Team:Hong Kong HKUST/Project/module3

From 2013.igem.org

(Difference between revisions)
 
(45 intermediate revisions not shown)
Line 8: Line 8:
$(this).find("ul").stop().fadeToggle(10);
$(this).find("ul").stop().fadeToggle(10);
});
});
 +
});
 +
</script>
 +
<script>
 +
$(document).ready(function(){
 +
 +
// hide #back-top first
 +
$("#back-top").hide();
 +
 +
// fade in #back-top
 +
$(function () {
 +
$(window).scroll(function () {
 +
if ($(this).scrollTop() > 100) {
 +
$('#back-top').fadeIn();
 +
} else {
 +
$('#back-top').fadeOut();
 +
}
 +
});
 +
 +
// scroll body to 0px on click
 +
$('#back-top a').click(function () {
 +
$('body,html').animate({
 +
scrollTop: 0
 +
}, 800);
 +
return false;
 +
});
 +
});
 +
});
});
</script>   
</script>   
Line 42: Line 69:
{visibility:hidden;}
{visibility:hidden;}
#globalWrapper
#globalWrapper
-
{position: relative;font-size:127%;width:100%;margin:0;padding:0;padding-bottom:10px;background-color:#494042;height:2400px;}
+
{position: relative;font-size:127%;width:100%;margin:0;padding:0;padding-bottom:10px;background-color:#494042;height:1500px;}
#content
#content
-
{width: 1000px;border:none;background-color:#ffffff;height:2300px;padding:0px;margin-top:0px;line-height: 1.5em;color: black;}
+
{width: 995px;border:none;background-color:#ffffff;height:1450px;padding:0px;margin-top:0px;line-height: 1.5em;color: black;}
#top-section
#top-section
{height:2px;border:none;background-color:#494042;}
{height:2px;border:none;background-color:#494042;}
Line 140: Line 167:
top:141px;
top:141px;
width:100%;
width:100%;
 +
z-index:1;
}
}
-
ul.side-nav {
+
#back-top {
 +
position: fixed;
 +
top: 10%;
 +
right: 2%;
 +
z-index:16;
 +
}
 +
#back-top a {
 +
width: 108px;
 +
display: block;
 +
text-align: center;
 +
font: 11px/100% Arial, Helvetica, sans-serif;
 +
text-transform: uppercase;
 +
text-decoration: none;
 +
color: #bbb;
 +
/* background color transition */
 +
-webkit-transition: 1s;
 +
-moz-transition: 1s;
 +
transition: 1s;
 +
}
 +
#back-top a:hover {
 +
color: #ffffff;
 +
}
 +
 
 +
#back-top span {
 +
width: 65px;
 +
height: 60px;
 +
display: block;
 +
margin-bottom: 7px;
 +
background: #ddd url(up-arrow.png) no-repeat center center;
 +
/* rounded corners */
 +
-webkit-border-radius: 15px;
 +
-moz-border-radius: 15px;
 +
border-radius: 15px;
 +
/* background color transition */
 +
-webkit-transition: 1s;
 +
-moz-transition: 1s;
 +
transition: 1s;
 +
}
 +
#back-top a:hover span {
 +
background-color: #777;margin-top:10px;
 +
}
 +
 
 +
ul.side-nav, ul.side-nav1 {
display: block;
display: block;
list-style: none;
list-style: none;
margin: 0;
margin: 0;
-
padding: 17px 0;
+
padding: 17px 0;font-family:"Trebuchet MS", Helvetica, sans-serif;
}
}
ul.side-nav h6 {
ul.side-nav h6 {
margin: 47px 0px 0px;
margin: 47px 0px 0px;
}
}
-
ul.side-nav li.divider {
+
ul.side-nav1 h6 {
 +
margin: 0px 0px 0px;
 +
}
 +
ul.side-nav li.divider, ul.side-nav1 li.divider {
border-top: 1px solid #ddd;
border-top: 1px solid #ddd;
}
}
 +
.two, .row .two {
.two, .row .two {
width: 16.66667%;
width: 16.66667%;
Line 167: Line 241:
width: 83.33333%;
width: 83.33333%;
top:192px;
top:192px;
-
z-index:-2;
+
 
