Team:KIT-Kyoto/Notebook/ATF2
From 2013.igem.org
(4 intermediate revisions not shown) | |||
Line 5: | Line 5: | ||
<head> | <head> | ||
</head> | </head> | ||
- | + | </html> | |
<div class="document"> | <div class="document"> | ||
<div id="doc-left"> | <div id="doc-left"> | ||
- | + | {{Template:KIT-Kyoto/menu_note}} | |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
</div> | </div> | ||
- | |||
<div id="doc-right" class="metro"> | <div id="doc-right" class="metro"> | ||
Line 50: | Line 16: | ||
<h2>ATF2</h2> | <h2>ATF2</h2> | ||
- | |||
- | |||
<p class=MsoNormal><b><span lang=EN-US style='font-size:14.0pt'>10th August</span></b></p> | <p class=MsoNormal><b><span lang=EN-US style='font-size:14.0pt'>10th August</span></b></p> | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>We performed PCR | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>We performed PCR | ||
- | to amplify the <span class=MsoSubtleEmphasis><span style='color:black'>ATF2</span></span><span | + | to amplify the <span class=MsoSubtleEmphasis><span style='color:black'><i>ATF2</i></span></span><i><span |
- | style='color:black'> g</span>ene.</span></p> | + | style='color:black'> </span></i><span style='color:black'>g</span>ene.</span></p> |
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>F:3' | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>F:3' | ||
Line 171: | Line 135: | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The PCR product | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The PCR product | ||
with the size (1.6 kb) was verified as <span class=MsoSubtleEmphasis><span | with the size (1.6 kb) was verified as <span class=MsoSubtleEmphasis><span | ||
- | style='color:windowtext'>ATF2.</span></span></span></p> | + | style='color:windowtext'><i>ATF2</i>.</span></span></span></p> |
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The PCR products of | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The PCR products of | ||
- | <span class=MsoSubtleEmphasis><span style='color:windowtext'>ATF2</span></span> | + | <span class=MsoSubtleEmphasis><span style='color:windowtext'><i>ATF2</i></span></span> |
was purified by ethanol precipitation</span></p> | was purified by ethanol precipitation</span></p> | ||
Line 184: | Line 148: | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The PCR product of | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The PCR product of | ||
- | <span class=MsoSubtleEmphasis><span style='color:windowtext'>ATF2</span></span> | + | <span class=MsoSubtleEmphasis><span style='color:windowtext'><i>ATF2</i></span></span> |
were digested with the <span class=MsoSubtleEmphasis><span style='color:windowtext'>Xho</span></span>I.</span></p> | were digested with the <span class=MsoSubtleEmphasis><span style='color:windowtext'>Xho</span></span>I.</span></p> | ||
Line 193: | Line 157: | ||
padding:0mm 5.4pt 0mm 5.4pt;height:17.1pt'> | padding:0mm 5.4pt 0mm 5.4pt;height:17.1pt'> | ||
<p class=MsoNormal><span class=MsoSubtleEmphasis><span lang=EN-US | <p class=MsoNormal><span class=MsoSubtleEmphasis><span lang=EN-US | ||
- | style='font-size:11.0pt;color:windowtext'>ATF2</span></span></p> | + | style='font-size:11.0pt;color:windowtext'><i>ATF2</i></span></span></p> |
</td> | </td> | ||
<td width=61 valign=top style='width:46.1pt;border:solid windowtext 1.0pt; | <td width=61 valign=top style='width:46.1pt;border:solid windowtext 1.0pt; | ||
Line 241: | Line 205: | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>We have repeated | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>We have repeated | ||
the PCR reactions to amplify <span class=MsoSubtleEmphasis><span | the PCR reactions to amplify <span class=MsoSubtleEmphasis><span | ||
- | style='color:windowtext'>ATF2</span></span> under the same conditions as those | + | style='color:windowtext'><i>ATF2</i></span></span> under the same conditions as those |
carried out on 10th, August.</span></p> | carried out on 10th, August.</span></p> | ||
Line 257: | Line 221: | ||
style='font-size:14.0pt'>14th August</span></b></p> | style='font-size:14.0pt'>14th August</span></b></p> | ||
- | <p class=MsoNormal><span style='font-size:11.0pt | + | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>1.</span></p> |
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>PCR reaction was | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>PCR reaction was | ||
Line 271: | Line 235: | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The PCR product | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The PCR product | ||
with the size (1.6 kb) was verified as <span class=MsoSubtleEmphasis><span | with the size (1.6 kb) was verified as <span class=MsoSubtleEmphasis><span | ||
- | style='color:windowtext'>ATF2.</span></span></span></p> | + | style='color:windowtext'><i>ATF2</i>.</span></span></span></p> |
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The PCR products | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The PCR products | ||
- | of <span class=MsoSubtleEmphasis><span style='color:windowtext'>ATF2</span></span> | + | of <span class=MsoSubtleEmphasis><span style='color:windowtext'><i>ATF2</i></span></span> |
was purified by ethanol precipitation.</span></p> | was purified by ethanol precipitation.</span></p> | ||
- | <p class=MsoNormal><span style='font-size:11.0pt | + | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>2.</span></p> |
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The <i>ATF2 </i>gene | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The <i>ATF2 </i>gene | ||
and pET15b were purified by ethanol precipitation.</span></p> | and pET15b were purified by ethanol precipitation.</span></p> | ||
- | <p class=MsoNormal><i><span lang=EN-US style='font-size:11.0pt'>ATF2 </span></i><span | + | <p class=MsoNormal><i><span lang=EN-US style='font-size:11.0pt'><i>ATF2</i> </span></i><span |
lang=EN-US style='font-size:11.0pt'>was digested with the <span | lang=EN-US style='font-size:11.0pt'>was digested with the <span | ||
