Cloning

During the project, we have built new biobricks for our various modules. We will not go into an overt amount of detail about the process and thus overwhelm you with the sheer number of gels produced since the start of the project as they involve standard, well-known methodology. You can find all about cloning in our dedicated lab book. Instead, we will give you a detailed account of how we constructed, improved and optimised our PHB bioplastic synthesis part, [http://parts.igem.org/Part:BBa_K934001 BBa_K934001]. The initiative for improvement came from the predictions taken from the PHB synthesis metabolic models.

We made two new improved constructs by modifying the native operon:

[http://parts.igem.org/Part:BBa_K1149051 BBa_K1149051] The modellers in the drylab predicted that an increased level of phaB enzyme will increase the amount of PHB produced and therefore we decided to change the native Ralstonia eutropha promoter and RBS to a strong constitutive E.coli promoter and RBS in front of the operon.

[http://parts.igem.org/Part:BBa_K11490?? BBa_K11490??] The second task in the wetlab came from the analysis of the metablic model: we realised that phaA enzyme is not necessary for PHB synthesis if we use 3HB as starting feedstock. Therefore we wanted to take out phaA an construct the phaCB operon for better PHB recycling.

Adding better promoter and RBS

We tested the promoter and RBS we were going to use by cloning them in front of amilCP blue chromoprotein ([http://parts.igem.org/Part:BBa_K1149020 BBa_K1149020]). It was bright blue and we had some fun playing around with it as part of our communication work "E.coli Art".

In order to change the promoter, we designed a forward primer that binds to the beginning of the first gene in the operon and contains a Xba restriction site: Pha_Fw (cgcttctagagatggctactgggaaaggagccg). We used pha_Fw and the suffix primer G1005 primer pain to amplify the insert out of the backbone. The new promoter and RBS were J23104 and B0034 from the biobrick [http://parts.igem.org/Part:BBa_K608002 BBa_K608002] We digested the pSB1C3 backbone with this biobrick with SpeI and PstI.

Summary diagram of construction steps:

We performed DpnI digest on the gel purified PCR product (insert) in order to get rid of any contamination from the original plasmid. We did Alkaline Phosphatase treatment of the backbone to remove terminal phosphates in order to decrease self-ligation of plasmid. We transformed the ligation into NEB5 cells and we grew overnight cultures from single cell colonies. The next day, we purified the plasmids and digested 200 ng of them with Xba and PstI to screen for the right clones:

Colony #8 had the expected 4.2kB insert and therefore we sent this plasmid for sequencing. After having the sequenced it, we submitted the new part to registry as [http://parts.igem.org/Part:BBa_K1149051 BBa_K1149051]. At the sequencing step, we realised that it has double P+RBS since the native P+RBS stayed there in between the new P+RBS and the operon. Anyhow, this hybrid configuration should increase the amount of protein products from the genes in the operon and we are in the process characterizing and testing our new construct. We have identified a clone (from colony #6) that contains the new constitutive promoter and submitted it as [http://parts.igem.org/Part:BBa_K1149052 BBa_K1149052] biobrick. We are testing both the hybrid and normal constitutive constructs for PHB bioplastic production.

The sequences of hybrid and constitutive phaCAB constructs: