Team:Hong Kong HKUST/Project/module4

From 2013.igem.org

(Difference between revisions)
 
(50 intermediate revisions not shown)
Line 8: Line 8:
$(this).find("ul").stop().fadeToggle(10);
$(this).find("ul").stop().fadeToggle(10);
});
});
 +
});
 +
</script>
 +
<script>
 +
$(document).ready(function(){
 +
 +
// hide #back-top first
 +
$("#back-top").hide();
 +
 +
// fade in #back-top
 +
$(function () {
 +
$(window).scroll(function () {
 +
if ($(this).scrollTop() > 100) {
 +
$('#back-top').fadeIn();
 +
} else {
 +
$('#back-top').fadeOut();
 +
}
 +
});
 +
 +
// scroll body to 0px on click
 +
$('#back-top a').click(function () {
 +
$('body,html').animate({
 +
scrollTop: 0
 +
}, 800);
 +
return false;
 +
});
 +
});
 +
});
});
</script>   
</script>   
Line 42: Line 69:
{visibility:hidden;}
{visibility:hidden;}
#globalWrapper
#globalWrapper
-
{position: relative;font-size:127%;width:100%;margin:0;padding:0;padding-bottom:10px;background-color:#494042;height:2550px;}
+
{position: relative;font-size:127%;width:100%;margin:0;padding:0;padding-bottom:10px;background-color:#494042;height:1650px;}
#content
#content
-
{width: 1000px;border:none;background-color:#ffffff;height:2500px;padding:0px;margin-top:0px;line-height: 1.5em;color: black;}
+
{width:995px;border:none;background-color:#ffffff;height:1600px;padding:0px;margin-top:0px;line-height: 1.5em;color: black;}
#top-section
#top-section
{height:2px;border:none;background-color:#494042;}
{height:2px;border:none;background-color:#494042;}
Line 93: Line 120:
{
{
float:left;
float:left;
-
width:16.667%;
+
width:16.66667%;
}
}
ul.first>li>a:link,ul.first>li>a:visited
ul.first>li>a:link,ul.first>li>a:visited
Line 140: Line 167:
top:141px;
top:141px;
width:100%;
width:100%;
 +
z-index:1;
}
}
-
ul.side-nav {
+
#back-top {
 +
position: fixed;
 +
top: 10%;
 +
right: 2%;
 +
z-index:16;
 +
}
 +
#back-top a {
 +
width: 108px;
 +
display: block;
 +
text-align: center;
 +
font: 11px/100% Arial, Helvetica, sans-serif;
 +
text-transform: uppercase;
 +
text-decoration: none;
 +
color: #bbb;
 +
/* background color transition */
 +
-webkit-transition: 1s;
 +
-moz-transition: 1s;
 +
transition: 1s;
 +
}
 +
#back-top a:hover {
 +
color: #ffffff;
 +
}
 +
 
 +
#back-top span {
 +
width: 65px;
 +
height: 60px;
 +
display: block;
 +
margin-bottom: 7px;
 +
background: #ddd url(up-arrow.png) no-repeat center center;
 +
/* rounded corners */
 +
-webkit-border-radius: 15px;
 +
-moz-border-radius: 15px;
 +
border-radius: 15px;
 +
/* background color transition */
 +
-webkit-transition: 1s;
 +
-moz-transition: 1s;
 +
transition: 1s;
 +
}
 +
#back-top a:hover span {
 +
background-color: #777;margin-top:10px;
 +
}
 +
 
 +
ul.side-nav, ul.side-nav1 {
display: block;
display: block;
list-style: none;
list-style: none;
margin: 0;
margin: 0;
-
padding: 17px 0;
+
padding: 17px 0;font-family:"Trebuchet MS", Helvetica, sans-serif;
}
}
ul.side-nav h6 {
ul.side-nav h6 {
margin: 47px 0px 0px;
margin: 47px 0px 0px;
}
}
-
ul.side-nav li.divider {
+
ul.side-nav1 h6 {
 +
margin: 0px 0px 0px;
 +
}
 +
ul.side-nav li.divider, ul.side-nav1 li.divider {
border-top: 1px solid #ddd;
border-top: 1px solid #ddd;
}
}
 +
.two, .row .two {
.two, .row .two {
width: 16.66667%;
width: 16.66667%;
Line 167: Line 241:
width: 83.33333%;
width: 83.33333%;
top:192px;
top:192px;
-
z-index:-2;
 
