Team:Hong Kong HKUST/experiment/exp4

From 2013.igem.org

(Difference between revisions)
(Created page with "<html> <head> <script src="http://ajax.googleapis.com/ajax/libs/jquery/1.10.2/jquery.min.js"> </script> <script type="text/javascript"> $(document).ready(function(){ $("ul.first...")
 
(22 intermediate revisions not shown)
Line 119: Line 119:
font-size: 14px;
font-size: 14px;
}
}
-
#slide{width:96%;height:auto;background-color:#F4DFC0;margin-top:80px;border:2px solid;
+
#slide{width:96%;height:auto;background-color:#Ffffff;margin-top:80px;border:2px solid;
border-radius:15px;padding-right:10px;margin-left:15px;}
border-radius:15px;padding-right:10px;margin-left:15px;}
.center
.center
Line 146: Line 146:
h3.title{font-size:40px;}
h3.title{font-size:40px;}
#hey{font-size:28px;margin-left:10px;font-family:"Trebuchet MS", Helvetica, sans-serif;}
#hey{font-size:28px;margin-left:10px;font-family:"Trebuchet MS", Helvetica, sans-serif;}
 +
 +
</style>
 +
<style>
 +
.pos_fixed
 +
{
 +
position:fixed;
 +
top:150px;
 +
left:10px;
 +
}
 +
 +
ol.pos_fixed
 +
{
 +
list-style-type:none;
 +
margin:0;
 +
padding:0;
 +
}
 +
.pos_fixed a:link,.pos_fixed a:visited
 +
{
 +
display:block;
 +
font-weight:bold;
 +
color:#494042;
 +
background-color:#35BB91;
 +
width:120px;
 +
text-align:center;
 +
padding:4px;
 +
text-decoration:none;
 +
;
 +
}
 +
.pos_fixed a:hover,.pos_fixed a:active
 +
{
 +
background-color:#35BB91;
 +
}
 +
 +
#iGEM_Logo{
 +
width:100px;
 +
height:80px;
 +
position:absolute;
 +
right:10px;
 +
top:60px;
 +
z-index:+15;
 +
}
 +
#hkust_Logo{
 +
width:60px;
 +
height:80px;
 +
position:absolute;
 +
right:110px;
 +
top:60px;
 +
z-index:+15;
 +
}
</style>
</style>
</head>
</head>
<body>
<body>
 +
     
 +
          <a href="https://2013.igem.org/Main_Page"><img id="iGEM_Logo" src="https://static.igem.org/mediawiki/2013/4/46/Igem_qgem_logo.png"></a>
 +
         
 +
 +
<a href="http://www.ust.hk/eng/index.htm"><img id="hkust_Logo" src="https://static.igem.org/mediawiki/2013/5/55/Hkust_logo.gif"></a>
 +
 +
<ol class="pos_fixed">
 +
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/results">Results</a></li>
 +
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/experiment/exp4">Glyoxylate Shunt</a></li>
 +
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/experiment/exp3">Protein Trafficking</a></li>
 +
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/experiment/exp2">FA Sensing Mechanism</a></il>
 +
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/experiment/exp1">Cell Viability & FA Quantification</a></il>
 +
</ol>
<a href=https://2013.igem.org/Team:Hong_Kong_HKUST><center><div id="kepala"><img src="https://static.igem.org/mediawiki/igem.org/c/c7/BANNER1_%281%29.png" style="height:121px;width:100%;"></div></center></a>
<a href=https://2013.igem.org/Team:Hong_Kong_HKUST><center><div id="kepala"><img src="https://static.igem.org/mediawiki/igem.org/c/c7/BANNER1_%281%29.png" style="height:121px;width:100%;"></div></center></a>
Line 209: Line 271:
</div>
</div>
-
<br><br><br><div id="slide"><center><h3 class="title">Blogging Synthetic Biology</h3></center><br>  
+
<br><br><br><div id="slide"><center><h3 class="title">Glyoxylate Shunt</h3></center><br>  
-
<h3>Introduction</h3>
+
<h1>Overview</h1>
-
<p id="yo">For one of our human practice projects, our team investigated the current development of synthetic biology in some of the Asian countries. While doing research, we found out that synthetic biology is really a new field in science and that is not well-known in Asia. In fact, when some of our members tried to research information about synthetic biology in Cantonese, we could not find any webpages dedicated to share information about synthetic biology for the public in Hong Kong. To address this observation, we have decided to use an easily accessible platform called Google Blogger. This blog will be used as mean to introduce synthetic biology, share our experience and our project, and report current events related to synthetic biology. It will be written in Chinese and English so that most people in Hong Kong can read it easily and pay more attention to this new field in science. By providing holistic and informational blog posts, we aim at raising the public awareness to synthetic biology.</p><br>
+
<p id="yo">Our artificial futile cycle is driven by the expression of two key enzymes in glyoxylate cycle. Since mammalian cells lack genes expressing glyoxylate shunt, we introduce these genes from <i>E. coli</i> and assemble them in a constitutive construct that will allow the expression of prokaryotic gene in eukaryotic cell. In addition to the constitutive system, we will also assemble an inducible construct which will allow tunable gene expression according to the concentration of fatty acid in the medium. We decided to introduce inducible system to prevent fatty acid deficiency in low concentration of plasma fatty acid and facilitate greater fatty acid uptake at a high circulating fatty acid levels. The inducible and constitutive system will be compared in terms of fatty acid uptake rate in a range concentration of fatty acid. </p>
-
<h3>A Sneak Peek of Our Blog</h3><br>
+
 