}
}
.column, .columns {
.column, .columns {
Line 179: Line 253:
}
}
h1, h2, h4, h5, h6 {
h1, h2, h4, h5, h6 {
-
font-family: 'Bitter', serif;
+
font-family:"Trebuchet MS", Helvetica, sans-serif;
font-weight: normal;
font-weight: normal;
color: #000;
color: #000;
border-bottom: none;
border-bottom: none;
-
h3{font-size:18px;}
+
 
 +
h3{font-size:18px;font-family:"Trebuchet MS", Helvetica, sans-serif;}
h5{margin-left:15px;}
h5{margin-left:15px;}
Line 209: Line 284:
}
}
.nine, .row .nine {
.nine, .row .nine {
-
width: 100%;
+
width: 100%;font-family:"Trebuchet MS", Helvetica, sans-serif;
}
}
[class*="column"] + [class*="column"]:last-child {
[class*="column"] + [class*="column"]:last-child {
Line 220: Line 295:
ul li ul, ul li ol {
ul li ul, ul li ol {
margin-left: 20px;
margin-left: 20px;
-
margin-bottom: 0;
+
margin-bottom: 0;}
-
</style>
+
 +
#iGEM_Logo{
 +
width:100px;
 +
height:80px;
 +
position:absolute;
 +
right:10px;
 +
top:60px;
 +
z-index:+15;
 +
}
 +
#hkust_Logo{
 +
width:60px;
 +
height:80px;
 +
position:absolute;
 +
right:110px;
 +
top:60px;
 +
z-index:+15;
 +
}
 +
 +
</style>
 +
</head>
<body>
<body>
 +
 +
          <a href="https://2013.igem.org/Main_Page"><img id="iGEM_Logo" src="https://static.igem.org/mediawiki/2013/4/46/Igem_qgem_logo.png"></a>
 +
         
 +
 +
<a href="http://www.ust.hk/eng/index.htm"><img id="hkust_Logo" src="https://static.igem.org/mediawiki/2013/5/55/Hkust_logo.gif"></a>
 +
 +
<p id="back-top" style="display:none;">
 +
<a href="#top"><span><img src="http://515alive.com/theme/img/up-arrow.png" style="width:90%;"><br><br>BACK TO TOP</span></a>
 +
</p>
<a href=https://2013.igem.org/Team:Hong_Kong_HKUST><center><div id="kepala" style="height:121px;width:100%;"><img src="https://static.igem.org/mediawiki/igem.org/c/c7/BANNER1_%281%29.png" style="height:121px;width:100%;align:middle;"></div></center></a>
<a href=https://2013.igem.org/Team:Hong_Kong_HKUST><center><div id="kepala" style="height:121px;width:100%;"><img src="https://static.igem.org/mediawiki/igem.org/c/c7/BANNER1_%281%29.png" style="height:121px;width:100%;align:middle;"></div></center></a>
<div id="cover"></div>
<div id="cover"></div>
Line 236: Line 338:
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/advisors">Advisors</a></li>
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/advisors">Advisors</a></li>
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/instructors">Instructors</a></li>
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/instructors">Instructors</a></li>
 +
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/attribution">Attribution</a></li>
 +
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/acknowledge">Acknowledgement</a></li>
</ul>
</ul>
</li>
</li>
-
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/project">Project</a>
+
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/Project">Project</a>
<ul>
<ul>
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/abstract">Abstract</a></li>
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/abstract">Abstract</a></li>
-
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/modelling">Modelling</a></li>
+
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/modules">Modules Description</a></li>
-
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/characterization">Characterization</a></li>
+
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/data">Data Page</a></li>
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/Parts">Parts</a></li>
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/Parts">Parts</a></li>
-
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/datapage">Data Page</a></li>
+
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/characterization">Characterization</a></li>
-
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/results">Results</a></li>
+
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/results">Result</a></li>
 +
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/future">Future Work</a></li>
</ul>
</ul>
</li>
</li>
Line 252: Line 357:
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/Wetlab">Wetlab</a>
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/Wetlab">Wetlab</a>
<ul>
<ul>
-
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/notebook">notebook</a></li>
+
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/notebook">Notebook</a></li>
-
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/protocols">protocols</a></li>
+
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/protocols">Protocols</a></li>
-
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/safety">safety</a></li>
+
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/safety">Safety</a></li>
 +
 