}
}
.column, .columns {
.column, .columns {
Line 179: Line 252:
}
}
h1, h2, h4, h5, h6 {
h1, h2, h4, h5, h6 {
-
font-family: 'Bitter', serif;
+
font-family:"Trebuchet MS", Helvetica, sans-serif;
font-weight: normal;
font-weight: normal;
color: #000;
color: #000;
border-bottom: none;
border-bottom: none;
-
h3{font-size:18px;}
+
 
 +
h3{font-size:18px;font-family:"Trebuchet MS", Helvetica, sans-serif;}
h5{margin-left:15px;}
h5{margin-left:15px;}
Line 209: Line 283:
}
}
.nine, .row .nine {
.nine, .row .nine {
-
width: 100%;
+
width: 100%;font-family:"Trebuchet MS", Helvetica, sans-serif;
}
}
[class*="column"] + [class*="column"]:last-child {
[class*="column"] + [class*="column"]:last-child {
Line 220: Line 294:
ul li ul, ul li ol {
ul li ul, ul li ol {
margin-left: 20px;
margin-left: 20px;
-
margin-bottom: 0;
+
margin-bottom: 0;}
-
</style>
+
 +
 +
#iGEM_Logo{
 +
width:100px;
 +
height:80px;
 +
position:absolute;
 +
right:10px;
 +
top:60px;
 +
z-index:+15;
 +
}
 +
#hkust_Logo{
 +
width:60px;
 +
height:80px;
 +
position:absolute;
 +
right:110px;
 +
top:60px;
 +
z-index:+15;
 +
}
 +
</style>
 +
</head>
<body>
<body>
 +
 +
 +
          <a href="https://2013.igem.org/Main_Page"><img id="iGEM_Logo" src="https://static.igem.org/mediawiki/2013/4/46/Igem_qgem_logo.png"></a>
 +
         
 +
 +
<a href="http://www.ust.hk/eng/index.htm"><img id="hkust_Logo" src="https://static.igem.org/mediawiki/2013/5/55/Hkust_logo.gif"></a>
 +
<a href=https://2013.igem.org/Team:Hong_Kong_HKUST><center><div id="kepala" style="height:121px;width:100%;"><img src="https://static.igem.org/mediawiki/igem.org/c/c7/BANNER1_%281%29.png" style="height:121px;width:100%;align:middle;"></div></center></a>
<a href=https://2013.igem.org/Team:Hong_Kong_HKUST><center><div id="kepala" style="height:121px;width:100%;"><img src="https://static.igem.org/mediawiki/igem.org/c/c7/BANNER1_%281%29.png" style="height:121px;width:100%;align:middle;"></div></center></a>
 +
<p id="back-top" style="display:none;">
 +
<a href="#top"><span><img src="http://515alive.com/theme/img/up-arrow.png" style="width:90%;"><br><br>BACK TO TOP</span></a>
 +
</p>
<div id="cover"></div>
<div id="cover"></div>
<div class="menu">
<div class="menu">
Line 236: Line 338:
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/advisors">Advisors</a></li>
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/advisors">Advisors</a></li>
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/instructors">Instructors</a></li>
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/instructors">Instructors</a></li>
 +
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/attribution">Attribution</a></li>
 +
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/acknowledge">Acknowledgement</a></li>
</ul>
</ul>
</li>
</li>
-
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/project">Project</a>
+
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/Project">Project</a>
<ul>
<ul>
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/abstract">Abstract</a></li>
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/abstract">Abstract</a></li>
-
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/modelling">Modelling</a></li>
+
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/modules">Modules Description</a></li>
-
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/characterization">Characterization</a></li>
+
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/data">Data Page</a></li>
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/Parts">Parts</a></li>
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/Parts">Parts</a></li>
-
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/datapage">Data Page</a></li>
+
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/characterization">Characterization</a></li>
-
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/results">Results</a></li>
+
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/results">Result</a></li>
 +
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/future">Future Work</a></li>
</ul>
</ul>
</li>
</li>
Line 252: Line 357:
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/Wetlab">Wetlab</a>
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/Wetlab">Wetlab</a>
<ul>
<ul>
-
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/notebook">notebook</a></li>
+
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/notebook">Notebook</a></li>
-
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/protocols">protocols</a></li>
+
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/protocols">Protocols</a></li>
-
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/safety">safety</a></li>
+
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/safety">Safety</a></li>
 +
 
</ul>
</ul>
</li>
</li>
Line 267: Line 373:
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/hp">Human Practice</a>
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/hp">Human Practice</a>
<ul>
<ul>
-
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/hp/Interviews">Interviews</a></li>
+
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/hp/cp">Country Profile</a></li>
-
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/hp/Presentation">Presentation</a></li>
+
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/hp/blog">Blog</a></li>
-
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/hp/Videos">Videos</a></li>
+
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/hp/interview">Interviews</a></li>
-
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/hp/Article">Article</a></li>
+
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/hp/article/genet">Article</a></li>
 +
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/hp/video">Videos</a></li>
 +
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/hp/presentation">Presentations</a></li>
</ul>
</ul>
</li>
</li>
</ul>
</ul>
-
</div>
+
 
