Team:UNITN-Trento/Protocols

The optimal conditions for the concentration of RBC Taq DNA Polymerase, MgCl2, primers and template DNA will depend on the system being utilized. It may be necessary to determine the optimal conditions for each individual component.

1) Add the following components to a sterile microtube on ice:

Components	Volume	Final Concentration
10X Reaction buffer	5µl	1X
10mM dNTP mix	0.5µl	0.1µm
Primer mix (10µM each)	1µl	0.2µm
Template DNA	0.5⁓10µl	n/a
RBC Taq DNA polymerase (5U/µl)	0.25µl	1.25units
ddH2O	to 50µl	n/a

2) Suggested Reaction Parameters for RBC Taq DNA Polymerase

Segment	Number of cycles	Temperature	Duration
1	1	94°C	1⁓3 minutes
2	25⁓35	94°C (denature) 5 degree lower than Tm of Primer 72°C (extend)	30 seconds⁓1 30 seconds⁓1 minute 1minute/Kbp
3	1	72°C 4°C	7 minutes

3) Analyze the amplification products by agarose gel electrophoresis and visualize by ethidium bromide staining.

External link

Component	50 µl Reaction
Nuclease-free water	to 50 µl
5X Phusion HF or GC Buffer	10 µl
10 mM dNTPs	1 µl
10 µM Forward Primer	2.5 µl
10 µM Reverse Primer	2.5 µl
Template DNA	Variable
DMSO (optional)	(1.5 µl)
Phusion DNA Polymerase	0.5 µl

For the template DNA, use 1 µl (50 ng/ µl) of E.coli genomic DNA.

Set the PCR with the following parameters:

Cycle step	Cycles	Temp [°C]	Time [s]
Initial denaturation	1	98	30
Denaturation	30	98	5-10
Annealing		72	10-30
Extention		72	10-30*kb
Final extention	1	72	5-10 [min]
Hold	1	4	∞

1) Add the following components in a sterile microtube on ice:

Reaction Mix
5x One Taq Buffer	10 µl
Fwd Primer	1 µl
Rev Primer	1 µl
10 mM dNTP's	1 µl
One Taq	0.25 µl
Phusion	0.3 µl
Template DNA	50-100 ng
H20	up to 50 µl

2) Suggested reaction parameters:

Cycle Step	Cycles	Temp [°C]	Time [s]
Inital denaturation	1	94	120
Denaturation	30	94	30
Annealing		60 *	60
Extension		68	60 s/Kbase
Final Extension	1	68	300
Hold	1	4	∞

1. Sample Capture:
   • Add 250 µl of Capture buffer type 3 to the sample.
   • Mix and control that the color is yellow or pale orange.
2. Sample Binding:
   • Transfer the mix in the assembled GFX MicroSpin column and Collection tube.
   • Spin for 30s at 16000*g (⁓13000rpm) and discard the Collection tube.
   • Replace GFX MicroSpin column in the same Collection tube.
3. Wash and Dry:
   • Add 500 µl of Wash buffer type 1.
   • Spin for 30s at 16000*g (⁓13000rpm) and discard the Collection tube.
   • Transfer the GFX MicroSpin column in a clean tube.
4. Eluition:
   • Add 50 µl of distilled water.
   • Incubate for 1 minute at room temperature.
   • Spin for 1 minute at 13000rpm.
   • Retain flowthrough.
   • Quantify the sample at Nanodrop and label it with its concentration.

External protocol
External site

Complete protocol (136kb)
Quik protocol (75kb)

• Transformation Buffer: sterile 10 mM Tris-HCl, pH 7.0, 50 mM CaCl2
• Grow a 50 mL culture in LB at 37 deg C from 1 colony.
• When OD ~ 0.5, collect the cells in a sterile Falcon tube and chill on ice for 10min.
• Centrifuge at 5000 rpm for 10 min at 4 deg C. Discard supernatant.
• Resuspend cells in 15 mL of transformation buffer.
• Chill on ice for 15 min. Spin at 5000 rpm for 10 min at 4 deg C. Discard supernatant.
• Resuspend cells in 4 mL of transformation buffer.