class=MsoSubtleEmphasis><span style='color:windowtext'>Xho</span></span>I for | class=MsoSubtleEmphasis><span style='color:windowtext'>Xho</span></span>I for | ||
Line 344: | Line 308: | ||
<p class=MsoNormal><span class=MsoSubtleEmphasis><span lang=EN-US | <p class=MsoNormal><span class=MsoSubtleEmphasis><span lang=EN-US | ||
- | style='font-size:11.0pt;color:black'>ATF2</span></span><span lang=EN-US | + | style='font-size:11.0pt;color:black'><i>ATF2</i></span></span><span lang=EN-US |
style='font-size:11.0pt;color:black'> </span><span lang=EN-US style='font-size: | style='font-size:11.0pt;color:black'> </span><span lang=EN-US style='font-size: | ||
11.0pt'>treated ethanol precipitation and pET-15b was digested with the <i>Nco</i>I | 11.0pt'>treated ethanol precipitation and pET-15b was digested with the <i>Nco</i>I | ||
Line 423: | Line 387: | ||
padding:0mm 5.4pt 0mm 5.4pt;height:18.25pt'> | padding:0mm 5.4pt 0mm 5.4pt;height:18.25pt'> | ||
<p class=MsoNormal><span class=MsoSubtleEmphasis><span lang=EN-US | <p class=MsoNormal><span class=MsoSubtleEmphasis><span lang=EN-US | ||
- | style='font-size:11.0pt;color:black'>ATF2</span></span></p> | + | style='font-size:11.0pt;color:black'><i>ATF2</i></span></span></p> |
</td> | </td> | ||
<td width=56 valign=top style='width:42.25pt;border:solid windowtext 1.0pt; | <td width=56 valign=top style='width:42.25pt;border:solid windowtext 1.0pt; | ||
Line 650: | Line 614: | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'><<span | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'><<span | ||
- | class=MsoSubtleEmphasis><span style='color:windowtext'>ATF2</span></span> | + | class=MsoSubtleEmphasis><span style='color:windowtext'>ATF2 </span></span>+ pET15b></span></p> |
- | + | ||
- | + | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>We checked the | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>We checked the | ||
Line 701: | Line 663: | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'> </span></p> | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'> </span></p> | ||
- | <p class=MsoNormal><span style='font-size:11.0pt | + | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>2.</span></p> |
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>PCR products were | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>PCR products were | ||
Line 711: | Line 673: | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The PCR products of | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The PCR products of | ||
- | <span class=MsoSubtleEmphasis><span style='color:windowtext'>ATF2</span></span> | + | <span class=MsoSubtleEmphasis><span style='color:windowtext'><i>ATF2</i></span></span> |
were purified by ethanol precipitation and digested with the following | were purified by ethanol precipitation and digested with the following | ||
composition.</span></p> | composition.</span></p> | ||
Line 772: | Line 734: | ||
padding:0mm 5.4pt 0mm 5.4pt'> | padding:0mm 5.4pt 0mm 5.4pt'> | ||
<p class=MsoNormal><span class=MsoSubtleEmphasis><span lang=EN-US | <p class=MsoNormal><span class=MsoSubtleEmphasis><span lang=EN-US | ||
- | style='font-size:11.0pt;color:black'>ATF2</span></span><span | + | style='font-size:11.0pt;color:black'><i>ATF2</i></span></span><span |
style='font-size:11.0pt;font-family:"MS 明朝","serif";color:black'> </span></p> | style='font-size:11.0pt;font-family:"MS 明朝","serif";color:black'> </span></p> | ||
</td> | </td> | ||
Line 911: | Line 873: | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'> </span></p> | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'> </span></p> | ||
- | |||
- | |||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>It were | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>It were | ||
Line 928: | Line 888: | ||
<p class=MsoNormal><b><span lang=EN-US style='font-size:14.0pt'>22th August</span></b></p> | <p class=MsoNormal><b><span lang=EN-US style='font-size:14.0pt'>22th August</span></b></p> | ||
- | <p class=MsoNormal><b><span style='font-size:11.0pt | + | <p class=MsoNormal><b><span lang=EN-US style='font-size:11.0pt'>I</span></b></p> |
- | <p class=MsoNormal><span style='font-size:11.0pt | + | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>1</span></p> |
<p class=MsoNormal><span class=MsoSubtleEmphasis><span lang=EN-US | <p class=MsoNormal><span class=MsoSubtleEmphasis><span lang=EN-US | ||
- | style='font-size:11.0pt;color:black'>ATF2</span></span><span lang=EN-US | + | style='font-size:11.0pt;color:black'><i>ATF2</i></span></span><span lang=EN-US |
style='font-size:11.0pt;color:black'> </span><span lang=EN-US style='font-size: | style='font-size:11.0pt;color:black'> </span><span lang=EN-US style='font-size: | ||
11.0pt'>gene extracted from the Blue gel was treated ethanol precipitation.</span></p> | 11.0pt'>gene extracted from the Blue gel was treated ethanol precipitation.</span></p> | ||
Line 939: | Line 899: | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'> </span></p> | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'> </span></p> | ||
- | <p class=MsoNormal><span style='font-size:11.0pt | + | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>2</span></p> |
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>Ligation of 2-1 | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>Ligation of 2-1 | ||
Line 948: | Line 908: | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The PCR products of | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The PCR products of | ||
- | <span class=MsoSubtleEmphasis><span style='color:windowtext'>ATF2 </span></span>gene | + | <span class=MsoSubtleEmphasis><span style='color:windowtext'><i>ATF2</i> </span></span>gene |
was purified.</span></p> | was purified.</span></p> | ||
Line 959: | Line 919: | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'> </span></p> | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'> </span></p> | ||
- | <p class=MsoNormal><span style='font-size:11.0pt | + | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>II</span></p> |