-
<center><img src="https://static.igem.org/mediawiki/2013/2/2e/Blog-cecilia.png" style="width:90%"></center><br>
+
<h1>Construct</h1>
-
<br>
+
<p id="yo">The two key enzymes of glyoxylate system are isocitrate lyase and malate synthase. These two enzymes are encoded by <i>aceA</i> and <i>aceB</i> genes, respectively. We planned to assemble <i>aceA</i> and <i>aceB</i> construct in one vector plasmid to minimize the possibility of mosaic expression of isocitrate lyase and malate synthase throughout the cell line. The mosaic expression can be caused by cell transfection with only either <i>aceA</i>-containing plasmid or <i>aceB</i>-containing plasmid. The constitutive system will be fused with a mammalian constitutive promoter, a mitochondrial leader sequence, a tagging protein and a polyadenylation sequence. Mitochondrial leader sequence is needed for protein translocation to the mitochondria. Tagging protein is essential for detecting the protein expression by means of western blot. Polyadenylation site enhances the gene expression as it is transfected into a mammalian where post-transcription modification exists. <i>aceA</i> and <i>aceB</i> construct will be assembled separately in different plasmid before being combined into one plasmid.</p>
-
<p id="hey">CLICK <a href="http://synbiohk.blogspot.hk">HERE</a> TO VISIT OUR BLOG! </p>
+
 
 +
<h1>ACEA Construct</h1>
 +
<p id="yo"><b>Backbone</b></p>
 +
<p id="yo">For ACEA construct, we decided to use a commercial plasmid called pShooter/<i>myc</i>/mito (Invitrogen). The vector is designed for expression in mammalian cell. In addition, the vector already contains mitochondrial leader sequence (MLS), a constitutive CMV promoter, Myc tag protein and polyadenylation site. </p>
 +
 
 +
<p id="yo"><b>Constitutive Promoter</b> </p>
 +
<p id="yo">In order for the prokaryotic genes to be expressed in mammalian cell, we need to fuse them with eukaryotic promoter. In order to generate the same result as UCLA team’s experiment, we adhere to their choice of promoter by fusing <i>aceA</i> gene with CMV promoter. Cytomegalovirus (CMV) promoter is a commonly used constitutive promoter to drive protein expression in mammalian cell. </p>
 +
<p id="yo"><b>Assembly </b> </p>
 +
<p id="yo">ACEA construct is assembled by extracting out <i> aceA </i> gene from <i>E. coli</i> BW25113 genome. The ligation product was confirmed by digestion check and sequencing.  
 +
 
 +
<h1>ACEB Construct</h1>
 +
<p id="yo"><b>Backbone pSB1C3 </b> was used for ACEB construct.</p>
 +
 
 +
<p id="yo"><b>Constitutive Promoter</b></p>                 
 +
<p id="yo">In line with the UCLA’s experiment, we will fuse<i> aceB</i> gene with human elongation factor-1 alpha (EF-1alpha) promoter. EF-1alpha promoter is often useful in conditions where other promoters (such as CMV promoter) have diminished activity or have been silenced. We cloned EF-1alpha promoter from plasmid called iDUET101a (Addgene).</p>
 +
 
 +
<p id="yo"><b>Tag protein </b></p>
 +
<p id="yo">We engineered in a FLAG protein tag in the 3’ ends of AceB by including the sequence in <i>aceB</i> extraction primer.
 +
<p id="yo">3’ primer to extract <i>aceB</i> with engineered FLAG tag gene sequence:</p>
 +
<p id="yo">GATCAT CTCGAG CTTATCGTCGTCATCCTTGTAATC CGCTAACAGGCGGTAG</p>
 +
<p id="yo"><i>[6’ Cap][6’ XhoI restriction site][24’ FLAG protein][25' reverse complementary of 3’ aceB]</i></p>
 +
 
 +
<p id="yo"><b>Mitochondrial Leader Sequence </b></p>
 +
<p id="yo">Since pSB1C3 backbone does not have any MLS and <i>aceB</i> needs to be translocated to mitochondria to serve glyoxylate shunt, we extract MLS out from pShooter/<i>myc</i>/mito (Invitrogen).</p>
 +
 