</ul>
</ul>
</li>
</li>
Line 267: Line 373:
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/hp">Human Practice</a>
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/hp">Human Practice</a>
<ul>
<ul>
-
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/hp/Interviews">Interviews</a></li>
+
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/hp/cp">Country Profile</a></li>
-
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/hp/Presentation">Presentation</a></li>
+
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/hp/blog">Blog</a></li>
-
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/hp/Videos">Videos</a></li>
+
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/hp/interview">Interviews</a></li>
-
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/hp/Article">Article</a></li>
+
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/hp/article/genet">Article</a></li>
 +
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/hp/video">Videos</a></li>
 +
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/hp/presentation">Presentations</a></li>
</ul>
</ul>
</li>
</li>
</ul>
</ul>
-
</div>
+
 
</div>
</div>
       <div class="row">
       <div class="row">
<div class="two columns">
<div class="two columns">
-
<ul class="side-nav">
+
<br>
 +
<ul class="side-nav">
<li>
<li>
-
<h6>Module Three</h6>
+
<h6>Modules</h6>
</li>
</li>
<li class="divider"></li>
<li class="divider"></li>
 +
<a href="https://2013.igem.org/Team:Hong_Kong_HKUST/Project/module4">Glyoxylate Shunt</a>
 +
 +
</li>
 +
<li>
 +
Protein Trafficking
 +
<ul><li>
 +
<li>
<li>
-
<a href="https://2013.igem.org/Team:Hong_Kong_HKUST/Wetlab">Cell Line</a>
+
<a href=#1>Overview</a>
</li>
</li>
<li>
<li>
-
<a href="https://2013.igem.org/Team:Hong_Kong_HKUST/Wetlab">Cell Culture</a>
+
<a href=#2>Biology of Mitochondrial Leader Sequence (MLS)</a>
</li>
</li>
-
<li>
+
-
<a href=>Cell Viability</a>
+
<li>
-
                                                 <ul><li>MTT Assay</li>
+
<a href=#3>Reference</a>
-
                                                <li>Results</li></ul>
+
                                                  
</li>
</li>
-
<li>
+
</ul>
-
Fatty Acid Quantification
+
</li>
-
+
<li>
-
<ul><li>
+
<a href="https://2013.igem.org/Team:Hong_Kong_HKUST/Project/module2">FA Sensing Mechanism</a>
-
Fatty Acid Treatment
+
 
</li>
</li>
-
                                <li>GC-MS</li></ul>
+
</ul>
-
                                </li>
+
 
-
+
-
</ul>
+
</div>
</div>
<div class="ten columns team-bios-container">
<div class="ten columns team-bios-container">
<div class="row" id="ugd-members">
<div class="row" id="ugd-members">
<div class="twelve columns">
<div class="twelve columns">
-
 
