified pDNA.

Results:

Groningen plasmid uncut,xba1,bamh1,both.jpg

Figure 1: Gel electrophoresis of Groningen plasmid.

Lane 1: DNA Ladder

Lane 2: Uncut plasmid

Lane 3: XbaI

Lane 4: BamHI

Lane 5: XbaI and BamHI

Discussion:

The gel shows that in lane 5 where the plasmid is cut with both XbaI and BamHI, two fragments are present. This is what we expected to have happened as the plasmid is cut at two places, isolating an insert of interest. The smaller fragment is the insert (RFP reporter gene) while the bigger fragment is the plasmid backbone.

BioGame

Further work on the game architecture has been done today. The main BioBrick class been created to provide common methods that all BioBricks will use. A very basic BioBrick has been created, and can be added upon touch to the Bacteria. This is simply to demonstrate what will happen when a BioBrick is added and the possibilities therein.

HBsu BioBrick Cloning Strategy

Due to the high cost of sequencing, the integration method of the HBsu BioBrick is now to clone the gene construct into the pMutin4 plasmid and use a single cross-over via the amyE gene to integrate it into the bacteria genome. Also the antibiotic marker and promoter is no longer being used because after SCO the whole plasmid will be integrated and as such will contain the promoter Pspac and Kanamycin cassette.

6

25

Modelling

  • Preparation for UCL
  • B.subtilis Transformation
  • Microfliuidics Introduction
  • HBsu BioBrick Cloning Strategy

Details

Preparation for UCL

We started preparing for our project presentation for UCL, and have started to prepare a presentation for our workshop about BioNetGen modelling.

B.subtilis Transformation

Aim:

To transform the bacteria with Groningen plasmid.

Methods:

A single colony of B.subtilis strain 168 was picked and transferred into MM media and left to grow at 37 ̊C overnight. We continued the protocol on June 26th .

Microfluidics Introduction

Our iGEM team attended a talk about microfluidics given by Sunny Park. Microfluidics is vital to some of our sub-projects (Genome Shuffling and Shape Shifting), therefore we looked into the mechanism of operation, possible uses and creation of design for master moulds on the silicon wafer.

HBsu BioBrick Cloning Strategy

The HBsu-GFP and HBsu-RFP BioBricks were sent off for synthesis. We then created an overnight liquid culture of LR2 rod B.subtilis cells in NB/MSM media, ready to be used to make L-form plates to obtain microscopic pictures.

6

26

Modelling

  • Preparation for UCL
  • B.subtilis Transformation

Details

Preparation for UCL

The team continued work on our modelling presentation for the UCL meetup. We added information about ordinary differential equation vs stochastic modelling and about Markov chain (Figure 1).

Geoff working.jpg

Markov.png

Figure 1: Markov Chain

B.subtilis Transformation

Aim:

To transform the bacteria with Groningen plasmid.

Methods:

Please refer to June 25th for the first part of the protocol.

We transferred 1ml of the prepared B.subtilis str. 168 into fresh MM media. We then tranformed the bacteria with the Groningen plasmid following the B.subtilis str. 168 transformation protocol. We also made some frozen competent B.subtilis str. 168 in glycerol.

Results:

Please refer to June 27th .


6

27

Modelling

  • Preparation for UCL
  • Transformation Prep

Details

Preparation for UCL

We began brainstorming what we should cover in our modelling workshop presentation for the YSB 1.0. We decided to first describe biological modelling and talk about stochastic vs differential models. Before introducing BioNetGen,talking about it's benefits and covering the basics of this language.

B.subtilis Transformation

Aim and Methods:

For Aim and Protocol, please refer to June 25th and June 26th .

Results:

No growth has been observed on the chloramphenicol plates apart from a single colony which might be just background growth.


6

28

Titles

  • Transform B.subtilis 168 with Groningen 2012 plasmid and RFP

Details

Groningen plasmid characterisation

Aim:

To characterise the [http://parts.igem.org/wiki/index.php?title=Part:BBa_K818000 Groningen 2012 integration plasmid].

Methods:

The transformation was done using the protocol for competent Bacillus subtilis.

Positive control: pGFPrrnB plasmid

Negative control: water

We then plated the transformants into LB + 5ug/ml Chloramphenicol plates.

Results and Discussion

Please refer July 1st .

7

1

Titles

  • Grow B.subtilis 168 for transformation
  • Sucrose test

Details

Results from Transformation

Aim and Methods:

Please refer June 28th .

Results:

We checked the transformation plates from the June 28th and found colonies have grown. We decided to conduct the sucrose test to check whether the cell contained actual Groningen plasmid. (see below)

Sucrose test

Aim:

To check whether the colonies on the Cm plate with B.subtilis 168 containing Groningen 2012 integration plasmid actually contained transformant cells rather than a random mutants/contaminant.

Methods:

Transfer the culture of into LB + 1% sucrose media and leaving it to grow over night. Protocol to be continued on July 2nd .

Results and Discussion:

Please refer July 2nd .

Transform B.subtilis 168 with Groningen 2012 plasmid and RFP

Aim:

In case if the transformation of Groningen plasmid into B. subtilis did not work, we decided to inoculated 5 ml of freshly prepared MM media with B.subtilis str.168 colonies to grow overnight in preparation to repeat the protocol.

Methods

A single colony of B.subtilis strain 168 was picked and transferred into MM media and left to grow at 37 ̊C overnight. We continued the protocol on July 2nd .

Results and Discussion:

Please refer July 3rd .


7

2

Titles

  • Transforming B.subtilis 168
  • Results of sucrose test

Details

Sucrose Test

Aim:

To check whether the colonies on the Cm plate with B.subtilis 168 containing Groningen 2012 integration plasmid actually contained transformant cells rather than a random mutants/contaminant.

Methods:

Following from the protocol indicated on July 1st , we checked the pH of the solution of cells from the Cm plate with Groningen 2012 integration plasmid incubated in sucrose rich media overnight to check for presence of acidic metabolites of sucrose and hence the activity of AmyE.

Results

The results were as hoped, as the pH of both the samples we prepared was the same as the pH of the +ve control (Bacillus 168 cells):4.7, 4.8, 5.04.

Transformation

Aim:

To transform B. subtilis with Groningen 2012 integration plasmid.

Methods:

We transformed B.subtilis 168 cells with Groningen 2012 integration plasmid and with pGMP (+ve control) and no plasmid at all (-ve control). Plated the colonies out according to the protocol and left to grow over night.

Results and Discussion:

Please see July 3rd for results and discussion.

7

3

Titles

  • Check the results of transformation
  • Set up the test for Amylase

Details

Groningen Plasmid Transformation Results

Aim and Methods:

Please refer to July 2nd

Results:

No colonies were found on the chloramphenicol plates B.subtilis 168 with Groningen 2012 plasmid, however there were a few colonies on the positive control, B.subtilis 168 with pGMP (Figure 1) integration plasmid plates and no colonies on B.subtilis 168 LB + chloramphenicol plates.

P1050607.JPG

Figure 1: B. subtilis 168 + pGMP on LB + Cm plate. Although a few colonies are found, it is not confirmed whether the pGMP insert is present.

Amylase Test

Aim:

To confirm that the pGMP plasmid was integrated in all of the colonies.

Methods:

Transfer a few colonies onto a freshly made LB + Starch agar plates. Check the amylase function using the iodine test for starch on July 4th .

Results and Discussion

Please refer to July 4th

7

4

Titles

  • Modelling Presentation
  • Checking starch plates

Details

Modelling Presentation

We made a few changes to our modelling presentation and practised our delivery in preparation for the presentation to members of the school of bioinformatics.

Amylase Test

Aim and Methods:

Please refer to July 3rd

Results:

The starch plates from yesterday were checked and it was found that they have overgrown.

P1050610.JPG

Figure 1: Overgrown starch plates.

Discussion:

The experiment will be repeated.

Repeating Amylase Test

Aim:

Please refer to July 3rd

Methods:

Starch agar plates were made including the antibiotic chloramphenicol (Cm) in the media. After these plates were made, colonies were transferred directly onto the plates and were left overnight.

Results:

Please refer to July 5th

7

5

Titles

  • Workshop Practice Presentation
  • Starch test

Details

Workshop Practice Presentation

We gave a workshop practice presentation to members of the school of bioinformatics. It was decided that we shouldn't talk about the subtilin two-components system model, because it might be too complex for our workshop. It was suggested that our workshop needed to be a little less like a presentation, with more interaction for the participants.

Starch test

Aim and Methods:

Please refer to July 3rd

Results: The starch plates were checked and a lawn of bacteria was found. The starch test was done anyway using vaporised iodine. The test showed a positive result for pGFP as it turned black (Figure 1: left plate) showing no amylase was present and there for it had transformed. The B.subtilis (positive control) did not go black because the starch was consumed by the bacteria as expected (Figure 1: white plate). Also E.coli was left with the Groningen plasmid in 10ml of LB over the weekend for purification. This was done because stocks of the Groningen plasmid were running low.

Barecillus IodineTest.jpg

Figure 1: Results from Iodine Test. Black plate contains pGFP, white plate contains B. subtilis and crystalized plate is just iodine crystals

Discussion

From the results, we can confirm that pGFP rrnB has an unfunctional amyE and hence it is unable to digest the starch, resulting in a black plate. The B. subtilis plate is white because there is a functional amyE and therefore the starch has been digested. From this experiment, we can tell that pGFP rrnB has been integrated into the correct region while there is no insert in that region in the B.subtilis plate.