- | <p class=MsoNormal><span style='font-size:11.0pt | + | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>1</span></p> |
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>PCR reaction was | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>PCR reaction was | ||
Line 967: | Line 927: | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The PCR products | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The PCR products | ||
- | of <span class=MsoSubtleEmphasis><span style='color:windowtext'>ATF2 </span></span>gene | + | of <span class=MsoSubtleEmphasis><span style='color:windowtext'><i>ATF2</i> </span></span>gene |
was purified.</span></p> | was purified.</span></p> | ||
Line 1,129: | Line 1,089: | ||
padding:0mm 5.4pt 0mm 5.4pt'> | padding:0mm 5.4pt 0mm 5.4pt'> | ||
<p class=MsoNormal><span class=MsoSubtleEmphasis><span lang=EN-US | <p class=MsoNormal><span class=MsoSubtleEmphasis><span lang=EN-US | ||
- | style='font-size:11.0pt;color:black'>ATF2</span></span><span | + | style='font-size:11.0pt;color:black'><i>ATF2</i></span></span><span |
style='font-size:11.0pt;font-family:"MS 明朝","serif"'> </span></p> | style='font-size:11.0pt;font-family:"MS 明朝","serif"'> </span></p> | ||
</td> | </td> | ||
Line 1,176: | Line 1,136: | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'> </span></p> | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'> </span></p> | ||
- | <p class=MsoNormal><span style='font-size:11.0pt | + | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>III</span></p> |
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>PCR reaction was | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>PCR reaction was | ||
Line 1,211: | Line 1,171: | ||
padding:0mm 5.4pt 0mm 5.4pt'> | padding:0mm 5.4pt 0mm 5.4pt'> | ||
<p class=MsoNormal><span class=MsoSubtleEmphasis><span lang=EN-US | <p class=MsoNormal><span class=MsoSubtleEmphasis><span lang=EN-US | ||
- | style='font-size:11.0pt;color:black'>ATF2</span></span><span | + | style='font-size:11.0pt;color:black'><i>ATF2</i></span></span><span |
style='font-size:11.0pt;font-family:"MS 明朝","serif"'> </span></p> | style='font-size:11.0pt;font-family:"MS 明朝","serif"'> </span></p> | ||
</td> | </td> | ||
Line 1,303: | Line 1,263: | ||
<p class=MsoNormal><span class=MsoSubtleEmphasis><span lang=EN-US | <p class=MsoNormal><span class=MsoSubtleEmphasis><span lang=EN-US | ||
- | style='font-size:11.0pt;color:black'>ATF2</span></span><span lang=EN-US | + | style='font-size:11.0pt;color:black'><i>ATF2</i></span></span><span lang=EN-US |
style='font-size:11.0pt'> were extracted from the Blue gel.</span></p> | style='font-size:11.0pt'> were extracted from the Blue gel.</span></p> | ||
<p class=MsoNormal><span class=MsoSubtleEmphasis><span lang=EN-US | <p class=MsoNormal><span class=MsoSubtleEmphasis><span lang=EN-US | ||
- | style='font-size:11.0pt;color:black'>ATF2</span></span><span lang=EN-US | + | style='font-size:11.0pt;color:black'><i>ATF2</i></span></span><span lang=EN-US |
style='font-size:11.0pt;color:black'> </span><span lang=EN-US style='font-size: | style='font-size:11.0pt;color:black'> </span><span lang=EN-US style='font-size: | ||
11.0pt'>extracted from the Blue gel was purified.</span></p> | 11.0pt'>extracted from the Blue gel was purified.</span></p> | ||
Line 1,313: | Line 1,273: | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'> </span></p> | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'> </span></p> | ||
- | <p class=MsoNormal><span style='font-size:11.0pt;font-family:"MS 明朝","serif"'> | + | <p class=MsoNormal><span style='font-size:11.0pt;font-family:"MS 明朝","serif"'>IV</span></p> |
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>PCR reaction was | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>PCR reaction was | ||
Line 1,319: | Line 1,279: | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The PCR products | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The PCR products | ||
- | of <span class=MsoSubtleEmphasis><span style='color:windowtext'>ATF2 </span></span>gene | + | of <span class=MsoSubtleEmphasis><span style='color:windowtext'><i>ATF2</i> </span></span>gene |
was purified.</span></p> | was purified.</span></p> | ||
Line 1,451: | Line 1,411: | ||
<p class=MsoNormal><span lang=EN-US> </span></p> | <p class=MsoNormal><span lang=EN-US> </span></p> | ||
- | <p class=MsoNormal><span style='font-size:11.0pt | + | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>I</span></p> |
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>Sample 1.</span></p> | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>Sample 1.</span></p> | ||
Line 1,464: | Line 1,424: | ||
<p class=MsoNormal><i><span lang=EN-US style='font-size:11.0pt'>ATF2</span></i><span | <p class=MsoNormal><i><span lang=EN-US style='font-size:11.0pt'>ATF2</span></i><span | ||
lang=EN-US style='font-size:11.0pt'> gene (</span><span style='font-size:11.0pt; | lang=EN-US style='font-size:11.0pt'> gene (</span><span style='font-size:11.0pt; | ||
- | font-family:"MS 明朝","serif"'> | + | font-family:"MS 明朝","serif"'>III</span><span lang=EN-US style='font-size:11.0pt'>) |
extracted from the Blue gel was purified by ethanol precipitation.</span></p> | extracted from the Blue gel was purified by ethanol precipitation.</span></p> | ||
Line 1,471: | Line 1,431: | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>PCR reaction was | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>PCR reaction was | ||
- | carried out using the primers | + | carried out using the primers </span></p> |
- | + | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>PCR products were | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>PCR products were | ||
electrophoresed in 1% agarose gel, and several fragments were detected.</span></p> | electrophoresed in 1% agarose gel, and several fragments were detected.</span></p> | ||
- | |||
- | |||
- | |||
- | |||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'> </span></p> | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'> </span></p> | ||