The cells are now ready to be transformed. They can be stored in this state at 4 deg C for under a week.
Alternatively, the competent cells can be aliquoted (200µL), adding glycerol to a final conc of 15% (v/v), and the cells stored at –80 deg C.
Every time you make new competent cells you should check for possible contaminations. Plate an aliquot of the new cells in LB plates + antibiotic (i.e. ampicillin, chloramphenicol, kanamycin). Strains such as DH5a, NEB10b, Novablue, should not grow in the presence of antibiotics.

Competent cells must always stay in ice

• Thaw home made CaCl2 competent cells on ice.
• Add 1µL of DNA to 200µL of competent cells (concentration of DNA stock should be between 50–150 ng/µL).
• Incubate on ice for 30 min.
• Heat shock at 42°C for exactly 2 min.
• Incubate on ice 1 min.
• Add 500-700µL of LB (or SOC) and shake at 37°C for 1 h.
• Plate the cells (use plates with the appropriate antibiotic according to your plasmid).

You can either plate a small amount (200µL) of the cells or more.
You should try a few conditions the first time and then choose the one that gives 30–300 separate colonies.
If few cells are expected: spin down the cells at 2500 rpm, discard supernatant and resuspend in 150–200µL of LB and plate all the cells.

Plates must be labeled as follow:
strain – [resistance] – part – “(plasmid)” – YOUR_NAME – date

For ligation you should increase the amount of DNA to be transformed (see cloning protocol).

• Incubate the plates O/N upside down at 37°C.

!!!Don't plate before four o'clock!!!

Prepare the competence medium as follow:

Competence medium (MC completed)
H2O	1.8 ml
10x MC	200 ul
MgSO4 1M	6.7 ul
trp 1% (for trp - strains)	10 ul

MC 10x
for 100 ml
K2HPO4 3H2O	14.036 g
KH2PO4	5.239 g
Glucose	20 g
Tri-Na Citrate 300 mM	10 ml
Ferric NH4 Citrate	1 ml
Casein Hydrolysate	1 g
K glutamate	2 g
Mix everything in 40-50 ml H2O, then adjust to 100 ml, filter sterilize, freeze at -20 C

Tri-Na Citrate 300mM	8.823 g	in 100 ml H2O
Ferric NH4 citrate	2.2 g	in 100 ml H2O
--> wrap in aluminium foil!!

1. Pick up a nice big colony and drop it in 2 ml of completed MC (1x) (see below);
2. Grow at 37 °C for 5 hours (or more if culture is not really turbid);
3. Mix 400 ul of culture with DNA (usually 1 ug) in fresh tube (i.e. 15 ml tubes losely closed);
4. Grow for additional 2 h at 37 °C;
5. Plate all on selective antibiotic plates, and incubate at 37 °C O/N

External link (registry)

1. Transfer 100 ul of sterile distilled water in an eppendorf;
2. Pick up a colony using a tip and resuspend it in the sterile water;
3. Verify that the glass slide is cleaned and degreased or clean it with 70% alcohol;
4. Transfer 20 ul of bacterial suspension on the slide;
5. Swipe gently bacterial suspension with the aid of a sterile loop to occupy 1-2 cm at the center of the slide;
6. Let dry the slide by evaporation;
7. Cover the central part of the slide with methanol, remove the excess and let it evaporate;
8. Sock the slide in the crystal violet solution for 1 min, wash then with sterile water;
9. Sock the slide in the lugol solution for 1 min, wash then with sterile water;
10. Pour Gram bleach solution on the product for 20-30 s, wash then with sterile water;
11. Sock the slide in the safranin solution for 1 min, wash then with sterile water;
12. Finally let dry the slide and observe it with the microscope.

1. Label the empty eppendorfs that will contain the parts, including antibiotic resistance, part denomination and position (and on which kit).
2. Spot the correct well and label it with a pen.
3. Push a hole with the pin of a micropipette and resuspend the content with 10ul water.
4. When the color is dark red, wait 1 minute.
5. Move the re-suspended part into the correct empty eppendorf.