 +
<p id="yo"><b>Assembly</b> </p>
 +
<p id="yo">ACEB construct contain 5 parts that needs to be assembled: EF-1alpha promoter, mitochondria leader sequence, AceB engineered with FLAG tag, and polyadenylation sequence in pSB1C3 backbone. We tried traditional digestion and ligation to construct ACEB but we found that four segments ligation is hard to be achieved and time-consuming. As an alternative, we used Gibson assembly to assemble four segments at the same time. More details on the Gibson assembly can be viewed in <a href="https://2013.igem.org/Team:Hong_Kong_HKUST/protocols">Protocol page</a>.</p>
 +
 
 +
 
</div>
</div>

Latest revision as of 13:06, 28 October 2013

  1. Results
  2. Glyoxylate Shunt
  3. Protein Trafficking
  4. FA Sensing Mechanism
  5. Cell Viability & FA Quantification



Glyoxylate Shunt


Overview

Our artificial futile cycle is driven by the expression of two key enzymes in glyoxylate cycle. Since mammalian cells lack genes expressing glyoxylate shunt, we introduce these genes from E. coli and assemble them in a constitutive construct that will allow the expression of prokaryotic gene in eukaryotic cell. In addition to the constitutive system, we will also assemble an inducible construct which will allow tunable gene expression according to the concentration of fatty acid in the medium. We decided to introduce inducible system to prevent fatty acid deficiency in low concentration of plasma fatty acid and facilitate greater fatty acid uptake at a high circulating fatty acid levels. The inducible and constitutive system will be compared in terms of fatty acid uptake rate in a range concentration of fatty acid.

Construct

The two key enzymes of glyoxylate system are isocitrate lyase and malate synthase. These two enzymes are encoded by aceA and aceB genes, respectively. We planned to assemble aceA and aceB construct in one vector plasmid to minimize the possibility of mosaic expression of isocitrate lyase and malate synthase throughout the cell line. The mosaic expression can be caused by cell transfection with only either aceA-containing plasmid or aceB-containing plasmid. The constitutive system will be fused with a mammalian constitutive promoter, a mitochondrial leader sequence, a tagging protein and a polyadenylation sequence. Mitochondrial leader sequence is needed for protein translocation to the mitochondria. Tagging protein is essential for detecting the protein expression by means of western blot. Polyadenylation site enhances the gene expression as it is transfected into a mammalian where post-transcription modification exists. aceA and aceB construct will be assembled separately in different plasmid before being combined into one plasmid.

ACEA Construct

Backbone

For ACEA construct, we decided to use a commercial plasmid called pShooter/myc/mito (Invitrogen). The vector is designed for expression in mammalian cell. In addition, the vector already contains mitochondrial leader sequence (MLS), a constitutive CMV promoter, Myc tag protein and polyadenylation site.

Constitutive Promoter

In order for the prokaryotic genes to be expressed in mammalian cell, we need to fuse them with eukaryotic promoter. In order to generate the same result as UCLA team’s experiment, we adhere to their choice of promoter by fusing aceA gene with CMV promoter. Cytomegalovirus (CMV) promoter is a commonly used constitutive promoter to drive protein expression in mammalian cell.

Assembly

ACEA construct is assembled by extracting out aceA gene from E. coli BW25113 genome. The ligation product was confirmed by digestion check and sequencing.

ACEB Construct

Backbone pSB1C3 was used for ACEB construct.

Constitutive Promoter

In line with the UCLA’s experiment, we will fuse aceB gene with human elongation factor-1 alpha (EF-1alpha) promoter. EF-1alpha promoter is often useful in conditions where other promoters (such as CMV promoter) have diminished activity or have been silenced. We cloned EF-1alpha promoter from plasmid called iDUET101a (Addgene).

Tag protein

We engineered in a FLAG protein tag in the 3’ ends of AceB by including the sequence in aceB extraction primer.

3’ primer to extract aceB with engineered FLAG tag gene sequence:

GATCAT CTCGAG CTTATCGTCGTCATCCTTGTAATC CGCTAACAGGCGGTAG

[6’ Cap][6’ XhoI restriction site][24’ FLAG protein][25' reverse complementary of 3’ aceB]

Mitochondrial Leader Sequence

Since pSB1C3 backbone does not have any MLS and aceB needs to be translocated to mitochondria to serve glyoxylate shunt, we extract MLS out from pShooter/myc/mito (Invitrogen).

Assembly

ACEB construct contain 5 parts that needs to be assembled: EF-1alpha promoter, mitochondria leader sequence, AceB engineered with FLAG tag, and polyadenylation sequence in pSB1C3 backbone. We tried traditional digestion and ligation to construct ACEB but we found that four segments ligation is hard to be achieved and time-consuming. As an alternative, we used Gibson assembly to assemble four segments at the same time. More details on the Gibson assembly can be viewed in Protocol page.

Retrieved from "http://2013.igem.org/Team:Hong_Kong_HKUST/experiment/exp4"