</div>
</div>
       <div class="row">
       <div class="row">
<div class="two columns">
<div class="two columns">
-
<ul class="side-nav">
+
<br>
 +
<ul class="side-nav">
<li>
<li>
-
<h6>Module Four</h6>
+
<h6>Modules</h6>
</li>
</li>
<li class="divider"></li>
<li class="divider"></li>
 +
 +
 +
<li>
 +
Glyoxylate Shunt
 +
<ul><li>
 +
<a href=#1>Overview</a>
 +
</li>
<li>
<li>
-
<a href="https://2013.igem.org/Team:Hong_Kong_HKUST/Wetlab">Overview</a>
+
<a href=#2>Reference</a>
 +
</li></ul>
</li>
</li>
-
 
-
<li>
 
-
<a href=>Construct</a>
 
-
                                                <ul><li>ACEA Construct</li>
 
-
                                                <li>ACEB Construct</li></ul>
 
-
</li>
 
-
<li>
 
-
Protein Expression
 
-
                                </li>
 
<li>
<li>
-
<a href="https://2013.igem.org/Team:Hong_Kong_HKUST/Wetlab">Characterization</a>
+
                                      <a href="https://2013.igem.org/Team:Hong_Kong_HKUST/Project/module3">Protein Trafficking</a>
 +
</li>
</li>
-
+
<li>
-
</ul>
+
<a href="https://2013.igem.org/Team:Hong_Kong_HKUST/Project/module2">FA Sensing Mechanism</a>
 +
</li>
 +
</ul>
</div>
</div>
<div class="ten columns team-bios-container">
<div class="ten columns team-bios-container">
Line 310: Line 421:
</div>
</div>
<div class="row">
<div class="row">
-
<div class="nine columns">
+
<div class="nine columns"><p id="1"></p>
<h3>Overview</h3>
<h3>Overview</h3>
-
Our artificial futile cycle is driven by the expression of two key glyoxylate cycle enzymes. Since mammalian cells lacks genes expressing glyoxylate shunt, we are working to introduce these genes form E. coli and assemble them in a constitutive construct which will allow the expression of prokaryotic gene in eukaryotic cell. In addition to the constitutive system, we will also assemble an inducible construct which will allow tunable gene expression according to the concentration of fatty acid in the medium. We decided to introduce inducible system to prevent fatty acid deficiency in low concentration of plasma fatty acid and facilitate greater fatty acid uptake at a high circulating fatty acid levels. The inducible and constitutive system will be compared in terms of fatty acid uptake rate in a range concentration of fatty acid. 
+
<p>Our artificial futile cycle design is based on the tested findings by Dean et  al, who demonstrated that by introducing the artificial glyoxylate shunt in mouse  liver cells, fatty acid uptake would increase and the mice would acquire resistance against obesity when fed with fatty diet. (Dean, 2009) In essence, we are reproducing their work from scratch but through the use of standard  BioBricks.</p>
<br>
<br>
-
</div>
+
 
-
</div>
+
<center><img src="https://static.igem.org/mediawiki/2013/a/a7/Glyoxylate_pathway.jpg" style="width:100%"></center>
-
<div class="row">
+
 