- | <p class=MsoNormal><span style='font-size:11.0pt | + | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>II</span></p> |
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>PCR reaction was | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>PCR reaction was | ||
- | carried out using the primers </span><span style='font-size:11.0pt | + | carried out using the primers </span></p> |
- | + | ||
+ | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>1-1 </span></p> | ||
+ | |||
+ | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>F:3' | ||
+ | TCGGCAATGCACAGTCATGGCCATAGTAGA</span></p> | ||
+ | |||
+ | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>R:5' | ||
+ | TTATTCAATTGGATGAGAAATCACCTTTATGAAATCATGCT</span></p> | ||
+ | |||
+ | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>1-2 </span></p> | ||
+ | |||
+ | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>F:3' | ||
+ | CATCTTGAATTCGATGACTTGATTATGAATAATCAACCA</span></p> | ||
+ | |||
+ | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>R:5' CGATCACTAGTATTAAAGCGACGCAAATTCGCCGATGGTTTG</span></p> | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The PCR products | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The PCR products | ||
of <i>ATF2</i> gene were purified, and digested with <i>Mfe</i> and <i>Eco</i>R</span><span | of <i>ATF2</i> gene were purified, and digested with <i>Mfe</i> and <i>Eco</i>R</span><span | ||
- | style='font-size:11.0pt;font-family:"MS 明朝","serif"'> | + | style='font-size:11.0pt;font-family:"MS 明朝","serif"'>I</span><span lang=EN-US |
style='font-size:11.0pt'>.</span></p> | style='font-size:11.0pt'>.</span></p> | ||
Line 1,501: | Line 1,470: | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>Ligation of 2-1 | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>Ligation of 2-1 | ||
- | and 2-2 | + | and 2-2 was performed using Ligation mix.</span></p> |
- | + | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>PCR reaction was | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>PCR reaction was | ||
- | carried out using the primers </span><span style='font-size:11.0pt | + | carried out using the primers </span></p> |
- | + | ||
+ | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>F:3' CGATCTCTAGATGGAAGATATAGAAGGATACGAACCACAT</span></p> | ||
+ | |||
+ | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>R:5' CGATCACTAGTATTAAAGCGACGCAAATTCGCCGATGGTTTG</span></p> | ||
<p class=MsoNormal><b><span lang=EN-US> </span></b></p> | <p class=MsoNormal><b><span lang=EN-US> </span></b></p> | ||
Line 1,514: | Line 1,485: | ||
<p class=MsoNormal><b><span lang=EN-US style='font-size:14.0pt'>24th August</span></b></p> | <p class=MsoNormal><b><span lang=EN-US style='font-size:14.0pt'>24th August</span></b></p> | ||
- | <p class=MsoNormal><span style='font-size:11.0pt | + | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>I</span></p> |
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>PCR reaction was | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>PCR reaction was | ||
Line 1,538: | Line 1,509: | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The PCR products | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The PCR products | ||
- | of <span class=MsoSubtleEmphasis><span style='color:windowtext'>ATF2 </span></span>gene | + | of <span class=MsoSubtleEmphasis><span style='color:windowtext'><i>ATF2</i> </span></span>gene |
was purified.</span></p> | was purified.</span></p> | ||
Line 1,601: | Line 1,572: | ||
padding:0mm 5.4pt 0mm 5.4pt'> | padding:0mm 5.4pt 0mm 5.4pt'> | ||
<p class=MsoNormal><span class=MsoSubtleEmphasis><span lang=EN-US | <p class=MsoNormal><span class=MsoSubtleEmphasis><span lang=EN-US | ||
- | style='font-size:11.0pt;color:black'>ATF2</span></span><span | + | style='font-size:11.0pt;color:black'><i>ATF2</i></span></span><span |
style='font-size:11.0pt;font-family:"MS 明朝","serif";color:black'> </span></p> | style='font-size:11.0pt;font-family:"MS 明朝","serif";color:black'> </span></p> | ||
</td> | </td> | ||
Line 1,648: | Line 1,619: | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'> </span></p> | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'> </span></p> | ||
- | <p class=MsoNormal><span style='font-size:11.0pt | + | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>II</span></p> |
<p class=MsoNormal><span style='font-size:11.0pt;font-family:"MS 明朝","serif"'>1</span></p> | <p class=MsoNormal><span style='font-size:11.0pt;font-family:"MS 明朝","serif"'>1</span></p> | ||
Line 1,670: | Line 1,641: | ||
padding:0mm 5.4pt 0mm 5.4pt'> | padding:0mm 5.4pt 0mm 5.4pt'> | ||
<p class=MsoNormal><span class=MsoSubtleEmphasis><span lang=EN-US | <p class=MsoNormal><span class=MsoSubtleEmphasis><span lang=EN-US | ||
- | style='font-size:11.0pt;color:black'>ATF2</span></span><span | + | style='font-size:11.0pt;color:black'><i>ATF2</i></span></span><span |
style='font-size:11.0pt;font-family:"MS 明朝","serif"'> </span></p> | style='font-size:11.0pt;font-family:"MS 明朝","serif"'> </span></p> | ||
</td> | </td> | ||
Line 1,774: | Line 1,745: | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'> </span></p> | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'> </span></p> | ||
- | <p class=MsoNormal><span style='font-size:11.0pt | + | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>III</span></p> |
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>1<span | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>1<span | ||
Line 1,783: | Line 1,754: | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The PCR products | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The PCR products | ||
- | of <span class=MsoSubtleEmphasis><span style='color:windowtext'>ATF2 </span></span>gene | + | of <span class=MsoSubtleEmphasis><span style='color:windowtext'><i>ATF2</i> </span></span>gene |
was purified.</span></p> | was purified.</span></p> | ||
Line 1,795: | Line 1,766: | ||
padding:0mm 5.4pt 0mm 5.4pt'> | padding:0mm 5.4pt 0mm 5.4pt'> | ||