7

8

Titles

  • Updated SGM tutorial
  • Finalized workshop presentation

Details

SGM tutorial

We added a modelling section to the SGM tutorial for potential funding. Deciding what information to include was a challenge due to the time constraint. We considered some of the exercises in the workshop for the tutorial.

UCL Presentation Practice

We practiced the UCL presentation to everyone on the team before everyone on the team gave feedback and constructive criticism which was recorded and addressed.

UCLpresentation.jpeg

Workshop presentation

The slides for the workshop were edited according to criticism from the feedback session on the 5th. We also began producing a handout with exercises to complete during the workshop.

7

9

Titles

  • Modelling Workshop
  • Groningen plasmid Mini-prep
  • B.subtilis Transformation

Details

Modelling Workshop Feedback Form

We produced a feedback form for attendees of our Workshop. This will be useful to access our workshops success and to improve its content for any future occasions we deliver a modelling workshop.

Groningen plasmid Mini-prep

Aim and Methods:

Please refer to June 24th

Results:

The Groningen plasmid was purified using plasmid Miniprep of previously prepared E.coli. The purity was checked using the NanoDrop and a result of 183.7 was obtained meaning the DNA was usable in subsequent protocols.

B.subtilis Transformation

Aim:

To transform the bacteria with Groningen plasmid.

Methods:

A single colony of B.subtilis strain 168 was picked and transferred into MM media and left to grow at 37 ̊C overnight. We continued the protocol on July 10th .


7

10

Titles

  • B.subtilis transformation
  • Receiving L-form Strain

Details

B.subtilis transformation

Aim:

To transform the bacteria with Groningen plasmid.

Methods:

Please refer to July 9th for the first part of the protocol.

The B.subtilis transformation was carried out again to see if it would successfully integrate the Groningen plasmid when a lower concentration of Cm antibiotic is used in the plates. The plates used include:

  • B.subtilis transformed with 10µl Groningen plasmid on 5µg/ml Cm, 12.5µg/ml Cm, Amp and LB
  • B.subtilis transformed with 20µl Groningen plasmid on 5µg/ml Cm and 12.5µg/ml Cm
  • B.subtilis transformed with 10µl pGFP (positive control) on 5µg/ml Cm, 12.5µg/ml Cm
  • B.subtilis with water (negative control) on 5µg/ml Cm, 12.5µg/ml Cm and Amp

Results:

Please refer to July 11th .

Receiving B.subtilis L-Form

Today we received two plates of B.subtilis L-Form on a LB + 0.8% Xylose plate, courtesy of Dr. Ling Juan Wu, which contains the original switch brick(BioBrick incompatable). One of the L-form has a GFP marker on its genome, and the other contain RFP. We also received the sequence of this strains genome.


7

11

Titles

  • B.subtilis transformation
  • Sucrose test
  • Chromosomal Extraction

Details

B.subtilis transformation

Aim and Methods:

Please refer to July 9th and July 10th .

Results: The following are pictures of the plates:

P1050613.JPG

Figure 1: B.subtilis transformed with 10µl Groningen plasmid on 5µg/ml Cm, 12.5µg/ml Cm, Amp and LB

P1050615.JPG

Figure 2: B.subtilis transformed with 10µl pGFP (positive control) on 5µg/ml Cm, 12.5µg/ml Cm

Sucrose test

Aim:

To check whether the colonies on the Cm plate with B.subtilis 168 containing Groningen 2012 integration plasmid actually contained transformant cells rather than a random mutants/contaminant.

Methods:

Both sucrose and glucose agar was made, left to cool, plated and left to set. Then the culture was transfered into LB + 1% sucrose media and leaving it to grow over night.

Results and Discussion:

Please refer July 16th .


Extracting Chromosome from the B. subtilis received

Using the protocol and kit supplied by Qiagen, we extracted the chromosome out of the B. subtilis that contain the Switch Brick in it. The spec reading showed that the DNA is actually present and to prevent the chromosome to be degraded it was stored in -20oC.

7

12

Titles

  • YSB 1.0 Conference
  • Modelling Workshop

Details

YSB 1.0 Conference

YSB meetup

The team travelled down to London for the Young Synthetic Biologists (YSB1.0) conference with the other UK iGEM teams. On arrival at the conference, the team put up their poster for display and proceeded to listen to other teams giving presentations about their projects. After lunch Yana, Geoff, Justas and James gave a modelling workshop on Rule Based Modelling with BioNetGen. During this time other team members attended various workshops about BioArt and public engagement. Discussions were ongoing throughout the day regarding teams posters and our own project.

More details can be found on the YSB1.0 page.

7

13

Titles

  • YSB 1.0 Conference
  • Presentation

Details

YSB 1.0 Conference

BareCillus UCL Presentation 1.jpg
BareCillus UCL Presentation 2.jpg

On arrival at the second day of the conference the team had the opportunity to view the posters and projects of other teams. A 10 minute presentation about our project was also given, followed by 5 minutes of questions. The presentation was very well received, resulting in many interesting questions and generating a lot of interest about the project. The entire conference split into groups after the presentations to discuss topics including modelling, wiki design, parts characterisation, human practices and SynBioSoc.

More details can be found on the YSB1.0 page.

7

15

Titles

  • Sequence Analysis
  • Primer design

Details

Switch Brick Sequence Analysis

We looked through the chromosomal sequence of the L-form B.subtilis we acquired from Dr. Ling Juan Wu, and located the region (ranging from the pbpb up to the murE gene) and sequence of the Switch Brick. Inside the strain that we received, the Pxyl and the Chloramphenicol resistance gene were already present in the region so it saved us a bit of work as we didn't have to clone it in. However, the sequence contains multiple illegal restriction sites for the BioBrick (EcoRI and PstI). To fix this issue, we decided to make a to synonymous change (no AA change) to the sequence where the restriction sites are located. The Switch Brick sequence is then sent off to DNA 2.0 for synthesis. Whilst waiting for the synthesised BioBrick to arrive, we will be using the current Switch BioBrick which contain EcoRI and PstI for our experiments.

Primer design for switch BioBrick

We designed primers to clone out and amplify the switch BioBrick from the strain that we received.

The primers were as follows:

BBa_K1185000_1_Forward Primer (20bp + XbaI tag + 'AAA')

5’ AAATTCTAGAGCAAAAGAAAGCAAAAGAGGA 3’

BBa_K1185000_1_Reverse Primer (19bp + SpeI tag + 'AAA')

5’ AAATACTAGTATTGTCCCTGTTATCCCAAT 3’

7

16

Titles

  • Making Plant Agar Plates
  • Sucrose test

Details

Making Agar Plates for our Plants

Aim:

Make some M&S Agar Plates for growing plants.

Methods:

Some Murashige and Skoog Medium (M&S Medium) was made. This medium was ordered in powder form and water had to be added to it to be made into a solution. The solutions were then autoclaved to be used to make the agar for growing plants.

After the solutions have been autoclaved, we made some agar with the M&S Medium. We weighed out 3.0g of agar no.2 into 2x500mL bottles. 250mL of M&S Medium was then added and mixed. The agar was then autoclaved and then cooled at 50 ̊C. When it is ready to be poured, we poured the agar onto 25 plates and left it to set.

BareCillus MandS.jpg


Sucrose test

Aim and Methods:

Please refer to July 11th .

Results and Discussion:

Inconclusive results were found as the agar was cloudy and individual colonies were not clear. For this reason a sucrose test was set up to see if the cells containing the Groningen plasmid from the plates had integrated the plasmid, consequently interrupting the sacA gene and so failing to metabolise sucrose and showing as more basic. For a positive control we used B.subtilis and sucrose (this was expected to be acidic) and our negative control was LB and sucrose (this was expected to be more basic as no metabolism). These cultures were left overnight. To see results please refer to July 17th .


7

17

Titles

  • Sucrose test
  • Transforming B.subtilis 168
  • Planting Seeds
  • Shape-shifting modelling

Details

Sucrose test

Aim and Method: Please refer to July 11th .

Results and Discussion: The sucrose test was carried out on the cultures using a PH meter. The results observed were as follows:

  • LB + sucrose + B.subtilis = 5.15
  • LB + B.subtilis = 6.77
  • LB + Groningen plasmid + sucrose = 4.23
  • LB + Groningen plasmid = 6.75
  • LB + sucrose = 7.07

These results show that cells with the Groningen plasmid had functional sucrase showing the plasmid has not been integrated so colonies must have been contaminants.

Transforming B.subtilis 168

Aim:

To transform B. subtilis with Groningen 2012 integration plasmid.

Methods:

Preparation for B.subtilis transformation was carried out; 5 ml of freshly prepared MM media was inoculated with B.subtilis 168 colonies to grow overnight. Also E.coli with Groningen plasmid was put in LB media and left to grow overnight. Protocol continued on July 18th .

Results and Discussion:

Please see July 19th for results and discussion.


Planting Chinese Cabbage Seeds

Aim:

Plant some Chinese Cabbage seeds to prepare for washing with L-forms.

Methods:

We washed and planted cabbage and french dwarf bean seeds in preparation for the introduction of L-forms into seedlings following the Production of L-form containing Plants protocol up to and including step four. The seeds were planted in Murishage and Skoog containing petri dishes and placed in a dark cupboard to germinate.

The washing of plant seeds with L-forms will be done on July 18th .