<h2 class="centered">Protein Trafficking</h2>
<h2 class="centered">Protein Trafficking</h2>
</div>
</div>
</div>
</div>
<div class="row">
<div class="row">
-
<div class="nine columns">
+
<div class="nine columns"><p id="1"></p>
<h3>Overview</h3>
<h3>Overview</h3>
-
In our project, we introduced bacterial enzymes to mammalian cell to modify metabolic pathway. However, unlike bacteria, citric acid cycle in mammalian cells is compartmentalized in mitochondria. The ACE proteins should be targeted to mitochondria for their functionality. To do so, we fused ACE enzymes with Mitochondrial Leader Sequence (MLS).
+
In our project, we introduced bacterial glyoxylate enzymes into mammalian cells to create alternative metabolic pathway. However, unlike their native environment in bacteria, the two enzymes needed to find their way through the high compartmentalized system in order to reach the citric acid cycle where they could act on.
<br>
<br>
 +
To guide the glyoxylate enzymes into the mitochondria where mammalian citric acid cycle resides, we produced recombinant glyoxylate enzymes by attaching the Mitochondrial Leader Sequence (MLS) to their N-termini.
 +
<br>
 +
We have also constructed the MLS in its own into standard BioBricks (<a href="http://parts.igem.org/Part:BBa_K1119000">BBa_K1119000</a> & <a href="http://parts.igem.org/Part:BBa_K1119001">BBa_K1119001</a>), and we quantitatively characterized their behavior using GFP reporter.
</div>
</div>
</div>
</div>
<div class="row">
<div class="row">
-
<div class="nine columns">
+
<div class="nine columns"><p id="2"></p>
-
<h3>Mechanism of MLS</h3>
+
<h3>Biology of Mitochondrial Leader Sequence (MLS)</h3>
-
MLS is attached to the N-terminal of enzyme, and bind to the receptor protein on mitochondrial membrane, and diffuse to contact site where inner and outer membrane fuse, then bring the ACE enzyme into mitochondria. Afterward, it is be cleaved, leaving the enzyme in mitochondria.
+
<p>In eukaryotes, the signal sequence guides the translocation of the newly synthesized peptide.</p>
 +
<p>The story starts with the MLS attached to the N-terminus of the protein of interest. Once the protein of interest is synthesized, this preprotein would remain unfolded by associating with chaperons. The preprotein will stay in the cytosol until the MLS gets recognized by receptor of the TOM complex on the outer mitochondrial membrane. Binding of the MLS to the receptor will trigger the feeding of the peptide through the translocation channel. Afterwards, the MLS will then be handed over to a TIM complex which sits on the inner membrane, which will then open up the channels on the inner membrane and allow the peptide to pass through. Once the peptide is through the double membranes, mitochondrial chaperone will be involved in pulling the peptide into the mitochondria and refold the protein. Lastly, the MLS will be cleaved by signal peptidase and dissociate from the transported peptide. (Alberts, 2002) <br>For the MLS we used, four additional amino acid residues (Ile-His-Ser-Leu) will be left at the N-terminus of the protein after the cleavage.(Invitrogen, 2012)</p>
 +
<img src="https://static.igem.org/mediawiki/2013/8/87/MLS_mechanism.png" >
</div>
</div>
</div>
</div>
<div class="row">
<div class="row">
-
<div class="nine columns">
+
<div class="nine columns"><p id="3"></p>
-
<h3>Submission of BioBricks</h3>
+
-
The MLS was cloned from a commercial plasmid, pCMV/myc/mito (Invitrogen) by PCR. For the MLS BioBrick, we have submitted the MLS BioBrick in RFC 10 and RFC 25, the Freiburg format which allows protein fusion, to facilitate other team to fuse the MLS with other protein for purpose of introducing other protein into mitochondria.
+
<div class="nine columns"><p id="5"></p>
-
<br><br>
+
<h3>Reference</h3>
-