<p class=MsoNormal><span class=MsoSubtleEmphasis><span lang=EN-US | <p class=MsoNormal><span class=MsoSubtleEmphasis><span lang=EN-US | ||
- | style='font-size:11.0pt;color:black'>ATF2</span></span><span | + | style='font-size:11.0pt;color:black'><i>ATF2</i></span></span><span |
style='font-size:11.0pt;font-family:"MS 明朝","serif";color:black'> </span></p> | style='font-size:11.0pt;font-family:"MS 明朝","serif";color:black'> </span></p> | ||
</td> | </td> | ||
Line 1,842: | Line 1,813: | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'> </span></p> | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'> </span></p> | ||
- | <p class=MsoNormal><span style='font-size:11.0pt | + | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>IV</span></p> |
<p class=MsoNormal><span style='font-size:11.0pt;font-family:"MS 明朝","serif"'>1</span></p> | <p class=MsoNormal><span style='font-size:11.0pt;font-family:"MS 明朝","serif"'>1</span></p> | ||
Line 1,850: | Line 1,821: | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The PCR products | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The PCR products | ||
- | of <span class=MsoSubtleEmphasis><span style='color:windowtext'>ATF2 </span></span>gene | + | of <span class=MsoSubtleEmphasis><span style='color:windowtext'><i>ATF2</i> </span></span>gene |
was purified.</span></p> | was purified.</span></p> | ||
Line 1,975: | Line 1,946: | ||
<p class=MsoNormal><b><span lang=EN-US style='font-size:14.0pt'>29th August</span></b></p> | <p class=MsoNormal><b><span lang=EN-US style='font-size:14.0pt'>29th August</span></b></p> | ||
- | <p class=MsoNormal><span style='font-size:11.0pt | + | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>I</span></p> |
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>PCR reaction was | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>PCR reaction was | ||
Line 1,988: | Line 1,959: | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'> </span></p> | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'> </span></p> | ||
- | <p class=MsoNormal><span style='font-size:11.0pt | + | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>II</span></p> |
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>PCR reaction was | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>PCR reaction was | ||
Line 2,141: | Line 2,112: | ||
<p class=MsoNormal><b><span lang=EN-US style='font-size:14.0pt'>30th August</span></b></p> | <p class=MsoNormal><b><span lang=EN-US style='font-size:14.0pt'>30th August</span></b></p> | ||
- | <p class=MsoNormal><span style='font-size:11.0pt | + | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>I</span></p> |
- | <p class=MsoNormal><span style='font-size:11.0pt | + | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>1</span></p> |
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>PCR reaction was | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>PCR reaction was | ||
Line 2,273: | Line 2,244: | ||
<p class=MsoNormal><span class=MsoSubtleEmphasis><span lang=EN-US | <p class=MsoNormal><span class=MsoSubtleEmphasis><span lang=EN-US | ||
- | style='font-size:11.0pt;color:windowtext'>ATF2</span></span><span lang=EN-US | + | style='font-size:11.0pt;color:windowtext'><i>ATF2</i></span></span><span lang=EN-US |
style='font-size:11.0pt'> extracted from the Blue gel was purified.</span></p> | style='font-size:11.0pt'> extracted from the Blue gel was purified.</span></p> | ||
Line 2,286: | Line 2,257: | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The PCR products | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The PCR products | ||
- | of <span class=MsoSubtleEmphasis><span style='color:windowtext'>ATF2 </span></span>gene | + | of <span class=MsoSubtleEmphasis><span style='color:windowtext'><i>ATF2</i> </span></span>gene |
was purified.</span></p> | was purified.</span></p> | ||
Line 2,298: | Line 2,269: | ||
padding:0mm 5.4pt 0mm 5.4pt'> | padding:0mm 5.4pt 0mm 5.4pt'> | ||
<p class=MsoNormal><span class=MsoSubtleEmphasis><span lang=EN-US | <p class=MsoNormal><span class=MsoSubtleEmphasis><span lang=EN-US | ||
- | style='font-size:11.0pt;color:black'>ATF2</span></span><span | + | style='font-size:11.0pt;color:black'><i>ATF2</i></span></span><span |
style='font-size:11.0pt;font-family:"MS 明朝","serif";color:black'> </span></p> | style='font-size:11.0pt;font-family:"MS 明朝","serif";color:black'> </span></p> | ||
</td> | </td> | ||
Line 2,341: | Line 2,312: | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The PCR products | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>The PCR products | ||
- | of <span class=MsoSubtleEmphasis><span style='color:windowtext'>ATF2 </span></span>gene | + | of <span class=MsoSubtleEmphasis><span style='color:windowtext'><i>ATF2</i> </span></span>gene |
was purified.</span></p> | was purified.</span></p> | ||
<p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'> </span></p> | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'> </span></p> | ||
- | <p class=MsoNormal><span style='font-size:11.0pt | + | <p class=MsoNormal><span lang=EN-US style='font-size:11.0pt'>II</span></p> |
<p class=MsoNormal><span style='font-size:11.0pt;font-family:"MS 明朝","serif"'>1</span></p> | <p class=MsoNormal><span style='font-size:11.0pt;font-family:"MS 明朝","serif"'>1</span></p> | ||
Line 2,484: | Line 2,455: | ||
<p class=MsoNormal><span class=MsoSubtleEmphasis><span lang=EN-US | <p class=MsoNormal><span class=MsoSubtleEmphasis><span lang=EN-US | ||
- | style='font-size:11.0pt;color:windowtext'>ATF2</span></span><span lang=EN-US | + | style='font-size:11.0pt;color:windowtext'><i>ATF2</i></span></span><span lang=EN-US |
style='font-size:11.0pt'> extracted from the Blue gel was purified.</span></p> | style='font-size:11.0pt'> extracted from the Blue gel was purified.</span></p> | ||
Line 2,570: | Line 2,541: | ||
</div> | </div> | ||
+ | |||
Line 2,575: | Line 2,547: | ||
</div> | </div> | ||
- | |||
- | |||
- |
Latest revision as of 02:26, 28 September 2013
ATF2
10th August
We performed PCR to amplify the ATF2 gene.
