Team:Uppsala/reporter-genes
From 2013.igem.org
(Difference between revisions)
Line 113: | Line 113: | ||
<div id="main_content"> <!-- Put content here --> | <div id="main_content"> <!-- Put content here --> | ||
+ | <h1 class="main-title-left">Reporter genes</h1> | ||
+ | <img class="symbol-pic" src="https://2013.igem.org/File:Uppsala2013_Reporter_mini.png"> | ||
+ | |||
+ | <div id="clear"></div> | ||
+ | |||
+ | <p>One of the most fundamental parts required in a new chassi is a reporter gene. Unfortunately, some fluorescent proteins do not work well in Lactobacillus, possibly due to lower levels of internal pH in the cytosol. | ||
+ | <br><br> | ||
+ | <p>One popular fluorescent protein that do work is mCherry. We have created a biobricked version of mCherry codon optimized for Lactobacillus reuteri, however it should work well in most species in the Lactobacillus genus. The gene has been modified in accordance with the Freiburgh fusion standard 25.</p> | ||
+ | |||
+ | <h3>Prefix</h3> | ||
+ | <p>gaattccgcggccgcttctagatggccggc...</p> | ||
+ | |||
+ | <h3>Suffix</h3> | ||
+ | <p>... accggttaatactagtagcggccgctgcag</p> | ||
Revision as of 07:24, 29 September 2013
Reporter genes
One of the most fundamental parts required in a new chassi is a reporter gene. Unfortunately, some fluorescent proteins do not work well in Lactobacillus, possibly due to lower levels of internal pH in the cytosol.
One popular fluorescent protein that do work is mCherry. We have created a biobricked version of mCherry codon optimized for Lactobacillus reuteri, however it should work well in most species in the Lactobacillus genus. The gene has been modified in accordance with the Freiburgh fusion standard 25.
Prefix
gaattccgcggccgcttctagatggccggc...
Suffix
... accggttaatactagtagcggccgctgcag