Bare Cillus seedz.jpg

Shape-Shifting modelling

Modelling tasks for the shape-shifting team were identified:

  1. Model cell shape using cytoskeleton structure
  2. Model cell growth
  3. Limit the growth of the cell by a certain shape (star or triangle)
  4. OPTIONAL Change the membrane rigidity parameters and run the simulation again.

The shape of the cell is influenced by membrane fluidity and structure of the cytoskeleton. As cytoskeleton is present in both eukaryotic and prokaryotic cells. The former cells have no cell wall, so it is reasonable to assume that the shape of the L-form cell would obey similar rules as eukaryotic cell would. It has been determined that cytoskeleton behaves as an isotropic fluid. Therefore it's realsonable to rely on two-phase flow modelling frame (Holmes, Edelstein-Keshet, 2012).

7

18

Titles

  • Innoculating Plants with L-forms
  • Groningen Plasmid Mini-prep
  • B.subtilis Transformation

Details

Innoculating Plants with L-forms

Aim and Methods:

The seeds that were planted on July 17th were checked and it was observed that the cabbage seeds had begun to germinate. This meant that they were ready to absorb L-forms. We soaked 5 cabbage seeds for 3 hours in 5ml of L-form solution and another 5 seeds in 5%(w/v) mannitol solution to act as a control. The seeds were then washed with distilled water (to lyse extracellular L-forms) and replated on Murishage and Skoog agar plates. This was done following the Production of L-form containing Plants protocol from stage five onwards.

BareCillusL-forms n seeds.jpg

Groningen Plasmid Mini-prep

Aim:

To isolate the groningen plasmid.

Methods:

We performed a mini prep of the Groningen 2012 integration plasmid DNA grown in E.coli overnight at 37 ̊C. The purity was tested using NanoDrop. We confirmed the insert size by first cut with fast digest XbaI and BamHI and then running the product on a gel to confirm the presence of the plasmid in the purified pDNA.

Results

This was done in 8 micro centrifuge tubes. The purity of each was tested using a NanoDrop.The average purity of the 8 tubes was 324ng/µl.

B.subtilis Transformation

Aim:

To transform B. subtilis with Groningen 2012 integration plasmid.

Methods:

Please refer to July 17th for the first part of the protocol. The B.subtilis transformation was carried out again to see if it would successfully integrate the Groningen plasmid when a higher concentration of the plasmid was used. The plates used include:

  • pGFP (positive control)on 5µg/ml Cm and 12.5µg/ml Cm
  • Groningen plasmid 30 µl on 5µg/ml Cm and 12.5µg/ml Cm
  • Groningen plasmid 45 µl on 5µg/ml Cm and 12.5µg/ml Cm
  • Groningen plasmid 60 µl on 5µg/ml Cm and 12.5µg/ml Cm
  • Water (negative control) on 5µg/ml Cm and 12.5µg/ml Cm

Results and Discussion:

Please see July 19th for results and discussion.


7

19

Titles

  • B.subtilis Transformation
  • Modelling

Details

B.subtilis Transformation

Aim and Methods: Please refer to July 17th .

Results and Discussion:

The results of the last transformation of B.subtilis with Groningen 2012 integration plasmid look promising. Everything has worked as expected. The insignificant difference in the number of colonies grown on plate with cells inoculated with different amount of plasmid indicates that the transformation occurred as efficiently as it could at around 9ug of DNA per reaction tube. The reason why nothing grew on the plates with 12.5ug/ml of chloramphenicol may be the inefficiency of the promoter used. The colony counts are recorded in a table below.

Agar/Transformants pGFP (positive control) Groningen plasmid 30 µl Groningen plasmid 45 µl Groningen plasmid 60 µl Water
Nutrient Agar + 5µg/ml Cm 134 Colonies 9 Colonies 12 Colonies 7 Colonies 0 Colonies
LB Agar = 12.5µg/ml Cm 142 Colonies 1 Colonies 2 Colonies 3 Colonies 0 Colonies

Untitled-3.jpg

To confirm the integration of the plasmid the test for sucrose metabolism will be carried out on Monday.

Modelling

Preparation work for modelling, learning to use VCell software. We started working our way through simple tutorials to get more familiar with the program before doing "real work".

Cell Shape model 
The structure and function of cytoskeleton were studied. The cell behaves like an isotropic fluid in terms of shape and movement, therefore some of the factors which influence the shape could be identified: Cell Volume, surface area, surface tension, hydrostatic pressure.
It turns out that eukaryotic cytoskeleton is characterised as a two-phase viscous, responsive and contractile liquid. If bacterial cytoskeleton is similar, it would complicate the modelling by a fair bit. More insight into the structure and physical properties of bacterial cytoskeleton is needed. In terms of cell growth and division it will be useful to look into the properties of FtsZ and MreB as well as properties of the vesicular membrane and physical triggers of the process of 'blebbing'. So that's a job for Monday.

7

22

Titles

  • Made SMM media
  • Made sucrose and glucose agar
  • Creating L-forms
  • BioGame

Details

Made SMM media

More SMM media was made, in order to make the sucrose and glucose plates which will be used to test if the Groningen plasmid has been integrated.

First trial on creating B.subtilis L-form

Aim:

To create L-forms.

Methods:

We used the plate of B.subtilis rod cells (containg the switch BioBrick) that Dr. Ling Juan Wu provided us on the 15th July. This was carried out using both; Direct Method and Protoplasting to generate L-form.

Results:

Both protocols were successful in creating L-forms.

IMG-20130727-WA0000.jpg

Made sucrose and glucose agar

Both sucrose and glucose agar was made, and sent for auto claving

P1050679.JPG


BioGame

Work restarted on the BioGame. The Sprite class has been extended to cope with both static and animated Sprites utilising Sprite Sheets. An animated background has been created for the game and further work is planned on the user interface in the coming days.

7

23

Titles

  • Tested the Lysozyme Protoplast Formation Protocol
  • Sucrose and Glucose test
  • Improving the poster design

Details

Tested the Lysozyme Protoplast Formation Protocol

The rest of the team members tested the protocol and further suggestions for improvement were made. Despite the suggestion, all teams were successful in creating L-forms. (microscope picture)

L-form (growth curve).jpg

Sucrose and Glucose test

Aim:

To check whether the colonies on the Cm plate with B.subtilis 168 containing Groningen 2012 integration plasmid actually contained transformed cells rather than a random mutants/contaminant.

Methods:

The agar was melted on heat plates for half an hour, left to cool, plated and left to set in the fume cupboard. Then the colonies from the transformation plates were plated out onto the agar. Both B.subtilis with the Groningen plasmid at concentrations of 30, 45 and 60 µl and B.subtilis alone (negative control) were put onto both sucrose and glucose plates.

Results:

Please refer to July 23th .

Improving the poster design

Progress on the poster design was made by thinking of different alterations to the layout to make the poster more readable. The favorite was selected as a starting point for the final design.

7

24

Titles

  • Sucrose and Glucose plates
  • Poster design
  • Wiki
  • BioGame

Details

Sucrose and Glucose plates

Aim and Methods:

Please refer to July 23th .

Results:

Both the Sucrose and Glucose plates overgrew which means that the Groningen plasmid is not integrated. our next step is to consider whether to sequence the plasmid using the BioBrick primers.

24th.jpg

Poster Design

Today, the layout was developed further and shown to the group. The next steps would be to introduce the text, logos and illustrations.

New poster layout.jpg

BioGame

A loading bar has now been added for the BioGame, providing the user graphical representation of how long they will be waiting for the game to load. This then opens into the main game screen where your Bacterium can be seen. The next stage is to add the User Interface allowing the user to "take care" of their Bacterium and install BioBricks.

7

25

Titles

  • PCR Switch BioBrick
  • Planting Seeds

Details

PCR Switch BioBrick

The Primers ordered to clone the Switch BioBrick arrived. Using the chromosome extracted from the B. subtilis which contain the Switch BioBrick we perform PCR to amplify the BioBrick. The spectophotometer reading for the PCR product showed good results (Figure 1) , however when running it on agarose gel to check for the size it didn't show (expected product around 2,666bp)(Figure 2).

Swirtch Brick.jpg

Figure 1: DNA concentration reading by conducting Nanodrop spectrophotometry

IspA current version all can't see 2.jpg

Figure 2:Gel to check the size of the BioBrick (To label)

Planting Seeds

Aim:

To plant seeds in order to wash them with L-forms and visualized by confocal microscopy.

Methods:

We washed and planted chinese cabbage seeds in preparation for the introduction of L-forms into seedlings following the Production of L-form containing Plants protocol up to and including step four. The seeds were planted in Murishage and Skoog containing petri dishes and placed in a dark cupboard to germinate.

Results: Due to contamination did not get results. Please refer to July 26th for more detail


7

26

Titles

  • Cloning Switch Brick via PCR
  • Travel Arrangements
  • L-form culture contaminate
  • Treating Plants with L-forms

Details

PCR Switch Brick

'Aim:

To confirm the size of the switch brick.

Methods:

We performed another round of PCR to amplify the Switch BioBrick from the extracted chromosome. The spec reading show good results (Figure 1), and we run an agarose gel to confirm its present. From the gel we can see a ban around 2,000-3,000bp region (Figure 2), and our BioBrick is around 2,600bp this conclude that we have successfully amplified our BioBrick.

Switch brick-PCR 2.jpg

Figure 1: Switch brick spectrophotometer reading with Nanodrop

IspA its there.jpg

Figure 2: Gel electrophoresis to confirm size of switch brick size(To label)

Travel Arrangements

Research was done into the most convenient way to travel to the regional jamboree in Lyon in October. A spread sheet was made of the different travel options so a balance could be found between cost and time efficiency. This included timings, prices and duration of trains, flights and buses.