-
<div class="nine columns">
+
Dean, Jason T. Resistance to Diet-Induced Obesity in Mice with Synthetic Glyoxylate Shunt. 2009. Graphic.  
-
<h3>Construct</h3>
+
-
The two key enzymes of glyoxylate system are isocitrate lyase and malate synthase. These two enzymes are encoded by aceA and aceB genes, respectively. We are assembling aceA and aceB construct in one vector plasmid to minimize the possibility of mosaic expression of isocitrate lyase and malate synthase throughout the cell line. The mosaic expression can be caused by cell transfection with only either aceA-containing plasmid or aceB-containing plasmid. The constitutive system will be fused with  a mammalian constitutive promoter, a mitochondrial leader sequence, a tagging protein and a polyadenylation sequence. Mitochondrial leader sequence is needed for protein translocation to the mitochondria. Tagging protein is essential for detecting the protein expression by means of western blot. Polyadenylation site enhances the gene expression as it is transfected into a mammalian where post-transcription modification exists. aceA and aceB construct will be assembled separately in different plasmid before being combined them into one plasmid.
+
-
<h5><b>ACEA Construct</b></h5>
+
-
<p id="construct"><b>Backbone</b> For ACEA construct, we decided to use a commercial plasmid called pShooter/myc/mito (Invitrogen). The vector is designed for expression in mammalian cell. In addition, the vector already contains mitochondrial leader sequence (MLS), a constitutive CMV promoter, myc tag protein and  polyadenylation site.
+
<br><br>
<br><br>
-
<b>Constitutive Promoter</b> In order for the prokaryotic genes to be expressed in mammalian cell, we need to fuse them with eukaryotic promoter. In order to generate the same result as UCLA team’s experiment, we adhere to their choice of promoter by fusing aceA gene with CMV promoter. Cytomegalovirus (CMV) promoter is a commonly used constitutive promoter to drive protein expression in mammalian cell. <br><br>
+
<p>In Dean et al.&rsquo;s  work, the glyoxylate shunt was achieved by the expression of two key enzymes  from the bacterial glyoxylate cycle, isocitrate lyase (AceA) and malate synthase (AceB). When the two enzymes enter mitochondria in liver cells, isocitrate  lyase will convert a proportion of isocitrate into glyoxylate, which will then  be converted by malate synthase into malate. This process would bypass the pathway  through alpha-ketoglutarate, and therefore, bypassing the ATPs and reducing  equivalent generating steps. (Dean, 2009)</p>
-
<b>Assembly</b> ACEA construct is assembled by extracting out aceA gene from E. coli BW25113 genome. The ligation product was confirmed by digestion check and sequencing.
+
<br>
<br>
-
</p><br>
+
<p>To reproduce  this masterpiece, we would first need to convert every single part into  BioBricks: we cloned out the glyoxylate enzymes genes <em>aceA</em> and <em>aceB</em> from <em>E. coli</em> and assembled them with mitochondrial leader sequence (MLS). The two  translation units were then assembled downstream of mammalian constitutive CMV Promoter and EF-1alpha Promoter respectively. Lastly, the hGH polyA signal  sequence was added to serve as terminator of the construct. These constructs,  when put together, should return the original constitutive glyoxylate shunt.</p>
-
<center><img src="https://static.igem.org/mediawiki/2013/f/f2/Acea.jpg"><br><br><p> Fig. 1 ACEA Construct Plasmid Map</p></center><br>
+
<br>
-
<h5><b>ACEB Construct</b></h5>
+
<p>Yet, in  addition to the constitutive system, we are assembling a fatty acid inducible  construct that allows tunable gene expression according to the concentration of  fatty acid around. We decided to introduce this inducible system to prevent  fatty acid deficiency when the concentration of fatty acid in body is low, hopefully overcoming the foreseeable shortcomings of the original constitutive shunt.</p><br>
-
<p id="construct"><b>Backbone</b> pSB1C3 was used for ACEB construct.  
+
<p>Lastly, the  inducible and constitutive system will be compared in terms of fatty acid  uptake rate in a range concentration of fatty acid and their performances shall  be evaluated.</p>
-
<br><br>
+
-
<b>Constitutive Promoter</b> In consistency with the UCLA’s experiment, we will fuse aceB gene with human elongation factor-1 alpha (EF-1alpha) promoter. EF-1alpha is often useful in conditions where other promoters (such as CMV) have diminished activity or have been silenced. We cloned EF-1alpha from plasmid called iDUET101a (Addgene).<br><br>
+
-
<b> Tag protein</b> We engineered in a FLAG protein tag in the 3’ ends of ACEB by including the sequence in aceB extraction primer<br>
+
-
3’ primer to extract aceB with engineered FLAG tag:
+
-
<center>GATCAT CTCGAG CTTATCGTCGTCATCCTTGTAATC CGCTAACAGGCGGTAG</center><br>
+
-
<p id="construct"><i>[6’ Cap][6’ XhoI restriction site][24’ FLAG protein][25' reverse complementary of 3’ aceB]</i><br><br>
+
-
<b>Mitochondrial Leader Sequence</b> Since pSB1C3backbone does not have any MLS and aceB needs to be translocated to mitochondria to serve glyoxylate shunt, we extract MLS out from pShooter/myc/mito (Invitrogen).<br><br>
+
-
<b>Assembly</b> ACEB construct contain 5 parts that need to be assembled: EF-1alpha promoter, mitochondria leader sequence, aceB protein engineered with FLAG tag, and polyadenylation sequence in pSB1C3 backbone. We tried traditional digestion and ligation to construct ACEB but we found that four segments ligation is hard to be achieved and time-consuming. As an alternative, we used Gibson assembly to assemble four segments at the same time. More details on the Gibson assembly can be viewed in <a href="https://2013.igem.org/Team:Hong_Kong_HKUST/protocol">Protocol</a> page.<br><br></p>
+
-
<center><img src="https://static.igem.org/mediawiki/2013/7/7b/Aceb.jpg"><br><br><p> Fig. 2 ACEB Construct Plasmid Map</p></center><br>
+
-
</p>
+
 +
</div>
</div>
</div>
-
</div>
+
<div class="row">
-
<div class="row">
+
<h3>Reference</h3>
-
<div class="nine columns">
+
<p>Dean Jason T, Tran Linh et al. "Resistance to Diet-Induced Obesity in Mice with Synthetic Glyoxylate Shunt." (2009)</p>
-
<h3>Protein Expression</h3>
+
-
The confirmed ACEA construct of CMV promoter – MLS – aceA protein – myc epitope – polyadenylation  sequence was transfected into HEK 293FT cell line and cultured for 24 hours to allow protein expression. The aceA protein was extracted and western blot was performed with untransfected HEK293FT cells for negative control. Membrane used in blotting is PVDF.  Primary antibody used is monoclonal Anti-c-Myc antibody produced in mouse by Sigma Aldrich (Catalog number: M4439) and anti-mouse-HRP antibody by…..(forgot). Blot is developed by appropriate substrate for five minutes and light film is exposed to the blot with 10 seconds exposure time. A single clear band is visible in the lane containing transfected cells’ protein in contrast to the negative control. Band size is compared to ladder and lies in between 40 kDa and 55 kDa. E. coli isocitrate lyase fused with myc-epitope size is around 49.5 kDa.<br>
+
-
</div>
+
<div class="nine columns"><p id="2"></p>
-
</div>
+
-
<div class="row">
+
-
<div class="nine columns">
+
-
<h3>Characterization</h3>
+
-
According to UCLA‘s experiment, the expressions of aceA and aceB genes in human liver cell increase the fatty acid uptake rate. We planned to characterize aceA and aceB genes by measuring the fatty acid uptake rate and compare with the wild type cell. The initial concentration of fatty acid in the medium is quantified. The decrease in fatty acid concentration of the medium over the time span between the initial and the second quantification would be the fatty acid uptake rate of the system. The fatty acid uptake rate will be measured also in different fatty acid concentration. <br>
+
</div>
</div>