F:3' CGATCCCATGGGGATGGAAGATATAGAAGGATACGAACCACA
R:5' CGATCGGATCCAAAAGCGACGCAAATTCGCCGATGGTTTG
Buffer |
50µL |
dNTP |
20µL |
Primer mix |
1µL |
DNA sample |
0.5µL |
KOD-FX |
2µL |
H2O |
26.5µL |
Total |
100µL |
PCR products were electrophoresed in 1% agarose gel.
We detected a DNA band at around 1600bp.
PCR reactions were carried out (total volume was 300µL).
PCR products were electrophoresed in 1% agarose gel.
The PCR product with the size (1.6 kb) was verified as ATF2.
The PCR products of ATF2 was purified by ethanol precipitation
12th August
The PCR product of ATF2 were digested with the XhoI.
ATF2 |
5µL |
Buff |
2µL |
H2O |
12µL |
Xho1 |
1µL |
No DNA was detected.
We have repeated the PCR reactions to amplify ATF2 under the same conditions as those carried out on 10th, August.
14th August
1.
PCR reaction was carried out by using the following primer for pSB1C3.
F:3' CGATCTCTAGATGGAAGATATAGAAGGATACGAACCACAT
R:5' CGATCACTAGTATTAAAGCGACGCAAATTCGCCGATGGTTTG
PCR products were electrophoresed in 1% agarose gel.
The PCR product with the size (1.6 kb) was verified as ATF2.
The PCR products of ATF2 was purified by ethanol precipitation.
2.
The ATF2 gene and pET15b were purified by ethanol precipitation.
<i>ATF2</i> was digested with the XhoI for verification.
ATF2 |
5µL |
Buff |
2µL |
H2O |
12µL |
Xho1 |
1µL |
PCR products were electrophoresed in 1% agarose gel.
The PCR products with the expected size were detected.
ATF2 treated ethanol precipitation and pET-15b was digested with the NcoI and BamHI.
pET-15b |
87µL |
Nco1 |
1µL |
BamH1 |
1µL |
Buff. |
10µL |
BSA |
1µL |
(total 100µL) |
ATF2 |
24µL |
Nco1 |
1µL |
BamH1 |
1µL |
Buff. |
3µL |
BSA |
1µL |
(total 30µL) |
It was electrophoresed in 1% Blue gel.
ATF2 were extracted from the Blue gel.
17th August
pET-15b was digested with the Nco1 and BamH1.
pET-15b |
87µL |
Nco1 |
1µL |
BamH1 |
1µL |
Buff. |
10µL |
BSA |
1µL |
(total 100µL) |
We treated the vector with 1µL BAP for 30 minutes.
It was electrophoresed in 1% Blue gel
ATF2 were extracted from the Blue gel
19th August
The ATF2 gene and pET-15b were purified.
We ligated pET-15b and ATF2.
ATF2 |
5µL |
pET-15b |
5µL |
L.MIX |
10µL |
total 20µL |
After the ligatation, we have transformed them into E.coli cells.
20th August
We got approximately 70 colonies and cultured them furthermore.
21th August
<ATF2 + pET15b>
We checked the insertion of DNA by colony cracking.
We could see correct bands of plasmid DNA only from five samples.
We cultured each transformant in LB liquid medium containing ampicillin.
PCR reaction was carried out using the following primers
1-1
F:3' TCGGCAATGCACAGTCATGGCCATAGTAGA
R:5' TTATTCAATTGGATGAGAAATCACCTTTATGAAATCATGCT
1-2
F:3' CATCTTGAATTCGATGACTTGATTATGAATAATCAACCA
R:5' CGATCACTAGTATTAAAGCGACGCAAATTCGCCGATGGTTTG
2-1
F:3' CGATCTCTAGATGGAAGATATAGAAGGATACGAACCACAT
R:5' CGCAGTCTGCAGGCGCCTTGAGATTTGCGTTCGGCCTAA
2-2
F:3' CGCAGTCTGCAGGCGCCTTGAGATTTGCGTTCGGCCTAA
R:5' ATCATCTTCGTAATCCTTGATGTGAATAGTGC
2.
PCR products were electrophoresed in 1% agarose gel.
The PCR products with the size (1.6 kb) were verified as ATF2.
The PCR products of ATF2 were purified by ethanol precipitation and digested with the following composition.