Contamination by Staphylococcus aureus

We checked our stocks L-form culture under the inverted microscopes and found out that all of the culture have been contaminated by S. aureus.

Treating Plants with L-forms

The above mentioned S. aureus contamination means we do not have any L-forms to wash our seedlings in and so cannot continue with the Production of L-form containing Plants protocol. We will have to grow new seedlings once we have some L-forms free from contamination.

7

29

Titles

  • Creating L-form
  • Transformation of B. subtilis with the switch biobrick
  • MM media innoculation
  • Cell wall synthesis modelling

Details

Creating L-form culture

Aim:

To make an L-form culture.

Methods:

Using the Protoplasting protocol, we converted both of the L-form strains we possess (GFP and RFP marker) into L-form. We left them to grow for 2 days in 30 ̊C incubator.

Transformation of B. subtilis with the switch biobrick

Aim:

To transform B.subtilis str.168 with the switch brick.

Methods:

Inoculate 10ml of MM medium with B.subtilis str.168 and left to grow overnight in 37 ̊C for preparation of Transformation.

The protocol to be continued on July 30th

Results:

July 31st

Cell wall synthesis modelling

Found a model of Peptidoglycan biosynthesis in B.subtilis on the BioModels Database. Generated automatically from the Kegg pathway, so the model is quite complicated and unclear. We plan on converting the SBML to bngl (i.e. useable in BioNetGen and adding the ability to switch the cell wall on and off- simulating our main BioBrick


7

30

Titles

  • Cell Shape Model
  • Transformation of B. subtilis with the switch biobrick

Details

Cell Shape Model

Substantial progress was made towards the understanding of fundamental approaches to mathematical modelling. Dr. David Swailes from the Department of Mechanical Engineering has kindly agreed to help us with our task. It was thought sensible to divide the project into three parts. First model the growth of the vesicle which is not limited by anything, then model the process of growth in a confined environment from the time just after the vesicle grows to touch the sides of the chamber, followed by a model of the transition between the two phases. Tasks for Wednesday: research more on the physiology of the vesicle growth.

Transformation of B. subtilis with the switch biobrick

Aim:

To transform B.subtilis str.168 with the switch brick.

Methods:

Please refer to July 29th for the start of the protocol. Using the overnight B.subtilis strain.168 grown in MM media we carried out the transformation protocol and transformed them with our naked PCR switch brick product and pGFPrrnb (as a control). We then plated the B.subtilis transformed with pGFPrrnb onto LB agar + Chloramphenicol (5ug/ml) plates, and plated out the B.subtilis with the switch brick onto LB agar + Chloramphenicol (5ug/ml) + Xyl 0.8% plates.


Results: Please refer to July 31th .


7

31

Titles

  • Transformation of B. subtilis with the switch biobrick
  • Visualising L-forms under Microfluidics
  • Translating the cell wall model

Details

Transformation of B. subtilis with the switch biobrick

Aims and Methods:

Please refer to July 29th and July 30th

Results and Discussion:

As it turns out the naked PCR product Switch BioBrick failed to be transformed, whilst the positive control worked. We found out that the efficiency and probability of transformation to works with just naked PCR product is very low. So, we then planned to clone it into a plasmid first before transforming it into our Bacillus subtilis.

'1000x900' '1000x900'

Visualising L-forms under Microfluidics

We created a silicon wafer of the mother machine using the master mold courtesy of Sunny Park. Once the wafer set we removed any impurities using a combination of dd.H2O, acetone, and isopropanol. In order to let the silicon wafer hold together we heated with plasma under vacuum condition. We then load L-forms with two different tags on them (GFP and mCherry expression). The results showed potential endosymbiosis or cell fusion between the L-forms.

Cell wall modelling

Opened the peptidoglycan biosynthesis model in copasi, to try and understand what was happening. The species names were particularly complicated so we attempted to simplify them, whilst making clear what was being referred to. There are 54 species so this took some time.

8

1

Titles

  • Plasmid (pGFPrrnb) amplification
  • L-Form simulation

Details

Plasmid (pGFPrrnb) Amplification

Aims:

Amplify the pGFPrrnB.

Methods:

We transformed the competent E.coli strain DH5alpha with plasmid pGFPrrnB taken from the spring 2013 BioBrick distribution kit using the [E.coli transformation protocol]. We then innoculated B. subtilis, from the yesterdays transformation plate, which contained pGFPrrnb into LB + Chloramphenicol (5ug/ml).

L-Form simulation

Started working on Java based application to simulate L-form behavior. Current goal is to make something simple, maybe moving circles?

8

2

Titles

  • L-Form simulation
  • E.coli Innoculation
  • Cloning switch brick

Details

L-Form simulation

Started programming L-form genomic fusion simulation using Java. So far everything went smoothly, we have some bacteria basic movement mechanics, and soon will be looking into how to make two bacteria fuse when they meet together.

E.coli Innoculation

We innoculated the transformed E.coli (pGFPrrnb) that we did yesterday into LB.

Cloning switch brick

Aim:

Cloning the switch brick into pSB1C3.

Methods:

We extracted our pSB1C3 plasmid from the BioBrick distribution kit. Through the use of restriction enzymes (XbaI and SpeI) we cut out the RFP insert from the MCS of the plasmid. We ran the digested product on a 0.8% agarose gel and purified the DNA (plasmid backbone) through the use of [gel extraction purification].

BarecillusgelelectrophoresisImage.jpeg


We checked the concentration of the purified DNA through nanodrop (spectrophotometer).

Results and Discussion:

It turned out that no DNA was present in the solution. This was due to too much elution buffer that was added to elute the DNA. This resulted in a very low concentration, and we will not be able to continue the [ligation protocol]. This protocol will need to be repeated the next day. Please refer to August 5th

BarecillusFail gel extraction pSB1C3.jpg

8

5

Titles

  • Cloning Switch Brick
  • Transforming HBsu-(x)fp BioBrick
  • BioGame

Details

Cloning Switch Brick

Aim:

Cloning the switch brick into pSB1C3

Methods:

We started off by extracting the [http://parts.igem.org/wiki/index.php/Part:pSB1C3 pSB1C3] plasmid with RFP marker through Miniprep from the E.coli liquid broth. We performed a double digest using XbaI and SpeI to isolate the insert from the plasmid backbone. We then ran the digested sample through gel electrophoresis to separate out the different parts. Through the use of gel extraction kit and protocol, we cut out the band of interest which was around 2000bp (the backbone). We then ligate the backbone with predigested switch brick through the use of T4 ligase via sticky end ligation in a 1:3 ratio. We left the ligated product in the 4 ̊C fridge.

BareCillus Psb1c3 restrictyion purification.jpg

Figure 1: Performed gel electrophoresis to confirm the size of the clone product.

Transforming HBsu-(x)fp BioBrick

The synthesised construct arrived fully cloned into the pMutin4 plasmid from DNA2.0 and we rehydrated the DNA by adding 10ul of elution buffer. We transformed the plasmid into competent E.coli DH5-alpha and plated it out on LB + Amp plate.

BioGame

Work recommenced on the BioGame with the beginning of the User Interface creation for the main game screen. This began by simply designing some basic sprite sheets for the button states, and then moved on to creating the button class. The button class started off by extending my own Sprite class, choosing to not use LibGDX's built in sprite or button class. I feel this would give me more control over the functionality of the objects, also as some of the documentation on the built in button class is a little light, it means I know exactly what it is doing.


8

6

Titles

  • Amplifying Switch Brick
  • HBsu-(x)FP BioBrick Extraction
  • BioGame
  • L-Form simulation

Details

Amplifying Switch Brick

Aim:

To amplify the switch brick.

'Methods:

We transformed the pre-prepared competent E. coli DH5α cells with the Switch Brick that we have cloned in to the psB1C3 plasmid yesterday. These were then plated on to LB+chloramphenicol 5μm/ml and incubated at 37 ̊C;

Results:

Detail needed!!

HBsu-(x)FP BioBrick Extraction

Aim:

To extract the HBsu-RFP & HBsuGF BioBricks from the E.coli.


Methods:

We took E. coli DH5α that has been transformed with HBsu-GFP/HBsu-RFP BioBrick from the plate that was made yesterday and inoculated them onto LB to let them grow before extracting the plasmid out.

Protocol to be continued on August 7th

Results:

Please refer to August 7th

BioGame

Further work has gone into developing the buttons, having now written the code for hit testing the clicks on the button. This code is a little buggy but will be improved as the program is progressed. Started to create the sub-menu that will appear when the "Install BioBrick" button is clicked. Currently this is just a blue box that will eventually contain a list of installable BioBricks.

L-Form simulation

It's starting to look good, as a base for our L-Form simulation Ball game [http://www.ntu.edu.sg/home/ehchua/programming/java/J8a_GameIntro-BouncingBalls.html tutorial] was used. We managed to get couple balls moving around and colliding with each other.


8

7

Titles

  • HBsu-(x)FP BioBrick Extraction
  • Cloning HBsu-(x)FP BioBrick into pSB1C3 Plasmid
  • B. subtilis str.168 Competent Cell Prep
  • Inoculating Chinese Cabbage with L-forms
  • BioGame

Details

HBsu-(x)FP BioBrick Extraction

Aims:

Please refer to August 6th

Methods:

Continued protocol from August 6th

Using the QIAgen Mini-Prep protocol we extracted the HBsu-RFP & HBsu-GFP BioBricks from the E. coli. We checked the concentration & quality of the plasmid using a spectophotometer.

