Team:Paris Bettencourt/SebaTemplate

From 2013.igem.org

(Difference between revisions)

Revision as of 05:59, 27 October 2013

PROJECT
- OVERVIEW
- DETECT
- TARGET
- INFILTRATE
- SABOTAGE
ACHIEVEMENTS
HUMAN PRACTICE
SAFETY
COLLABORATION
- COLLABORATION
- SENSIGEM
NOTEBOOK
TEAM

@iGEM_Paris

DAY NOTES

Detect

ASDF

Saturday 13^th August

PCR circular and linear, Conjugation of XL-10 (with sSP011), Patches, Digestion M13 backbone, RFP insert, Gel of PCR

PCR circular and linear, 40.5°C, 60° of pSB1A3, pSB1C3

Reagent	Volume
	1x
Nuclease-free water	37.25 ul
5x Phusion HF Buffer	10 ul
10 mM dNTPs	1 ul
Forward Primer (10 uM)	0.5 ul
Reverse Primer (10 uM)	0.5 ul
Template Plasmid	0.25 ul
Phusion DNA Polymerase	0.5 ul
Total Volume	50 ul

Thermocycler Protocol: NEB Phusion
	Temp	Time
Start	98°C	30 sec	Melt

Cycle 1	98°C	5 sec	Melt	35 cycles
Cycle 2	40.5°C / 60°C	25 sec	Anneal
Cycle 3	72°C	5 min	Extend

Finish	72°C	5 min	Extend
Store	10°C	Forever	Store

Conjugation of XL-10 (with sSP011)
1) From O/N cultures Dilute strains 1/100 in LB
2) Wait for OD to reach O,2
3) Prepare tube (in BD tubes) :
- Tube = 0,5mL LB with Strain (sSP011) + 0,5mL LB with Strain (XL-10 Kan)
4) Incubate 2 hours at 37°C (actually not in the shaker, but we accidently kept them in the shaker...)
5) Plate 20ul for mixed tube on LB antiobiotics (Tet, Kan)
6) Incubate overnight at 37°C

Patches
check and make new ones

Digestion M13 backbone, RFP insert
for Backbone (M13mp18 plasmid): 3ug
7,58 ul plasmid (c=395ng/ul)
3 ul EcoRI
3 ul PstI
3ul 10x Fast Digest
13,42 ul H20
incubate for 12 min on 37°
heat inactivation: 80° 5 min
for insert (BBa_J04450): 5ug
31,4 ul plasmid
5 ul EcoRi
5 ul PstI
3,6 ul H20
incubate for 20 min at 37°
heat inactivation: 80° 5min

Gel of PCR (Amp 40.5 circ, lin, Chl 60° lin, circ)
100V, 20 min 1% gel

Detect

ASDF

Sunday 14^th July

Gel of PCR, Gel Extraction, DpnI digest of PCR products and PCR purification

Gel of PCR (Amp 60° circ, lin, Chl 40.5 circ, lin)
100V, 20 min 1% gel

Gel of Digest
100V, 20 min 1% gel

Gel Extraction
Excise the DNA fragment from the agarose gel with a clean, sharp scalpel. Minimize the size of the gel slice by removing extra agarose.
Weigh the gel slice in a colorless tube. Add 3 volumes of Buffer QG to 1 volume of gel (100 mg ~ 100 μl). To help dissolve gel, mix by vortexing the tube every 2–3 min during the incubation. After the gel slice has dissolved completely, check that the color of the mixture is yellow (similar to Buffer QG without dissolved agarose).
Add 1 gel volume of isopropanol to the sample and mix (actually only needed for very small products or very big products)
To bind DNA, apply the sample to the QIAquick column, and centrifuge for 1 min.
Discard flow-through and place QIAquick column back in the same collection tube.
To wash, add 0.75 ml of Buffer PE to QIAquick column and centrifuge for 1 min.
11. Discard the flow-through and centrifuge the QIAquick column for an additional 1 min at 17,900 x g (13,000 rpm). 12. Place QIAquick column into a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 30 μl elution buffer to the center of the QIAquick membrane, let the column stand for 1 min, and then centrifuge for 1 min.