1-1
ATF2 |
25µL |
Mfe1 |
2µL |
Buff. |
3µL |
Total 30µL |
1-2
ATF2 |
25µL |
EcoR1 |
2µL |
Buff. |
3µL |
Total 30µL |
2-1
ATF2 |
25µL |
Nsi1 |
2µL |
Buff. |
3µL |
Total 30µL |
2-2
ATF2 |
25µL |
Pst1 |
2µL |
Buff. |
3µL |
Total 30µL |
It were electrophoresed in 1% Blue gel
ATF2 were extracted from the Blue gel
22th August
I
1
ATF2 gene extracted from the Blue gel was treated ethanol precipitation.
2
Ligation of 2-1 and 2-2 was performed by using Ligation mix.
1-1 with 1-2 and 2-1 with 2-2
The PCR products of ATF2 gene was purified.
It was electrophoresed in 1% agarose gel.
No DNA was detected.
II
1
PCR reaction was carried out using the primers.
The PCR products of ATF2 gene was purified.
It was digested with the following composition.
1-1
ATF2 |
25µL |
Mfe1 |
2µL |
Buff. |
3µL |
Total 30µL |
1-2
ATF2 |
25µL |
EcoR1 |
2µL |
Buff. |
3µL |
Total 30µL |
2-1
ATF2 |
25µL |
Nsi1 |
2µL |
Buff. |
3µL |
Total 30µL |
2-2
ATF2 |
25µL |
Pst1 |
2µL |
Buff. |
3µL |
Total 30µL |
It was electrophoresed in 1% Blue gel.
Any DNA fragment was not detected.
III
PCR reaction was carried out using the following primers.
1-1
F:3' TCGGCAATGCACAGTCATGGCCATAGTAGA
R:5' TTATTCAATTGGATGAGAAATCACCTTTATGAAATCATGCT
1-2
F:3' CATCTTGAATTCGATGACTTGATTATGAATAATCAACCA
R:5'
The PCR products of ATF2 gene was purified.
It was digested with the following composition.
1-1
ATF2 |
25µL |
Mfe1 |
2µL |
Buff. |
3µL |
Total 30µL |
1-2
ATF2 |
25µL |
EcoR1 |
2µL |
Buff. |
3µL |
Total 30µL |
It were electrophoresed in 1% Blue gel.
ATF2 were extracted from the Blue gel.
ATF2 extracted from the Blue gel was purified.
IV
PCR reaction was carried out using the primer.
The PCR products of ATF2 gene was purified.
It was digested with the following composition.
1-1
ATF2 |
25µL |
Mfe1 |
2µL |
Buff. |
3µL |
Total 30µL |
1-2
ATF2 |
25µL |
EcoR1 |
2µL |
Buff. |
3µL |
Total 30µL |
23th August
The plasmids (d, e, f, I, o) were digested with Nco1 and BamH1.
We applied them to 1% agarose gel electrophoresis and checked them.
Sample d, e, f, i had two bands and we cultured them.
The plasmids (d, e, f, I,) were digested with BsiWI and checked.
We detected the correct size band.
We minipreped and transformed them into BL21(DE3).
I
Sample 1.
ATF2 gene (Ⅳ) extracted from the Blue gel was purified by ethanol precipitation.
Sample 2.
ATF2 gene (III) extracted from the Blue gel was purified by ethanol precipitation.
Ligation of sample 1 and 2 was performed by Ligation mix.
PCR reaction was carried out using the primers
PCR products were electrophoresed in 1% agarose gel, and several fragments were detected.
II
PCR reaction was carried out using the primers
1-1
F:3' TCGGCAATGCACAGTCATGGCCATAGTAGA
R:5' TTATTCAATTGGATGAGAAATCACCTTTATGAAATCATGCT
1-2
F:3' CATCTTGAATTCGATGACTTGATTATGAATAATCAACCA
R:5' CGATCACTAGTATTAAAGCGACGCAAATTCGCCGATGGTTTG
The PCR products of ATF2 gene were purified, and digested with Mfe and EcoRI.
After the digestion, the ATF2 gene was electrophoresed in 1% Blue gel.
The ATF2 genes were extracted from the Blue gel and purified.
Ligation of 2-1 and 2-2 was performed using Ligation mix.
PCR reaction was carried out using the primers
F:3' CGATCTCTAGATGGAAGATATAGAAGGATACGAACCACAT
R:5' CGATCACTAGTATTAAAGCGACGCAAATTCGCCGATGGTTTG
24th August
I
PCR reaction was carried out using the following primers.
2-1
F:3' CGATCTCTAGATGGAAGATATAGAAGGATACGAACCACAT
R:5' CGCAGTCTGCAGGCGCCTTGAGATTTGCGTTCGGCCTAA
2-2
F:3' CGCAGTCTGCAGGCGCCTTGAGATTTGCGTTCGGCCTAA
R:5' ATCATCTTCGTAATCCTTGATGTGAATAGTGC
The PCR products of ATF2 gene was purified.
It was digested with the following composition.
2-1
ATF2 |
25µL |
Nsi1 |
2µL |
Buff. |
3µL |
Total 30µL |
2-2
ATF2 |
25µL |
Pst1 |
2µL |
Buff. |
3µL |
Total 30µL |
It was electrophoresed in 1% Blue gel.
No DNA was detected.
II
1
PCR react ion was carried out using the primer.
The PCR products for ATF2 was treated ethanol precipitation.
It was digested with the following composition.
2-1
ATF2 |
25µL |
Nsi1 |
2µL |
Buff. |
3µL |
Total 30µL |
2-2
ATF2 |
25µL |
Pst1 |
2µL |
Buff. |
3µL |
Total 30µL |
It were electrophoresed in 1% Blue gel.
ATF2 were extracted from the Blue gel.
ATF2 extracted from the Blue gel was purified.