For characterization, MLS and green fluorescence protein was fused with constitutive mammalian CMV promoter. The promoter was cloned from pEGFP-N1 (Clonetech) in RFC10 format, since such part could not be found in partsregistry. The CMV cloned for our characterization construct was also submitted. The two construct for characterization, the CMV promoter – green fluorescent protein – polyadenylation sequence – pSB1C3 and CMV promoter – mitochondria leader sequence – green fluorescence protein – polyadenylation sequence – pSB1C3 composite parts are also submitted. <a href="https://2013.igem.org/Team:Hong_Kong_HKUST/Parts">Click here to see our submitted parts.</a>
+
Alberts, B., Bray, D., Hopkin, K., Johnson, A., Lewis, J., Raff, M., Roberts, K., & Walter, P. (2010). <i>Essential cell biology.</i> (3rd ed., p. 505). UK: Garland Science.<br><br>
-
</div>
+
pCMV/<i>myc</i>/mito Invitrogen.(2012).pShooter™ Vector(pCMV/<i>myc</i> vectors).Retrieved from http://tools.lifetechnologies.com/content/sfs/manuals/pshooter_pcmv_man.pdf <br><br>
-
</div>
+
-
<div class="row">
+
-
<div class="nine columns">
+
-
<h3>Characterization</h3>
+
-
In order to characterize mitochondria that it can translocate protein into mitochondria in standard BioBrick, we constructed CMV promoter – mitochondria leader sequence – green fluorescent protein – polyadenylation sequence – pSB1C3. We use pCMV/myc/mito.GFP (Invitrogen) as positive control, which include MLS with GFP reporter, and we built negative control, CMV promoter – green fluorescent protein – polyadenylation sequence – pSB1C3 for response without MLS. Characterization was conducted on HEK 293FT cell. If the result shows that GFP is localized in mitochondria while the negative control is scatter all around cell, we can conclude that MLS is targeting GFP into mitochondria in HEK 293FT Cell.
+
-
<br><br>
+
-
Since we could not find a constitutive promoter BioBrick allow expression in mammalian cell, we amplified pCMV from pEGFP-N1 (Clonetech). To characterize this CMV promoter, we used CMV promoter – green fluorescent protein – polyadenylation sequence construct with pEGFP-N1 as positive control and GFP-PolyA in pSB1C3 as negative control. If the result shows that GFP is expressed and scatter around in cell, while negative control shows no GFP signal in cell, we can conclude that CMV is functioning.
+
-
<br><
+
-
<h5><b>Characterization for MLS</b></h5>
+
-
There are three constructs made:<br><br>
+
-
<p style="font-size:13px;"><b>1. CMV-MLS-GFP-PolyA in pSB1C3</b></p>
+
-
<p id="construct"><b>Promoter</b> CMV mammalian promoter to allow expressing the construct in mammalian cell.<br>Forward primer:<br><center>
+
-
[TTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGCTGTGGATAACCGTATTACCGCCATGC]</center><br>
+
-
<p id="construct">Reverse primer:<br><center>[CCTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTACTAGTAGATCTGACGGTTCACTAAACCAGCTCTGC]</center><br><p id="construct">These primers were used to amplify CMV from pEGFP-N1 (Clonetech) in RFC 10 format. Since not enough length is kept after the transcription start site, future user may need to put spacer between the CMV promoter and the part need to be transcribed.
+
-
<br><br>
+
-
<b>Mitochondria Leader Sequence</b> MLS was cloned from pCMV/myc/mito (Invitrogen) using forward primer: <br><center>[GATCATGAATTCGCGGCCGCTTCTAGATGGCCGGCATGTCCGTCCTGACGCCGC]</center><br> <p id="construct">and reverse primer:<br> <center>GATCATCTGCAGCGGCCGCTACTAGTATTAACCGGTCAACGAATGGATCTTGGCGCG]</center><br> <p id="construct">The MLS was cloned with RFC 25 Freiburg standard prefix and suffix to allow doing fusion protein with MLS, to allow trafficking of reporter into mitochondria.<br><br>
+
-
<b>Reporter</b> We use BBa_K648013, the GFP in Freiburg standard as a reporter for MLS, since it allow doing fusion protein by using RFC 25  assembly.
+
-
<br>
+
-
<b>Terminator</b> We use hGH polyadenylation sequence, BBa_K404108, as the terminator.</p><br><br>
+
-
<p style="font-size:13px;"><b>2. CMV-GFP-PolyA in pSB1C3</b></p><p id="construct">Construct without MLS for comparing response brought by MLS.</p>
+
Alberts, B. (2002). <i>Molecular biology of the cell.</i> (4th ed., pp. 1050-1061). New York:Garland Science.
-
 