DpnI digest of PCR products:
SPCR4 (40ul) - add 1 ul DpnI
SPCR 7 (150ul) - add 3 ul of DpnI
SPCR8 (60 ul) - add 3 ul of DpnI
SPCR 9 (150ul) - add 3 ul of DpnI
SPCR10 (110ul) - add 3 ul of DpnI
Incubate for 15 min at 37°C

PCR purification
Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through. Place the QIAquick column back into the same tube
To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 50 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.

Detect

ASDF

Monday 15^th July

Plating and control of antibiotic resistance.

We made a 1:1000 dilution of KAN (stand.c) in an LB solid media.

Pouring the plates. Around 20 mL/plate
1. KEIOΔPYR KANR Growth
2. ME1655 KANR No growth

Conclusion :

The KEIOΔPYRF growed as expected. Negative control did not growth.
Plates have KAN antibiotic
KEIO has KAN R.

Detect

ASDF

Tuesday 16^th July

We prepared a colony PCR to send the KAN for sequencing, to know exactly the sequence of the KAN.

KEIOΔMPYRF has a deletion of PYRF to be replaced by KAN
We pitched 4 singles colonies into 50µL of H2O
Boil 5 minutes at 95°C
1,5 µL of this can be used directly for PCR

PCR reaction
Keep all the regents at 4°C while preparing the mixture

Reagent	Volume
JW 182 (10 uM) JW 183 (10 uM) Template DNA Quick-load Tag 2x Master Mix Nuclease free water	0,5 µL 0,5 µL 1,5 µL 12,5 µL 10 µL
Total volume	25 µL

Thermocycler Protocol : NEB Quick-Load

	Temperature	Time
Start Cycle1 Cycle 2 Cycle 3 Finish Store	95°C 95°C 50°C 68°C 68°C 10°C	30 seconds 15 seconds 30 seconds 1 minute/kB 5 minutes Forever	melt melt anneal extend - 35 cycles extend store

Gel electrophoresis

We do it to prove that our colony PCR was successful. We expect a band at about 800 base pairs.
Our gel is 1%, therefore we used 0,5g agarose in 100µL TAE buffer.
As a ladder, we used a 1kB plus gene ruler of fermentor.
We l the gel with 5 µL sample ans we kept the sample at 4°C.

PICTURE

We see that the band are as expected. THis is an indicator that KAN is at the right place. The sequence has then been sent for sequencing

Transformation of PAUC 18 into a NEBΔturbo clearing cells
We are transforming PAUC 18 that consist in a low ORI and ampicillin resistance
We will use commercialized NEB turbo competent cells as well as freshly made chemical competent cells
We did this to check the competency of our fresh competent cells

NOTE : EVERYTHING HAS TO BE KEPT ON ICE AND NO VORTEX

Throw competent cells on ice. Those can be prepared using the CaCl2 protocol
Place 20 µL of cells in a pre-chilled Eppendorf tube
For an intert vector, add 0,5 µL or less to the chilled cells
For a ligation product, add 2-3 µL to the chilled cells
Mix gently by flicking the tube
Chill on ice for 10 minutes - this step is optional but can improve yields when transforming a ligation product
Heat shock at 42°C for 30 seconds
Return on ice for 2 minutes
Add 200µL LB medium and recover the cells by shaking at 37°C
Another rich medium can substitute for the recovery. The recovery time varies with the antibiotic selection
Ampicillin : 15 - 30 minutes

Place out the cells on selective LB
Use glass beads to spread the cells. The volume of cells plated depends on what is being transformed

For an intact vector
High transformation efficiencies are expected. Plating out 10 µL of recovered cells should produce many colonies.

Note : 200 µL is the maximum volume of liquid that an LB plate can absorb
Incubate at 37°C. Transformants should appear within 12 hours

Conclusion
The BL 21 DE3 strain showed IP colonies
For the new NEB turbo cells, we see no colony
The old NEB turbo cells worked fine

Detect

ASDF

Wednesday 17^th of July

PCR purification

We are purifying the colony PCR from yesterday to send it away for sequencing

Procedure
Add 1.1 volume and Binding Buffer
Transfer up to 800 µL. Centrifuge for 30-60 seconds. Descend the flow through
Add 700 µL of washed Buffer. Centrifuge for 30-60 seconds
+ 1 min centrifuge to completely remove any residual wash buffer
Add 50 µL of Elution Buffer to the center of the Gene JT purification column membrane and centrifuge for 1 minute
Discard the Gene JET purification column and store the purified DNA at -20°C.