Results:

The DNA concentration reading was the following

HBsu-GFP: 67.5 ng/μl HBsu-RFP: 55.5 ng/μl

This is of good quality and will be used for cloning in the pSB1C3 plasmid on the same day.

Coloning HBsu-(x)FP BioBrick into psB1C3 Plasmid

Aim:

Clone the HBsu(x)FP BioBrick into pSB1C3 so it can be submitted to the repository.

Methods:

The HBsu-(x)FP BioBrick and the linearised pSB1C3 plasmid was cut using EcoRI and PstI. We then attempted to purify the BioBrick using the gel extraction protocol

Results:

No bands were found after we have conducted the protocol. The protocol will be repeated on the next day.

B. subtilis str.168 Competent Cell Prep

Detail needed!!

Inoculating Chinese Cabbage with L-forms

Aims:

To plant Chinese Cabbage seeds on petri dishes so it can germinate and can be inoculated with L-forms.

Methods:

We washed and planted chinese cabbage seeds in preparation for the introduction of L-forms into seedlings following the Production of L-form containing Plants protocol up to and including step four. The seeds were planted in Murishage and Skoog containing petri dishes and placed in a dark cupboard to germinate.

The protocol was continued on August 8th

Results:

Please refer to August 9th

BioGame

Upon adding buttons into the Install BioBrick sub-menu, it was noted that any button placed over the top of the clicked button on the parent menu is started off in the "over" position and as such is automatically registering a hit. To solve this the hit test code as been completely refactored for a more accurate hit test. To aid this, ActionListeners have been added into the Button class so as to handle the desire events upon click. This will enable coders to write anonymous classes for attaching to individual buttons.

8

8

Titles

  • Inoculating Plants with L-forms
  • B. subtilis Transformation of HBsu-(x)FP
  • Digest pMutin4 HBsu-GFP and HBsu-RFP

Details

B. subtilis Transformation of HBsu-(x)FP

Aim:

To transform B.subtilis with the HBsu-(x)FP biobrick into pMutin 4.

Methods:

We followed the bacillus transformation protocol. We then plated it out on LB + ery (5ug/ml) plates that were made earlier today.

Plates:

HBsu-GFP on LB + ery (5ug/ml) plates x2

HBsu-RFP on LB + ery (5ug/ml) plates x2

rrnB on LB + ery (5ug/ml) plates x2 (positive control)

Water on LB + ery (5ug/ml) plates x2 (negative control)

Cell in LB x2 (to check viability of cells)

Results:

Please refer to August 9th .

Digest pMutin4 HBsu-GFP and HBsu-RFP

Aim:

To digeste the pMutin4 HBsu-GFP and HBsu-RFP by fast digest from promega.

Methods:

The reaction we ran was:

45ul DNA

1ul 10x fast digest buffer

1ul PstI

1ul EcoRI

2ul Water

Total: 50ul

We left this at 37 ̊C for 3 hours.

Then we also cut the linearised pSB1C3 backbone that was sent from iGEM using the same restriction enzyme. The reaction used is:

4ul of DNA (25ng/ul)

4ul of master mix (Contains restriction enzyme EcoRI and PstI)

After the digest we kept it in the -20 ̊C freezer.

Results:

Detail needed!!

Inoculating Plants with L-forms

Aim:

To plant Chinese Cabbage seeds on petri dishes so it can germinate and can be inoculated with L-forms.

Methods:

For the first part of the protocol please refer to August 7th . We checked the seeds we planted yesterday and observed that the chinese cabbage seeds had begun to germinate. This meant that they were ready to absorb L-forms. We soaked 20 cabbage seeds for 3 hours in 5ml of L-form solution and another 20 seeds in 5%(w/v) mannitol solution to act as a control. The seeds were then washed with distilled water (to lyse extracellular L-forms) and replated on Murishage and Skoog agar plates. This was done following the Production of L-form containing Plants protocol from stage five onwards.

Results:

Please refer to August 9th .


8

9

Titles

  • L-form Protocol
  • B. subtilis Transformation of HBsu-(x)FP
  • Plant Microscopy
  • Project Description Due

Details

Wiki

We finalized the project description and put it onto the wiki page.

L-form Protocol

We did the L-form protocol to create more L-forms. Using this protocol, we created 4 flasks of L-forms which has HBsu-GFP tag on them.

B. subtilis Transformation of HBsu-(x)FP

Aim and Methods:

Please refer to August 8th .

Results:

The transformation conducted yesterday did not work after checking the plates. Only thing that grew was control in normal LB.

LB ery 168H20 0908.jpg

Barecillus LB ery 168rrnB 0908.jpg

Barecillus LB ery HBsu-GFP 0908.jpg

Barecillus LB ery HBsu-RFP 0908.jpg

Plant microscopy

Aim and Methods:

Please refer to August 7th and August 8th .

Results and Discussion:

Today we viewed the seedlings, that we had washed with L-forms yesterday,using bright field and fluorescence microscopy. When viewing an L-form washed seedling using fluorescence microscopy we noticed clearly defined green circles in several different areas of the plant. These were of the correct size (about 0.5um) to correspond to our GFP labelled L-forms. No such green circles were found in our control that had been washed in mannitol solution instead of L-form solution. These results are encouraging as they indicate we may have successfully inoculated plants with L-forms, although more evidence is needed. We also decided that when we next grow L-forms in plants, we should wash some seedlings in a solution of bacteria with cell walls to see if these can be taken up by plants.

8

12

Titles

  • Transformation of HBsu-(x)FP into B. subtilis
  • L-form Growth Curve
  • Planting Chinese Cabbage Seeds
  • L-Form simulation

Details

Transformation of HBsu-(x)FP into B. subtilis

Aim:

To transform B. subtilis with HBsu-(x)FP.

Methods:

Prepared competent cells by putting B. subtilis 168 in 10ml MM Media and left it to grow overnight. For the next part of the protocol please refer to August 13th .

Results:

Please refer to August 13th .

L-form Growth Curve

Aim:

To establish a growth curve for L-forms.

Methods:

We started doing the L-form growth curve. Initially we took OD reading of the L-form we grew over the weekend with a spectrophotometer.

Results:

The OD obtained was 0.246. We then diluted the solution down to get an OD of 0.05. That solution was then used to create the L-form growth curve. The initial readings of the two L-form samples were 0.05 and 0.046.

Planting Chinese Cabbage Seeds

Aim:

To plant seeds in order to wash them with L-forms and visualize them by confocal microscopy.

Methods:

We washed and planted chinese cabbage seeds in preparation for the introduction of L-forms into seedlings following the Production of L-form containing Plants protocol up to and including step four. The seeds were planted in Murishage and Skoog containing petri dishes and placed in a dark cuboard to germinate. The washing part of the protocol will be done on August 13th .


Results:

Please refer to August 14th .

L-Form simulation

In last couple days we tried adding fusion, which was kind of hard to do, but in the end we succeeded doing that(although it still has couple of bugs, we will fix them asap).

8

13

Titles

  • Transformation of HBsu-(x)FP into B. subtilis
  • Cloning HBsu-GFP and HBsu-RFP into pSB1C3
  • Inoculating L-forms into Chinese Cabbage
  • L-form Growth Curve
  • Anything

Details

Transformation of HBsu-(x)FP into B. subtilis

Aim:

To transform B. subtilis with HBsu-(x)FP.

Methods:

For the first part of the protocol please refer to August 12th . We followed the B. subtilis transformation protocol.

Plates:

HBsu-GFP on LB + ery (5ug/ml) plates x2

HBsu-RFP on LB + ery (5ug/ml) plates x2

rrnB on LB + ery (5ug/ml) plates x2 (positive control)

Water on LB + ery (5ug/ml) plates x2 (negative control)

Water on LB + Cm (5ug/ml) plates x2 (negative control)

Cell in LB x2 (to check viability of cells)

Barecillus LB ery HBsu-GFP 1308.jpg

Figure 1: HBsu-GFP on LB + ery (5ug/ml) plates

Barecillus LB ery HBsu-RFP 1308.jpg

Figure 2: HBsu-RFP on LB + ery (5ug/ml) plates

Barecillus LB ery 168rrnB 1308.jpg

Figure 3: rrnB on LB + ery (5ug/ml) plates x2 (positive control)

Barecillus LB ery 168H20 1308.jpg

Figure 4: Water on LB + ery (5ug/ml) plates x2 (negative control)

Results:

Please refer to August 14th .


Digest pMutin4 HBsu-GFP and HBsu-RFP

Aim:

To digeste the pMutin4 HBsu-GFP and HBsu-RFP by fast digest from promega.

Methods:

The reaction we ran was:

45ul DNA

1ul 10x fast digest buffer

1ul PstI

1ul EcoRI

2ul Water

Total: 50ul

We left this at 37 ̊C for 3 hours.

After we linearized the plasmid, we ran 8ul digest reaction on a gel to confirm the size of the fragments (Figure 5).

Results and Discussion:

Barecillus august22 cloning(pMutin4).jpg

Figure 5: Gel to confirm size of HBsu-GFP and HBsu-RFP in pMutin4

Lane 1: 10kB DNA Ladder

Lane 2-3: Empty

Lane 4: HBsu-RFP

Lane 5-6: Empty

Lane 7: Hbsu-GFP

Lane 8:Empty

Lane 9: 10kB DNA Ladder

Lane 10: Empty

Lane 11: 10kB DNA Ladder


After we have confirmed the size, we ran a 80ul digest and cut out the fragment of interest of HBsu-RFP and HBsu-GFP using the transilluminator and performed the gel extraction protocol.

Barecillus august11 transilluminator(80).jpg

Figure 6

Lane 1: 10kB DNA Ladder

Lane 2-4: Empty

Lane 5: HBsu-RFP

Lane 6-7: Empty

Lane 8: 10kB DNA Ladder

Lane 9-11:Empty

Lane 12: Hbsu-GFP

After this was conducted we checked the nanodrop reading to find out the concentration of DNA which turned out to be for 20ng/ul HBsu-RFP and 17 ng/ul for HBsu-GFP). We then ligated them to the cut backbone that was done on the august 17th. Using the T4 ligase we ran a 1:1, 1:3, 1:5 and control for each sample. We then let it react in the thermocycler at 22 ̊C for an hour and stored at 4 ̊C overnight.

Inoculating L-forms into Chinese Cabbage

Aim and Methods:

We checked the seeds we planted on August 12th and observed that the chinese cabbage seeds had begun to germinate. This meant that they were ready to absorb L-forms. We soaked 20 cabbage seeds for 3 hours in 5ml of L-form solution and another 20 seeds in 5%(w/v) mannitol solution to act as a control. We also created another control by soaking 20 seeds in B. subtilis rod cells. The seeds were then washed with distilled water (to lyse extracellular L-forms) and replated on Murishage and Skoog agar plates. This was done following the Production of L-form containing Plants protocol from stage five onwards.

Results:

Please refer to August 14th .


L-form Growth Curve

Aim and Methods:

Please refer to August 12th .

Results:

An OD of 0.08 and 0.09 was obtained.

8

14

Titles

  • Transformation of HBsu-(x)FP into B. subtilis
  • Competent Cells Preparation
  • L-form Growth Curve
  • Plant Confocal Microscopy

Details

Transformation of HBsu-(x)FP into B. subtilis

Aim and Methods:

Please refer to August 12th and August 13th .

Results and Discussion:

The transformation conducted on August 13th worked. We took some colonies and plated it on a starch plate we made earlier so the iodine test could be performed to confirm that HBsu-RFP and HBsu-GFP has integrated into the amyE region (Figure 1-3).

Plates:

HBsu-RFP

HBsu-GFP

168 BSB1 (negative control)

pGFP-rrnB (positive control)

Barecillus august14 frontview.jpg

Figure 1: Iodine Test (Front View of Plate 1)

Barecillus august14 backview.jpg

Figure 2: Iodine Test (Back View of Plate 1)

Barecillus august14 plate2.jpg

Figure 3: Iodine Test (Front View of Plate 2)

Competent Cells Preparation

Aim:

To make competent E.coli

Methods:

We inoculated some XL1-B in 10ml of LB overnight to use in the next day to prepare competent E.coli cells. Method continued on August 15th .

Results:

Please refer to August 15th .

L-form Growth Curve

Aim and Methods:

Please refer to August 12th .

Results:

An OD of 0.1 and 0.12 was obtained

Plant Confocal microscopy

Aim and Methods:

Please refer to August 12th and August 13th .

Results:

Today we viewed our plants using confocal microscopy to try and detect any GFP-labelled bacteria. After viewing a few seeds washed in L-form solution under the microscope, we found a green fluorescing dot in the correct size range to be an L-form. No green dots were found in the rod cell or mannitol controls. Following these results we have decided to use confocal microscopy four days after washing our plants in L-form solution, rather than after one. As this co-insides with when [http://www.ncbi.nlm.nih.gov/pubmed/12859751 Tsomlexoglou et al.] used PCR to detect L-forms in their chinese cabbage.

BareCillusSeedptcl+GFP140813.jpg

Figure 1. Possible L-form inside Chinese cabbage. The bright green dot is the correct size to be an L-form. The green fluorescence image used to detect the L-form is superimposed onto a bright-field image of plant matter.

L-forms in sol1.jpg

Figure 2. L-forms from the solution used to wash the Chinese cabbage.

8

15

Titles

  • Iodine Test
  • Making Competent E.coli
  • Preparation of IPTG reaction and B. subtilis Transformation
  • L-form Growth Curve

Details

Iodine Test

Aim:

To carry out the iodine test to show... Detail needed!!

Methods:

Detail needed!!

Results and Discussion:

B. Subtilis 168 (Negative control): Halo

B. Subtilis BSB1 (Negative control): Halo

pGFP rrnB (Positive control): No Halo

HBsu-RFP: No Halo

HBsu-GFP: No Halo

When a halo is found, this shows that amyE is functional as it digests the starch around it. When a halo is not found, this means the amyE is non-functional. In this case, it means that the gene fragment has integrated into the amyE region causing it to be non-functional.

Making Competent E.coli

Aim:

To make competent E.coli for use on August 21th .

Methods:

Please refer to August 14th for the first part of the protocol. We followed the Competent E. coli protocol.

Results:

We yielded around 200 aliquots of E. coli competent cells.

Preparation of IPTG reaction and B. subtilis Transformation

We inoculated 2ml NB with B. subtilis 168 that is tagged with HBsu-GFP and another 2ml of NB with B. subtilis that is tagged with HBsu-RFP. This is then incubated at 37 ̊C to use for IPTG reaction. We also prepared 10ml of MM media and inoculated it with some B. subtilis 168.

L-form Growth Curve

Aim and Methods:

Please refer to August 12th .

Results:

An OD of 0.06 and 0.07 was obtained.

8

16

Titles

  • Transformation of Switch Brick into B. subtilis
  • L-form Growth Curve
  • L-Form simulation

Details

Transformation of Switch Brick into B. subtilis

Aim:

To transform the switch biobrick into Bacillus subtilis 168 strain.

Methods:

We followed the B. subtilis transformation protocol and plated it out on LB + Cm (5ug/ml) + Xyl (0.8%) plates that were made earlier today.

Plates:

Switch BioBrick on LB + Cm (5ug/ml)+ Xyl (0.8%) plates x1

rrnB on LB + Cm (5ug/ml)+ Xyl (0.8%) x1 (positive control)

B. subtilis 168 + Water on LB + Cm (5ug/ml)+ Xyl (0.8%) plates x1 (negative control)

B. subtilis 168 in LB x1 (to check viability of cells)

We left the plates to grow over the weekend.

Results:

Please refer to August 19th .


L-form Growth Curve

Aim and Methods:

Please refer to August 12th .

Results:

An OD of 0.03 and 0.05 was obtained.

L-Form simulation

After fixing bugs with L-Form fusion, simulation is starting to look very good. Next step would be to add L-Form division, which might get complicated, because we will need to have additional objects which would serve as another L-Form.

8

19

Titles

  • Transformation of Switch Brick into B. subtilis
  • L-form Growth Curve
  • Lyon Presentation
  • Planting Chinese Cabbage Seeds

Details

Transformation of Switch Brick into B. subtilis

Aim and Methods:

Please refer to August 16th .

Results:

We checked the transformation plate and it worked as expected.

Switch BioBrick on LB + Cm (5ug/ml)+ Xyl (0.8%) plates x1: Colonies Found

rrnB on LB + Cm (5ug/ml)+ Xyl (0.8%) x1 (positive control): Colonies Found

168 +Water on LB + + Cm (5ug/ml)+ Xyl (0.8%) plates x1 (negative control): No Colonies Found

Cell in LB x1 (to check viability of cells): Colonies Found

This was done to confirm the characterization of our BioBrick.

Barecillus Switch brick 1908.jpg

L-form Growth Curve

Aim and Methods:

Please refer to August 12th .

Results:

An OD of 0.008 and 0.005 was obtained.

Lyon Presentation

Started working on the presentation layout for Lyon using [http://www.http://prezi.com/ Prezi]. The team feels this will enable us to create a much more visually appealing presentation, giving us not only the best chance of captivating our audience and conveying our findings, but also winning at the Jamboree.

Initial design ideas have begun along the line of a microfluidics chip being used as a back-drop, with chambers used to contain relevant information (acting as "slides" as such). Along with the design ideas we have also started to compile a list of what information we want to have in the presentation, and how best to present this.

Planting Chinese Cabbage Seeds

Aim:

To plant seeds in order to wash them with L-forms and visualize them by confocal microscopy.

Methods:

We washed and planted chinese cabbage seeds in preparation for the introduction of L-forms into seedlings following the Production of L-form containing Plants protocol up to and including step four. The seeds were planted in Murishage and Skoog containing petri dishes and placed in a dark cupboard to germinate.

Results:

Please refer to August 23th .

8

20

Titles

  • Lyon Presentation
  • Inoculating L-forms into Chinese Cabbage
  • L-form Growth Curve
  • L-Form simulation

Details

Lyon Presentation

The presentation team has started getting to grips with Prezi and trying to find out exactly what it is capable of. We have discovered that the easiest way of creating animations is to create .swf files using Adobe Flash which, luckily, one of our members has a decent amount of experience with. Unfortunately it has also come to light that Prezi does not handle interactive animations well, meaning that animations will work much better if they loop endlessly. Whilst it is possibly to build simply interactivity into the animation, it requires and ActionScript 3.0 "hack" that could result in some unpredictable behavior. In the interest of reliability and owing to not wanting any unexpected events whilst giving the presentation, the interactive elements have been dropped out of the design.