Complete protocol (180kb)
Quik protocol (72kb)

Prepare the digestion mix as follow:

DNA	500 ng
10X NEB Buffer	2.5 ul
10X BSA	2.5 ul
E1	1 ul
E2	1 ul
H2O	Up to 25 ul

Incubate the reaction mix at 37 °C for 30 min. Disactivate then the enzymes incubating the mix at 80 °C for 20 min. The next step will be the ligation of the digestion products. The raction mix is prepared as follow:

Insert	3 fold excess
Vector	40 ng
10X T4 Ligase Buffer	2 ul
T4 Ligase	1 ul
H2O	Up to 20 ul

Gently mix the reaction and incubate for 30 min at room temperature. Disactivate the enzymes at 80 °C for 20 min. Transorm 10 ul of the reaction in competent cells.

Prepare the reaction mix, you can use the automatic calculator.
Prepare your reaction and incubate at RT for 2 hours. Transform half of the reaction into 200μL of “homemade” competent cells (DH5α, NEB10β, Novablue or other appropriate strains) following a standard transformation protocol. Plate all the cells.

Assemble the digestion mix as follow (check the correct buffer with the Double Digest finder).

	Classic Cloning		Screening
	PCR products	Plasmids
Template	~3-4µg	~2-3µg	~1.0µg
Enzyme 1	2.5µl	1.5µl	1.0µl
Enzyme 2
Buffer (stock 10X)	10µl	5µl	2µl
BSA (stock 10X)	10µl	5µl	2µl
Water	Up to 100µl	Up to 50µl	Up to 20µl

Classic Cloning - for PCR products

Incubate at 37°C overnight. The day after add 1µl of DpnI and incubate at 37°C for 2 hours. Please note that PCR product must be purified before digestion.

Classic Cloning - for plasmids

Incubate at 37°C overnight. The day after add 1µL of phosphatase (CIP or SAP) to the vector and incubate for 2 hours at 37°C.

Biobricks Cloning

Incubate at 37°C for 30 minutes. Then disactivate the enzymes at 80°C for 20 minutes.

Screening

Incubate for 1.5h at 37°C. Run all the digested product on an agarose gel to screen colonies.

---

Double Digest finder

PRIMERS SEQUENCES
Primer Forward	GCCGCTTCTAGAGA AGGAGG AACTACT ATGGCAAAACACCTTTTT	prefix(only Xba1) + RBS + spacer + ATG...	Tm = 66°C
Primer Reverse	CTGCCGGTCTGAAG TAATAA TACTAGTAGCGGCCGCTGCAG	sequence + stop codon + suffix	Tm = 67.5°C

SAMsynthethase gene length = 1155 bp

PCR mix
Solutes	Quantities or Concentration
Template(genome)	1ng/ µl
dNTPs	0.5µl
Primer Forward	1 µl
Primer Reverse	1 µl
Buffer RBC	1X
Phusion polimerase	0.3 µl
RBC Taq polimerase	0.25 µl
Water	up to 50 µl

We have chosen to use RBC for its amplification power and Phusion for its proofreading activity
The program set on the PCR is the following:

PCR Settings
Step	Temperature	Time	Go to
1	94°C	2 min
2	94°C	1 min
3	62.5°C	1 min
4	72°C	1 min 9 s	Go to Step 2 for 30 times
5	72°C	7 min
6	4°C	pause

This protocol is a Phusion PCR using Suffix Forward and Prefix Reverse primers: in this way it is possible to linearize pSB1C3 removing any insert (like RFP,...). Note: it is advisable to perform the PCR at least in triplicates.

PCR mix
Template	50ng (at least 0.50µl)
HF Buffer	10µl
dNTPs	1µl
Primer Fw (suff)	2.5µl
Primer Rv (pref)	2.5µl
Phusion	0.5µl
Water	up to 50µl

Given that pSB1C3 is 2070bp long and that the annealing temperature of the primers used is 58°C, the PCR program to be used is the following:

Step	Temperature	Time	Type	Go to
1	98°C	30sec
2	98°C	10sec	Denaturation
3	58°C	20sec	Annealing
4	72°C	35sec	Extend	Go to step #2 for 30 times
5	72°C	10min
6	4°C	&infinit;

Then run the PCR samples on a 1% agarose gel to verify the success of the reactions (each sample is prepared with 8µl of PCR reaction and 2µl of 6X loading die; 1kb ladder is good).