Detect

ASDF

Thursday 18^th July

Calculating the transformation efficiency for the E.coli NEB and E.coli NNEB strains.

· 20 µL of cell culture was inoculated in 200 µL of LB, where 0.5 µL of DNA sample (?) was added, giving the total volume of 220.5 µL.
· After the heat shock transformation 10 µL of the culture was diluted in 90 µL of LB, giving the 10-1 dilution (d); then 10 µL of this dilution was transferred in 90 µL of LB, giving the 10-2 dilution. 10 µL of each dilution (v) was plated on ampicillin media and left for incubation (24 h, 37 ̊C).

· After incubation, colonies were counted:

	NEB	NNEB
10^-¹	0	433
	0	368
Average	0	400.5
10^-¹	0	62
	0	40
Average	0	51

Obviously, NEB strain was not transformed and only NNEB was included in further calculations.
· The number of the transformed colony forming units per mL of the culture was calculated following the formula: colony number / d*v.

Calculation from the 10-1 dilution: 0.4 * 109 CFU/mL
Calculation from the 10-2 dilution: 0.51 * 109 CFU/mL

· The transformation efficiency was calculated by dividing the number of transformed colony forming units (CFU) by the amount of the DNA used (mDNA).

CFU1 = 0.4 * 109 CFU/mL * 0.22 mL (total V of the transformation culture) = 0.088*109 CFU
CFU2 = 0.51 * 109 CFU/mL * 0.22 mL = 0.1122*109 CFU

The concentration of the DNA solution which was used was 0.323 µg/µL, while the total DNA mass which was added to the transformation culture was: 0.323 µg/µL * 0.5 µL = 0.1615 µg.

So the transformation efficiency, calculated from the 10 times diluted (TE1) and 100 times diluted (TE2) cultures is:

TE1 = CFU1/mDNA = 0.55 * 109 CFU/µg
TE2 = CFU2/mDNA = 0.69 * 109 CFU/µg

TE1 and TE2 are almost the same

Detect

ASDF

Monday 22^nd July

Culture purification by streak plate method and preparing the glycerol stock for the sSP001 (TN 57) and sSP002 (NEC) strains.

Place your note here

Detect

ASDF

Tuesday 23^rd July

Colony PCR

· Strain: Keio ΔpyrF
· Primers: JW182 and JW183
· Amplified region: kanamycine resistance gene

Detect

ASDF

Monday 29^th July

Liquid culture of:
pCOLA DUET (from glycerol stock of Sabotage Group) - 20 ml culture
pSSB1 (from plate) - 5 ml culture
pSSB2 (from plate ) - 5 ml culture

Plating of addgene bacteria containing the plasmids we want:
streak out bacteria from addgene to get single colonies:
pBAC-BA-lacZ
pCRISPR
pCas9
pCRIPSR::rpsL

Detect

ASDF

Tuesday 30^th July

Liquid culture, Miniprep and Glycerol stock

Liquid culture of:
pCOLA DUET (from liquid culture (29.07.13)) - 20 ml culture
pSSB1 (from liquid culture (29.07.13)) - 5ml culture
pSSB2 (from liquid culture (29.07.13)) - 5 ml culture
pBAC-BA-lacZ (from plate ) - 5 ml culture
pCRISPR (from plate ) - 5 ml culture
pCas9 (from plate ) - 5 ml culture
pCRIPSR::rpsL (from plate ) - 5 ml culture
F+ strain - (from glycerol stock Sabotage) - 10 ml culture
Keio Keio delta pyrF (from plate ) - 10 ml culture