Due to this the microfluidics theme has come under question, as the complexity of it may outweigh the overall result. One team member has, as such, come up with a preliminary design along a different theme. This can be seen in the image below and also by clicking [http://prezi.com/4jcdd8as8qrm/?utm_campaign=share&utm_medium=copy this link]. BareCillus Pres1.jpg

Inoculating L-forms into Chinese Cabbage

Aim and Methods:

We checked the seeds we planted on August 19th and observed that the chinese cabbage seeds had begun to germinate. This meant that they were ready to absorb L-forms. We soaked 20 cabbage seeds for 3 hours in 5ml of L-form solution. We created 5%(w/v) mannitol, B. subtilis rod and E.coli rod controls. The seeds were then washed with distilled water (to lyse extracellular L-forms) and replated on Murishage and Skoog agar plates. This was done following the Production of L-form containing Plants protocol from stage five onwards.

Results:

Please refer to August 23th .

L-form Growth Curve

Aim and Methods:

Please refer to August 12th .

Results:

An OD of 0.00 and 0.00 was obtained. For unknown circumstances, the L-form growth curve instead of increasing steadily throughout the week, it increased during the first 48hrs and then decreased throughout the rest of the week. We will reattempt to construct the L-form growth curve again at a later date.

L-Form simulation

Last couple days were quite busy in terms of L-Form simulation, was trying different ways to make L-Forms divide. Found a quite neat solution which required me to create another list, with empty objects (when L-Forms fuse, 1 of the previous L-Forms become redunandt), but using this method number of L-forms in simulation won't exceed initial number of balls.

8

21

Titles

  • Characterisation of Switch Brick
  • Cloning of HBsu-(x)fp pSB1C3 into E. coli XL1-B
  • Lyon Presentation

Details

Characterization of switch brick

Aim:

To characterize the switch brick.

Methods:

We took some colonies that grew on August 19th and put it in NB/MSM + xyl. We altered the xylose concentration between the range of 0-0.8% by increments of 0.2%. We then left it to grow for 12 hours before checking them under the microscope.

Results:

Please refer to August 22nd .

Cloning of HBsu-(x)fp pSB1C3 into E.coli XL1-B

Aim:

To clone the ligation product that was obtained from August 13th into competent E.coli XL1-B that was prepared on the August 15th .

Methods:

Plates:

XL1B + 1:1 HBsu-GFP pSB1C3 on LB + Cm (5ug/ml)

XL1B + 1:3 HBsu-GFP pSB1C3 on LB + Cm (5ug/ml)

XL1B + 1:5 HBsu-GFP pSB1C3 on LB + Cm (5ug/ml)

XL1B + 1:1 HBsu-RFP pSB1C3 on LB + Cm (5ug/ml)

XL1B + 1:3 HBsu-RFP pSB1C3 on LB + Cm (5ug/ml)

XL1B + 1:5 HBsu-RFP pSB1C3 on LB + Cm (5ug/ml)

XL1B + No insert pSB1C3 on LB + Cm (5ug/ml)

Results:

Please refer to August 22nd .

Lyon Presentation

The design idea created yesterday has been scrapped to further pursue the microfluidics theme less the abundance of animation & interactivity. Designs are currently being worked on.

8

22

Titles

  • Characterization of Switch Brick Results
  • Cloning of HBsu-(x)fp pSB1C3 into E.coli XL1-B Results

Details

Characterization of Switch Brick Results

Aim and Methods:

Please refer to August 21st .

Results:

The samples that had been growing for 12 hours were put under the microscope.

No xylose: All L-forms

0.2 xylose: Most L-forms but a few rod cells

0.4 xylose: Few L-forms more rod cells

0.8 xylose: All rod cells

From this result, we can tell that our switch brick works as expected. When xylose is not present, almost all cells are L-forms. When more xylose is present, more rod cells survive.

Cloning of HBsu-(x)fp pSB1C3 into E.coli XL1-B Results

Aim and Methods:

Please refer to August 21st .


Results and Discussion:

There were colonies for all of the plates except for the negative control.

Barecillus LB HBsuGFP 1,1 2108.jpg

Figure 1: XL1B + 1:1 HBsu-GFP pSB1C3 on LB + Cm (5ug/ml)

Barecillus LB HBsuGFP 1,3 2108.jpg

Figure 2: XL1B + 1:3 HBsu-GFP pSB1C3 on LB + Cm (5ug/ml)

Barecillus LB HBsuGFP 1,5 2108.jpg

Figure 3: XL1B + 1:5 HBsu-GFP pSB1C3 on LB + Cm (5ug/ml)

Barecillus LB HBsuRFP 1,1 2108.jpg

Figure 4: XL1B + 1:1 HBsu-RFP pSB1C3 on LB + Cm (5ug/ml)

Barecillus LB HBsuRFP 1,3 2108.jpg

Figure 5: XL1B + 1:3 HBsu-RFP pSB1C3 on LB + Cm (5ug/ml)

Barecillus LB HBsuRFP 1,5 2108.jpg

Figure 6: XL1B + 1:5 HBsu-RFP pSB1C3 on LB + Cm (5ug/ml)

Barecillus LB control 2108.jpg

Figure 7: XL1B + No insert pSB1C3 on LB + Cm (5ug/ml)

We then inoculate one colony from each sample in to LB and let it grow overnight in order to harvest the plasmid. With the amplified plasmid we could then check that it is the correct size and confirm that cloning has worked (Figure 8). The HBsu-GFP and HBsu-RFP insert was confirmed to be the correct size of 1379bp and 1339bp respectively. However the switch brick has not been cut properly. Therefore, the protocol will be repeated.

Barecillus august22 cloning HBsu(pSB1C3).jpg

Figure 8: Gel to Confirm Size of HBsu-GFP and HBsu-RFP insert size

Lane 1: 1kB Ladder

Lane 2: HBsu-GFP PstI

Lane 3: Hbsu-GFP EcoRI

Lane 4: HBsu-GFP PstI and EcoRI

Lane 5: HBsu-GFP Uncut

Lane 6: 1kB Ladder

Lane 7: HBsu-RFP PstI

Lane 8: Hbsu-RFP EcoRI

Lane 9: HBsu-RFP PstI and EcoRI

Lane 10: HBsu-RFP Uncut

Lane 11: 1kB Ladder

Lane 12: Switch Brick PstI

Lane 13: Switch Brick EcoRI

Lane 14: Switch Brick PstI and EcoRI

Lane 15: Switch Brick Uncut

8

23

Titles

  • Lyon Jamboree Attendance Fee Due
  • Plant Confocal Microscopy

Details

Safety Form

We worked on the safety form that was due in for August 30th . To complete the safety forms, we referred back to some COSHH forms and BioCOSHH forms of the lab for help. We also had to look up some of the bacterial strains we were using. This was to confirm the risk group and possible threats it may pose to the members of the lab, environment, general public and security through misuse. For more information on the safety form please refer to the following link.

Plant Confocal Microscopy

Aim and Methods:

Please refer to August 19th and August 20th

Results:

We viewed 7 different Chinese cabbage seedlings washed with L-forms under the confocal microscope. In three of these plants we found clusters of green fluorescent dots about 0.5µm in diameter. We found no clusters of green fluorescent dots in three seedlings soaked in the mannitol control.

BareCilluspos.Lf.in.C.C.2230813.jpg

Figure 1. Cluster of L-forms inside a Chinese cabbage seedling.

BareCilluscontrolAF.plant cells.jpg

Figure 2. Image of mannitol-soaked control exhibiting faint green auto-fluorescence, allowing us to see the outline of plant cells.

8

26

Titles

  • Miniprep on XL1-B cells with clone product
  • Planting Chinese Cabbage Seeds

Details

Miniprep on XL1-B cells with clone product

Aim:

We conducted a miniprep on XL1-B cells containing the clone product from August 22nd .

Methods:

  • link to mini-prep protocol*

Results:

The spectrophotometer readings were:

HBsu-GFP pSB1C3: 80.7ng/ul

HBsu-RFP pSB1C3: 95.6ng/ul

We then digest the plasmid using EcoRI and PstI fast digest on a 10ul reaction.

8ul of DNA

0.5ul of PstI Fast Digest

0.5ul of EcoRI Fast Digest

1ul of 10x Fast Digest Buffer

Total: 10ul

We let the reaction run at 37 ̊C for 2 hours and ran the digest on a 0.7% agarose gel. After the gel has finished running, we viewed the gel under the transilluminator to check the size of the fragments. The fragments were all of the correct sizes so the cloning was successful.

Planting Chinese Cabbage Seeds

Aim:

To plant seeds in order to wash them with L-forms and visualize them by confocal microscopy.

Methods:

We washed and planted chinese cabbage seeds in preparation for the introduction of L-forms into seedlings following the Production of L-form containing Plants protocol up to and including step four. The seeds were planted in Murishage and Skoog containing petri dishes and placed in a dark cuboard to germinate.

Results:

Please refer to ??

8

27

Titles

  • L-Form simulation
  • Characterisation of the HBsu-(x)fp
  • Transformation of B. subtilis that contained HBsu-(x)FP with Switch Brick

Details

L-Form simulation

Simulation is nearly done, just giving finishing touches. One of them is improving movement of L-forms, so it's more realistic. Although it took a while to figure out the best movement algorithm, at first we tried doing it completely random, but it didn't work out quite well, so in the end we decided it to make not as random. So what we did is that let's say L-form moves 1px in x and y axis per second, so our algorithm would then generate random number from [-2;2] and then would add it up to the current speed. But, because of nature of randomness balls would move too fast or too slow, so we had to make "limits" so it doesn't get too fast or too slow.