+
-
<p style="font-size:13px;"><b>3. pCMV/myc/mito.GFP</b></p><p id="construct">Construct of MLS fused with GFP, provided by manufacturer to serve as positive control for MLS.</p>
+
-
 
+
-
<h5><b>Characterization for CMV</b></h5>
+
-
There are three consructs made:
+
-
<br><br>
+
-
<p style="font-size:13px;"><b>1. CMV-GFP-PolyA in pSB1C3</b></p><p id="construct">This construct is for testing CMV functionality by expressing GFP</p>
+
-
<p style="font-size:13px;"><b>2. pEGFP-N1</b></p><p id="construct">Construct for expressing GFP in cell, serve as positive control for GFP expression.</p>
+
-
<p style="font-size:13px;"><b>3. GFP-Poly in pSB1C3</b></p><p id="construct">Construct without CMV for comparing response brought by CMV.</p>
+
<br>
<br>
-
 
-
</div>
 
-
</div>
 
-
<div class="row">
 
-
<div class="nine columns">
 
-
<h3>Staining</h3>
 
-
All of the constructs were transfected into HEK 293FT cell. We stained mitochondria with Mitotracking dye and fixed the cell. Under fluorescence microscope, we could see the position of the mitochondria and the GFP. By merging the image together, we could determine whether MLS is targeting GFP into mitochondria.<br><br>
 
-
 
-
Transfected cell was stained with MitoTracker® Red CMXRos (Invitrogen), a rosamine-based stain, to stain the mitochondria. When they entered live mitochondria, they would be oxidized and bind with peptide to give a fixable fluorescent complex, which can be observed under fluorescence microscope and be retained after fixation.<br><br>
 
-
 
-
The manufacturer’s standard protocol was used with staining solution of final working concentration 200nM, and was incubated for 20 minutes under a humidified atmosphere, containing 5% CO2 at 37 °C during staining.<br>
 
-
 
</div>
</div>
</div>
</div>
</div>
</div>
-
</div>
+
 
</body>
</body>
</html>
</html>

Latest revision as of 12:42, 28 October 2013

Protein Trafficking

Overview

In our project, we introduced bacterial glyoxylate enzymes into mammalian cells to create alternative metabolic pathway. However, unlike their native environment in bacteria, the two enzymes needed to find their way through the high compartmentalized system in order to reach the citric acid cycle where they could act on.
To guide the glyoxylate enzymes into the mitochondria where mammalian citric acid cycle resides, we produced recombinant glyoxylate enzymes by attaching the Mitochondrial Leader Sequence (MLS) to their N-termini.
We have also constructed the MLS in its own into standard BioBricks (BBa_K1119000 & BBa_K1119001), and we quantitatively characterized their behavior using GFP reporter.

Biology of Mitochondrial Leader Sequence (MLS)

In eukaryotes, the signal sequence guides the translocation of the newly synthesized peptide.

The story starts with the MLS attached to the N-terminus of the protein of interest. Once the protein of interest is synthesized, this preprotein would remain unfolded by associating with chaperons. The preprotein will stay in the cytosol until the MLS gets recognized by receptor of the TOM complex on the outer mitochondrial membrane. Binding of the MLS to the receptor will trigger the feeding of the peptide through the translocation channel. Afterwards, the MLS will then be handed over to a TIM complex which sits on the inner membrane, which will then open up the channels on the inner membrane and allow the peptide to pass through. Once the peptide is through the double membranes, mitochondrial chaperone will be involved in pulling the peptide into the mitochondria and refold the protein. Lastly, the MLS will be cleaved by signal peptidase and dissociate from the transported peptide. (Alberts, 2002)
For the MLS we used, four additional amino acid residues (Ile-His-Ser-Leu) will be left at the N-terminus of the protein after the cleavage.(Invitrogen, 2012)

Reference

Alberts, B., Bray, D., Hopkin, K., Johnson, A., Lewis, J., Raff, M., Roberts, K., & Walter, P. (2010). Essential cell biology. (3rd ed., p. 505). UK: Garland Science.

pCMV/myc/mito Invitrogen.(2012).pShooter™ Vector(pCMV/myc vectors).Retrieved from http://tools.lifetechnologies.com/content/sfs/manuals/pshooter_pcmv_man.pdf

Alberts, B. (2002). Molecular biology of the cell. (4th ed., pp. 1050-1061). New York:Garland Science.

Retrieved from "http://2013.igem.org/Team:Hong_Kong_HKUST/Project/module3"