Ligation of 2-1 and 2-2 was performed using Ligation mix.
III
1.
PCR reaction was carried out using the primer.
The PCR products of ATF2 gene was purified.
It was digested with the following composition.
ATF2 |
25µL |
EcoR1 |
2µL |
Buff. |
3µL |
Total 30µL |
It was electrophoresed in 1% agarose gel.
Multiple DNA fragments were detected.
IV
1
PCR reaction was carried out using the primers.
The PCR products of ATF2 gene was purified.
It was digested with the following composition.
ATF2 |
25µL |
EcoR1 |
2µL |
Buff. |
3µL |
Total 30µL |
It was electrophoresed in 1% agarose gel.
Multiple DNA fragments were detected for the DIAP2.
26th August
Cell free extract was prepared and applied to SDS-PAGE to detect ATF2 protein.
27th August
PCR products were electrophoresed in 1% agarose gel.
The PCR products were treated ethanol precipitation.
They were digested.
They were electrophoresed in 1% Blue gel.
ATF2 were extracted from the Blue gel.
ATF2 extracted from the Blue gel was treated ethanol precipitation.
Ligation of 2-1 and 2-2 was performed using Ligation mix.
We purified them.
28th August
The PCR products was treated ethanol precipitation.
PCR reaction was carried out by using the primer.
PCR products were electrophoresed in 1% agarose gel.
No DNA was detected.
We performed PCR, purified, and digested again.
We ligated and purified them.
29th August
I
PCR reaction was carried out using the primer.
PCR products were electrophoresed in 1% agarose gel.
No DNA band was detected.
II
PCR reaction was carried out using the following primers.
2-1
F:3' CGATCTCTAGATGGAAGATATAGAAGGATACGAACCACAT
R:5' CGCAGTCTGCAGGCGCCTTGAGATTTGCGTTCGGCCTAA
2-2
F:3' CGCAGTCTGCAGGCGCCTTGAGATTTGCGTTCGGCCTAA
R:5' ATCATCTTCGTAATCCTTGATGTGAATAGTGC
The PCR products were treated ethanol precipitation.
It was digested with the following composition.
2-1
ATF2 |
25µL |
Nsi1 |
2µL |
Buff. |
3µL |
Total 30µL |
2-2
ATF2 |
25µL |
Pst1 |
2µL |
Buff. |
3µL |
Total 30µL |
It was electrophoresed in 1% Blue gel.
ATF2 were extracted from the Blue gel.
ATF2 extracted from the Blue gel was purified.
We ligated them and purified it.
We performed PCR to amplify it.
Cell free extract was prepared with FastBreak Cell Lysis Reagent and applied to SDS-PAGE.
30th August
I
1
PCR reaction was carried out using the following primers
1-1
F:3' TCGGCAATGCACAGTCATGGCCATAGTAGA
R:5' TTATTCAATTGGATGAGAAATCACCTTTATGAAATCATGCT
1-2
F:3' CATCTTGAATTCGATGACTTGATTATGAATAATCAACCA
R:5'
The PCR products were purfied.
It was digested with the following composition.
2-1
ATF2 |
25µL |
Nsi1 |
2µL |
Buff. |
3µL |
Total 30µL |
2-2
ATF2 |
25µL |
Pst1 |
2µL |
Buff. |
3µL |
Total 30µL |
It were electrophoresed in 1% Blue gel.
ATF2 were extracted from the Blue gel.
ATF2 extracted from the Blue gel was purified.
We ligated them and purified it.
PCR reaction was carried out using the following primers for pSB1C3.
PCR products were electrophoresed in 1% agarose gel.
The PCR products of ATF2 gene was purified.
It was digested with the following composition.
ATF2 |
25µL |
Pst1 |
2µL |
Buff. |
3µL |
Total 30µL |
PCR products were electrophoresed in 1% agarose gel.
The PCR products of ATF2 gene was purified.
II
1
We performed PCR (prepared 8/29).
PCR reaction was carried out using the following primers.
2-1
F:3' CGATCTCTAGATGGAAGATATAGAAGGATACGAACCACAT
R:5' CGCAGTCTGCAGGCGCCTTGAGATTTGCGTTCGGCCTAA
2-2
F:3' CGCAGTCTGCAGGCGCCTTGAGATTTGCGTTCGGCCTAA
R:5' ATCATCTTCGTAATCCTTGATGTGAATAGTGC
The PCR products were purified.
It was digested with the following composition.
2-1
ATF2 |
25µL |
Nsi1 |
2µL |
Buff. |
3µL |
Total 30µL |
2-2
ATF2 |
25µL |
Pst1 |
2µL |
Buff. |
3µL |
Total 30µL |
It was electrophoresed in 1% Blue gel.
ATF2 was extracted from the Blue gel.
ATF2 extracted from the Blue gel was purified.
We ligated it.
We purified it and performed PCR.
2nd September
We purified the mutant of ATF2.
We digested it and cc3 with Xba1 and Spe1.
We electrophoresed and extracted them in and from 1% Blue gel.
We purified them.
We ligated and transformed them into E.coli cells.
4th September
We purified the mutant of ATF2.
Three tubes of pSB1C3 were treated ethanol precipitation
We add 25mL H2O and digested it with Xba1 and Spe1.
We electrophoresed and extracted them in and from 1% Blue gel.
We purified them.
We ligated and transformed them into E.coli cells.
5th September
We did rapid check of the insert by colony cracking (ATF2+pSB1C3).
But we detected no band.
We cultured them for 5 hours and minipreped.
We checked them by electrophoresing but couldn’t see any bands.
So, we thought them failed.
We cultured other sample (ATF2+pSB1C3).