Miniprep (pCOLA-DUET = sSP007) using the Thermo Scientific Miniprep Kit

1) Pellet 2x9 ml of liquid culture (4000 rpm, 10 min)
2) Discard supernatant
3) resuspend the cells in 250 µL of resuspension solution
4) add 250 µL of lysis solution, mix by inverting 4-6 times
5) add 350 µL of neutralization solution
4) centrifuge for 5 min
5) transfer supernatant to spin column
6) centrifuge for 1 min
7) discard flow through
8) add 500 µL wash solution and centrifuge for 1 min , discard flow through(repeat this step)
9) centrifuge for 1 min to remove left over liquid
10) transfer the column on a 1.5 ml tube
11) add 50 µL of elution buffer and incubate for 2 min
12) centrifuge for 2 min
13) Nanodrop the concentration and freeze at -20°

pSP001= pCOLA-DUET: 65 ng/ul

Glycerol Stock
from overnight culture of MG1655-pCOLA-DUET (sSP007)
Centrifuge 4000 rpm, 10 minutes,
take out liquid
resuspend cells in 0,5 mL glycerol (60%) , 2 mL LB
freeze in -80°C

Detect

ASDF

Wednesday 31^st July

Conjugation, Miniprep addgene plasmids,Glycerol Stock of addgene plasmids

Conjugation

sSP001, SP002, keio Delta PyrF
F+ comes from XL1 Blue (glycerol stock Sabotage) => F+ is tetR

Protocol :
1) From O/N cultures Dilute strains 1/100 in LB
2) Wait for OD to reach O,2
3) Prepare 4 tubes (in BD tubes) :
- Tube 1 = 0,5 mL LB with Strain 1 (sSP001) ,5 mL LB = control
- Tube 2 = 0,5 mL LB with Strain 2 (sP001) + 0,5 mL LB = control
- Tube 3 = 0,5 mL LB with Strain 3 (keio Delta pyrF) + 0,5 mL LB = control
- Tube 4 = 0,5 mL LB with Strain 4 (XL1) + 0,5 mL LB = control
- Tube 5 = 0,5 mL LB with Strain 1 (sSP001) + 0,5 mL LB with Strain 4 (XL1)
- Tube 6 = 0,5 mL LB with Strain 2 (sSP002) + 0,5 mL LB with Strain 4 (XL1)
- Tube 7 = 0,5 mL LB with Strain 3 (keio Delta pyrF) + 0,5 mL LB with Strain 4 (XL1)
4) Incubate 2 hours at 37°C (actually not in the shaker, but we accidently kept them in the shaker...)
5) Plate 10ul for controls, 100uL, 10ul for mixed tubes on LB antibiotics (Tube 5: Chl + Tet, Tube 6: Chl + Tet, Tube 7: Kan + Tet)
6) Incubate overnight at 37°C

Miniprep addgene plasmids
1) Pellet 4 ml of liquid culture (4000 rpm, 10 min)
2) Discard supernatant
3) resuspend the cells in 250 µL of resuspension solution
4) add 250 µL of lysis solution, mix by inverting 4-6 times
5) add 350 µL of neutralization solution
4) centrifuge for 5 min
5) transfer supernatant to spin column
6) centrifuge for 1 min
7) discard flow through
8) add 500 µL wash solution and centrifuge for 1 min , discard flow through(repeat this step)
9) centrifuge for 1 min to remove leftover liquid
10) transfer the column on a 1.5 ml tube
11) add 50 µL of elution buffer and incubate for 2 min
12) centrifuge for 2 min
13) Nanodrop the concentration and freeze at -20°

See Database for plasmid reference
pCas9:
pCRISPR:
pBac-LacZ:
pCRISPR::rpsL:

Glycerol Stock of addgene plasmids
(see Database for strain reference)
from overnight culture
Centrifuge 4000 rpm, 10 minutes,
take out liquid
resuspend cells in 0,5 mL glycerol (60%) , 2 mL LB
freeze in -80°C

Detect

ASDF

Thursday 1^st August

PCR (gradient + usual) of SPCR1, SPCR7, SPCR8, SPCR10, SPCR9, SPCR4

Reagent	Volume
	1x
Nuclease-free water	37.25 µL
5x Phusion HF Buffer	10 µL
10 mM dNTPs	1 µL
Forward Primer (10 µM)	0.5 µL
Reverse Primer (10 µM)	0.5 µL
Template Plasmid	0.25 µL
Phusion DNA Polymerase	0.5 µL
Total Volume	50 µL