Characterisation of the HBsu-(x)fp

Aim:

To characterize the HBsu-(x)FP BioBrick. From our cloning strategy, we planned to conduct a single cross over so the whole pMutin4 plasmid including the insert is integrated into the B. subtilis chromosomal DNA. After it has been integrated, our biobrick will be under the control of Pspac promoter. Pspac promoter is an IPTG inducible promoter.

Methods:

The B. subtilis 168 strain that has been transformed with HBsu-GFP and HBsu-RFP was inoculated on August 15th to characterise the HBsu-(x)fp biobrick.

The concentration of IPTG was varied from a range of 0.05 – 0.8 mM to observe the conditions that yield the maximum concentration of product. We checked the fluorescence of this fusion protein at 10mins, 30mins, 60mins and 120mins after addition of IPTG to see how long it takes to get the maximum signal.

Results:

The results of this first trial were not very conclusive as there were cross contamination between samples with IPTG and the control.

Transformation of B. subtilis that contained HBsu-(x)FP with Switch Brick

Aim:

To transform B. subtilis that contained HBsu-(x)FP with Switch Brick as well.

Methods:

The the MM Media was inoculated with B. subtilis that was transformed with HBsu-GFP and HBsu-RFP and was left to grow overnight at 37 ̊C. This is to prepare for transformation with switch brick on August 28th .

Results:

Please refer to August 29th


8

28

Titles

  • Transformation of B. subtilis that contained HBsu-(x)FP with Switch Brick
  • Safety Page

Details

Transforming Switch BioBrick into HBsu-(x)fp B. subtilis

Aim:

To transform B. subtilis that contained HBsu-(x)FP with Switch Brick as well.

Methods:

The protocol was continued from August 27th

The switch biobrick was transformed into Bacillus subtilis 168 strain which already contained the HBsu-(x)fp. The B. subtilis transformation protocol was followed and samples were plated out on LB + Ery (5ug/ml)+ Cm (5ug/ml) + Xyl (0.8%) plates that were made earlier today.

Plates:

168 HBsu-RFP + Switch BioBrick on LB + Ery (5ug/ml) + Cm (5ug/ml) + Xyl (0.8%) plates x1

168 HBsu-GFP + Switch BioBrick on LB + Ery (5ug/ml) + Cm (5ug/ml) + Xyl (0.8%) plates x1

168 HBsu-RFP + water on LB + Ery (5ug/ml) + Cm (5ug/ml) + Xyl (0.8%) plates x1

168 HBsu-GFP + water on LB + Ery (5ug/ml) + Cm (5ug/ml) + Xyl (0.8%) plates x1

168 HBsu-RFP + Switch BioBrick on LBx1

168 HBsu-GFP + Switch BioBrick on LB x1

The plates were left to grow for the next two days.

Results:

Please refer to August 29th .

Safety Page

Having completed the safety form on August 23rd, we started to work on the safety page of the wiki. On the safety page, we included everything in the safety form but in more detail. We also included a detailed account of the lan training program and safety precautions. For more detail, please visit the safety page

8

29

Titles

  • Transformation of B. subtilis that contained HBsu-(x)FP with Switch Brick
  • Part submission

Details

Transformation of B. subtilis that contained HBsu-(x)FP with Switch Brick

We checked the transformation that we did previously and the results are the following:

Plates: 168 HBsu-RFP + Switch BioBrick on LB + Ery (5ug/ml)+ Cm (5ug/ml) + Xyl (0.8%) plates x1: Colonies

168 HBsu-GFP + Switch BioBrick on LB + Ery (5ug/ml)+ Cm (5ug/ml) + Xyl (0.8%) plates x1: No Colonies

168 HBsu-RFP + water on LB + Ery (5ug/ml)+ Cm (5ug/ml) + Xyl (0.8%) plates x1: No Colonies

168 HBsu-GFP + water BioBrick on LB + Ery (5ug/ml)+ Cm (5ug/ml) + Xyl (0.8%) plates x1: No Colonies

168 HBsu-RFP + Switch BioBrick on LBx1: Colonies

168 HBsu-GFP + Switch BioBrick on LB x1: Colonies

To check that the transformation with the switch brick works we inoculate some of the cells on the plate into NB/MSM + xyl (0.8%) and NB/MSM only.

Part submission

We worked on submitting three of our BioBrick to the iGEM registry. We put all the basic information about the part including the sequences.

Here are the parts:

[http://parts.igem.org/Part:BBa_K1185000 Switch BioBrick]

[http://parts.igem.org/Part:BBa_K1185001 HBsu-GFP]

[http://parts.igem.org/Part:BBa_K1185002 HBsu-RFP]

8

30

Titles

  • Confirming Transforming Switch BioBrick into HBsu-(x)fp B. subtilis Has Worked
  • L-form Protocol
  • Preparing 168 with HBsu-GFP and HBsu-RFP for IPTG check
  • L-form Conversion Time Lapse

Details

Confirming Transforming Switch BioBrick into HBsu-(x)fp B. subtilis has Worked

Aim:

To confirm that the switch BioBrick has transformed into B. subtilis containing HBsu-(x)FP.

'Methods:

Cells from the NB/MSM xyl (0.8%) and NB/MSM only plates were inoculated into a solution and the solution was checked.

Results:

NB/MSM + xyl: Stay as rod cells

NB/MSM only: L-forms

This suggests that the switch biobrick works even when we transform it into B. subtilis 168 with HBsu-(x)fp biobrick in it.

L-form Protocol

Aim:

To produce more L-form culture.

Methods:

The L-form Protocol was followed to obtain more L-forms.

Results:

The L-form protocol was successful and new L-forms were obtained.

IPTG check for B. subtilis 168 containing HBsu-GFP and HBsu-RFP

Aim:

To check that HBsu-GFP and HBsu-RFP was controlled by IPTG.

Detail needed!!

Methods:

B. subtilis 168 with HBsu-GFP and HBsu-RFP was inoculated into LB+ery solution in preparation for IPTG check.

Results:

Details needed!!

L-form Conversion Time Lapse

Set up microscope to do time lapse photography to see the conversion of B. subtilis rod cell to L-forms.

9

2

Titles

  • Wiki Design Plan

Details

Wiki Design Plan

We made rough sketches of adaptations to the front page of the wiki to make it more user friendly with less text and more symbols. This will make the wiki more visually appealing, directing readers to the overview page where the information will be found. There was also talk of redesigning the overview page to make it clearer where individual sub-project information could be found.

9

3

Titles

  • Poster Text

Details

Poster Text

We changed and adapted the poster text from the YSB1.0 conference according to feedback given, to make the format more visual and a clear. This included adding pictures, labels, captions and results for the Lyon Jamboree.

9

4

Titles

  • Skype Conference with Edinburgh Team and Dr. Jane Calvert

Details

Skype Conference with Edinburgh Team and Jane Calvert

We had a conference call via skype to the Edinburgh iGEM team and Dr. Jane Calvert who works in the Science Technology and Innovation Studies, School of Social and Political Science at the University of Edinburgh. The aim of this conference was to gain ideas about how to approach the ethical concerns related to our project and possibly highlight opinions that haven't yet been considered. The call was very successful and there were multiple points made that we could consider and expand on for the ethics section of our project.

JaneCalvert Edinburgh2.jpg

JaneCalvert Edinburgh.jpg

9

6

Titles

  • Switch BioBrick pre-submission check
  • Creating L-form

Details

Switch BioBrick Digest

We have characterize the Switch BioBrick and shown that it works as expected. Now we are preparing sample for submission, just to make sure that the Switch BioBrick size is correct and has been cloned into pSB1C3 we digested the Switch BioBrick.

We performed 4 digest reactions, first is an uncut plasmid, second and third is a single digest with EcoRI, PstI in this order, and last one is the Double Digest with both enzymes. After leaving the reaction to run at 37oC for 3 hours, we then load them into 0.7% Agarose gel.

The results of the gel revealed that the Switch BioBrick is indeed the correct size and been cloned into pSB1C3 backbone.

BareCillus Switch BioBrick Digest.jpg

Figure 1: Switch BioBrick digest product on a 0.7% agarose.

Lane 1: Uncut plasmid

Lane 2: Switch BioBrick Single Digest with EcoRI

Lane 3: Switch BioBrick Single Digest with PstI

Lane 4: Double Digest with EcoRI and PstI

We then picked the Switch BioBrick transformed E.coli XL1B colonies from the plate and inoculate 4 bottles of 10ml LB with it. This is to amplify the plasmid, and so will be able to do Plasmid Extraction MiniPrep to extract large quantities of plamid and ready for submission.

Making L-form

We picked B. subtilis str. 168 with HBsu-GFP + Switch BioBrick and HBsu-RFP + Switch BioBrick transformed into them from the LB+Cm+Ery+0.8%Xylose plate and innoculate them into 12 bottles of 10ml LB. Let them grew for 3 hours before applying lysosyme onto them to get L-form. These L-forms were then incubated at 30oC over the weekend, before being used on Monday to prove that they are unstable outside osmotically balance environment.

9

18

Titles

  • BioBrick DNA Due

Details

The DNA of our BioBricks needs to be submitted to the registry by this date.



Newcastle University The Centre for Bacterial Cell Biology Newcastle Biomedicine The School of Computing Science The School of Computing Science