An overnight culture was diluited 1:100 and grown until O.D.600 reached 0.5. After that, the culture was induced with 5 mM arabinose and placed with a stirrer in a sealed vial (V = 15 ml) with a pierceable septum. The sample was kept for about 4 hours at 37 °C in thermoshaker. After that the sample was connected to the Micro Gas Chromatograph Agilent 3000A endowed with two colums: a Mol Sieve 5A Plot and a Plot U column (see the tables for colums and method specifications).

Column	Lenght	Diameter
Mol Sieve 5A Plot	10 m	0.32 mm
Plot U	8 m	0.32 mm

Method used
t sample	50 °C
t injector	55 °C
t column Mol Sieve 5A Plot	110 °C
t column Plot U	70 °C
p column Mol Sieve 5A Plot	39.16 psi
p column Plot U	21.76 psi
t injection	40 us
t analysis	95 s

A measure was then taken.
In order to estimate how much gas was taken for each measurement using the settings described above, a mass flow meter was connected to the micro GC. During a measurment, a flow of 3 (± 0.15) ml / min was registered. Due to the fact that a measurment lasts 10 s, the withdrawn volume was 0.5 ml.

An overnight culture was diluited 1:100 and grown until O.D.600 reached 0.5. After that, 3 ml of culture induced with 5 mM arabinose was placed with a stirrer in a sealed vial (V = 15 ml) with a pierceable septum. The sample was then connected to the Micro Gas Chromatograph Agilent 3000A endowed with two colums: a Mol Sieve 5A Plot and a Plot U column (see the tables for colums and method specifications).

Column	Lenght	Diameter
Mol Sieve 5A Plot	10 m	0.32 mm
Plot U	8 m	0.32 mm

Method used
t sample	50 °C
t injector	55 °C
t column Mol Sieve 5A Plot	110 °C
t column Plot U	70 °C
p column Mol Sieve 5A Plot	39.16 psi
p column Plot U	21.76 psi
t injection	40 us
t analysis	95 s

A measurment was taken every 45 min / 1 h in order to get an overview of the time course of ethylene production.
In order to estimate how much gas was taken for each measurement using the settings described above, a mass flow meter was connected to the micro GC. During a measurment, a flow of 3 (± 0.15) ml / min was registered. Due to the fact that a measurment lasts 10 s, the withdrawn volume was 0.5 ml.

To test if our system was able to accelerate or to slow down fruit ripening, we designed an ermetically closed jam jar with a rubber hose connector. These jars contained our test-fruit and each one was connected to a flask. The flasks contained 300 ml of induced (or not) culture when its O.D.600 reached 0.8. The flasks contained also a stirrer. The cultures were maintained at 37 °C using a laboratory heating plate connected to a digital thermometer immersed in the culture.
For some days, every morning the culture in the flasks was substituted with a new induced (or not) colture .
Furthermore, canonical jam jars (i.e.: with no connector) were adopted to contain the negative control fruit samples. All the apparatus was put under the chemical hood.

The apparatus.

Sample preparation

To detect if E. coli actually produced Methyl salicilate (MeSA), we tried both qualitative (SNIFF Test) and quantitative (GC-MS) tests.

All the measurement have to start by inocula in the correct antibiotics (CM) of MeSA producing cells and of normal Neb10β in LB without antibiotic as control. The inocula need to be growth O/N at 37°C in agitation. The following day, dilutions 1:100 were done in falcons with fresh LB and the same antibiotic; the cells were growth at 37°C in agitation until O.D.600≈0.6 was reached.

Then the cells were induced by adding Arabinose 5mM by a solution 1 M prepared by dissolving 0,150 g in 1 mL of dH2O. After two hours in some of the samples was added Salicylic Acid 2mM by a solution 1 M obtained by dissolving 0,138 g in 1 mL ethanol 70%. Then the culture were put for other 2 hours at 37°C in agitation waiting for the 4 hours of induction to pass.

The tests could also been in M9 medium because it smells less than LB. To do this, when cells in LB reached an O.D. of 400 they were centrifuged at 4100 rpm for 10 minutes to form a pellet. The supernatant was discarded and they were resuspended in fresh M9 medium with the correct antibiotic. This was done because E.coli cells growth in M9 in much more time than in LB. The cells were therefore induced with Arabinose and after two hours SA was added where needed.

At this point the samples were ready for different test.