Latest revision as of 12:42, 28 October 2013


Glyoxylate Shunt

Overview

Our artificial futile cycle design is based on the tested findings by Dean et al, who demonstrated that by introducing the artificial glyoxylate shunt in mouse liver cells, fatty acid uptake would increase and the mice would acquire resistance against obesity when fed with fatty diet. (Dean, 2009) In essence, we are reproducing their work from scratch but through the use of standard BioBricks.


Dean, Jason T. Resistance to Diet-Induced Obesity in Mice with Synthetic Glyoxylate Shunt. 2009. Graphic.

In Dean et al.’s work, the glyoxylate shunt was achieved by the expression of two key enzymes from the bacterial glyoxylate cycle, isocitrate lyase (AceA) and malate synthase (AceB). When the two enzymes enter mitochondria in liver cells, isocitrate lyase will convert a proportion of isocitrate into glyoxylate, which will then be converted by malate synthase into malate. This process would bypass the pathway through alpha-ketoglutarate, and therefore, bypassing the ATPs and reducing equivalent generating steps. (Dean, 2009)


To reproduce this masterpiece, we would first need to convert every single part into BioBricks: we cloned out the glyoxylate enzymes genes aceA and aceB from E. coli and assembled them with mitochondrial leader sequence (MLS). The two translation units were then assembled downstream of mammalian constitutive CMV Promoter and EF-1alpha Promoter respectively. Lastly, the hGH polyA signal sequence was added to serve as terminator of the construct. These constructs, when put together, should return the original constitutive glyoxylate shunt.


Yet, in addition to the constitutive system, we are assembling a fatty acid inducible construct that allows tunable gene expression according to the concentration of fatty acid around. We decided to introduce this inducible system to prevent fatty acid deficiency when the concentration of fatty acid in body is low, hopefully overcoming the foreseeable shortcomings of the original constitutive shunt.


Lastly, the inducible and constitutive system will be compared in terms of fatty acid uptake rate in a range concentration of fatty acid and their performances shall be evaluated.

Reference

Dean Jason T, Tran Linh et al. "Resistance to Diet-Induced Obesity in Mice with Synthetic Glyoxylate Shunt." (2009)

Retrieved from "http://2013.igem.org/Team:Hong_Kong_HKUST/Project/module4"