"
Team:KIT-Kyoto/Notebook/ATF1/september
From 2013.igem.org
| Line 5: | Line 5: | ||
<head> | <head> | ||
</head> | </head> | ||
| - | + | </html> | |
<div class="document"> | <div class="document"> | ||
<div id="doc-left"> | <div id="doc-left"> | ||
| - | + | {{Template:KIT-Kyoto/menu_note}} | |
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
</div> | </div> | ||
| Line 1,032: | Line 999: | ||
</div> | </div> | ||
| - | |||
| - | |||
Revision as of 08:42, 27 September 2013
ATF1
September 1st
Picked 32 colonies of ATF1 transformants.
September 3rd
Checked the colonies by colony cracking.
No appropriate plasmid DNA was detected.
Digested ATF1 and pET-15b with XhoI and Bpu1102I at 37˚C overnight.
|
ATF1 |
24µL |
|
XhoI |
1µL |
|
Bpu1102I |
1µL |
|
BSA |
1µL |
|
NEB Buffer 2 |
3µL |
|
pET-15b |
33µL |
|
XhoI |
1µL |
|
Bpu1102I |
1µL |
|
BSA |
1µL |
|
NEB Buffer 2 |
4µL |
September 4th
Applied pET-15b and ATF1 to the blue gel electrophoresis.
No pET-15b was detected.
ATF1 was extracted from the blue gel.
September 11th
PCR reaction was carried out using the primer.
(Forward : CGATCCTCGAGTGGCCTGGTATTGTCATCGCGTTG
Reverse : CGATCGCTCAGCAACCAACCAAAGCCGAGGGAGTG)
|
Buffer |
50µL |
|
dNTP |
20µL |
|
Primer mix |
1µL |
|
Genome DNA |
0.5µL |
|
KOD-FX |
2µL |
|
H2O |
26.5µL |
Electrophoresed in 1% agarose gel. Verified as ATF1.
Purified the PCR products of ATF1.
Digested ATF1 and pET-15b with XhoI and Bpu1102I at 37˚C for 2 hours.
|
ATF1 |
15.5µL |
|
XhoI |
1µL |
|
Bpu1102I |
1µL |
|
BSA |
0.5µL |
|
NEB Buffer 2 |
2µL |
Added 1µL of BAP to the solution of pET-15b and incubated it at 37˚C for 30 minutes.
Applied pET-15b and ATF1 to the blue gel electrophoresis.
Isolated and purified them.
Ligated pET-15b and ATF1 and transformed.
September 12th
Picked 32 colonies of ATF1 transformants.
September 13th
Checked the colonies by colony cracking.
Picked up the appropriate colonies and cultured in 3mL LB medium with ampicillin at 37˚C for 5 hours.
Miniprepped plasmid DNA.
Digested plasmid DNA with XhoI and Bpu1102I at 37˚C for 2 hours.
|
ATF1 into pET-15b |
15.5µL |
|
XhoI |
1µL |
|
Bpu1102I |
1µL |
|
BSA |
0.5µL |
|
NEB Buffer 2 |
2µL |
Applied pET-15b to the agarose gel electrophoresis.
No band was detected.
Plasmid DNA was digested with XhoI and Bpu1102I at 37˚C (overnight).
|
ATF1 into pET-15b |
15.5µL |
|
XhoI |
1µL |
|
Bpu1102I |
1µL |
|
BSA |
0.5µL |
|
NEB Buffer 2 |
2µL |
September 14th
ATF1 and pET-15b were applied to electrophoresis to the agarose gel.
No band was detected.
Digested ATF1 and pET-15b with Bpu1102I at 37˚C overnight.
|
ATF1 |
26µL |
|
Bpu1102I |
1µL |
|
Bpu1102I Buffer |
3µL |
|
pET-15b |
26µL |
|
Bpu1102I |
1µL |
|
Bpu1102I Buffer |
3µL |
September 15th
Purified ATF1 and pET-15b.
Digested ATF1 and pET-15b with XhoI.
|
ATF1 |
26µL |
|
XhoI |
1µL |
|
Bpu1102I Buffer |
3µL |
|
pET-15b |
26µL |
|
XhoI |
1µL |
|
Bpu1102I Buffer |
3µL |
pET-15b and ATF1 were applied to electrophoresis in the Blue gel and purified.
Ligated ATF1 and pET-15b and transformed them into E. coli cells.
September 16th
Picked 32 colonies of ATF1 transformants.
September 18th
Checked the colonies by colony cracking.
Picked up the colonies and cultured in 3mL LB medium with ampicillin at 37˚C (overnight).
September 19th
plasmid DNA was purified and digested with XhoI and Bpu1102I at 37˚C for 2 hours.
|
ATF1 into pET-15b |
15.5µL |
|
XhoI |
1µL |
|
Bpu1102I |
1µL |
|
BSA |
0.5µL |
|
NEB Buffer 2 |
2µL |
ATF1 and pET-15b were applied to electrophoresis to the agarose gel.
No band was detected.
Digested ATF1 and pET-15b with XhoI and BlpI.
|
ATF1 |
15.5µL |
|
XhoI |
1µL |
|
BlpI |
1µL |
|
BSA |
0.5µL |
|
Buffer |
2µL |
|
pET-15b |
15.5µL |
|
XhoI |
1µL |
|
BlpI |
1µL |
|
BSA |
0.5µL |
|
Buffer |
2µL |
Added 1µL of BAP to the solution of pET-15b and incubated it at 37˚C for 30 minutes.
Applied pET-15b and ATF1 to the blue gel electrophoresis.
Isolated and purified them.
The ATF1 was ligated with pET-15b, and transformed into E. coli cells.
September 20th
Picked 64 colonies of ATF1 transformants.
September 21st
Checked the colonies by colony cracking.
Picked up colonies and cultured in the LB in 3mL LB medium with ampicillin at 37˚C (overnight).
September 22nd
Miniprepped plasmid DNA and digested it with XhoI and BlpI at 37˚C for 2 hours.
Applied ATF1 into pET-15b to the agarose gel electrophoresis.
No band was detected.