Gradient:
Pos 1: 40°
Pos 2: 40,2°
Pos 3: 41,3°
Pos 4: 43,1°
Pos 5: 45,4°
Pos 6: 48°
Pos 7: 50,7°
Pos 8: 53,5°
Pos 9: 56,0°
Pos 10: 58,1°
Pos 11: 59,8°C
(Pos 12: 60,6°)

Usual PCR: 52°

Detect

ASDF

Friday 2^nd August

Place your twit here

Gels with PCR products: 1% Agar
100V 20 Min
10 min staining in BET

Detect

ASDF

Monday 5^th August

Place your twit here

5ml liquid culture with proper antibiotics of:
SSp001 + F+
sSP002 + F+
keio delta pyrF + F+

Gelelectrophoresis: 1% Agar, 100 V 20 min

Detect

ASDF

Tuesday 6^th August

Liquid cultures of sSP008-sSP0011

Detect

ASDF

Wednesday 7^th August

Glycerol Stock of sSP008-sSP0011, M13 Test, Single Colonies, Liquid cultures, PCR and Transformation

Glycerol Stock of sSP008-sSP0011
Take 1.5ml of ON culture + 500ul Glycerol (60%)
Freeze at -80°C

M13 Test
Plate from ON culture:
1) 1:1000 - sSP012: sSP009 (plate 200ul)
2) 200 ul sSP012
3) 200ul sSp009

Single Colonies
streak out ON culture of sSP012 to get single colonies

Liquid cultures of pir+ E.coli and pKD13 from Jake

PCR of SPCR4, SPCR7, SPCR8, SPCR9, SPCR10 from circuar backbone, directly taken from Biobrick plate

Protocol

Reagent	Volume
	1x
Nuclease-free water	37,25µL
5x Phusion HF Buffer	10µL
10 mM dNTPs	1µL
Forward Primer (10 µM)	0.5µL
Reverse Primer (10 µM)	0.5µL
Template Plasmid	0.25µL
Phusion DNA Polymerase	0.5µL
Total Volume	50µL

Thermocycler Protocol: NEB Phusion
	Temp	Time
Start	98°C	30 sec	Melt

Cycle 1	98°C	5 sec	Melt	35 cycles
Cycle 2	40.5°C / 60°C	25 sec	Anneal
Cycle 3	72°C	30 sec per kb	Extend

Finish	72°C	5 min	Extend
Store	10°C	Forever	Store

Transformation Biobricks BBa_K649304 (with pSB1C3 backbone) and BBa_J04450 (with pSB1A3 backbone) into NEB Turbo (heat shock trafo)

1) Thaw competent cells on ice.
2) Place 20 ul of cells in a pre-chilled Eppendorf tube.
3) Add 2.5 ul of plasmid (from Biobrick stock)
4) Mix gently by flicking the tube.
5) Chill on ice for 10 minutes.
4) Heat shock at 42 °C for 30 seconds
5) Return to ice for 2 minutes.
6) Add 200 ul LB medium and recover the cells by shaking at 37 °C.
Ampicillin: 15-30 minutes
Chloramphenicol: 60-120 minutes
7) Plate out the cells on selective LB (10ul)
8) Incubate at 37 °C. Transformants should appear within 12 hrs.

Result: BBa_J04450: many colonies, BBa_K649304 no colonies, plate rest

Detect

ASDF

Thursday 8^th August

Liquid culture of FR-433 (M13)

Gel of PCR products. 100V 20min 1%

4-7-8-9-10 (40.5°C)- 4-7-8-9-10 (60°C)

Detect

ASDF

Friday 9^th August

Liquid culture, Gel, Trafo of BBa_E1010 (pSB1C3 backbone) into NEB turbo, Glycerol Stock, Making electro competent cells of pir+ E.coli, Transforming pKD13 into pir+ E.coli, Miniprep NEB turbo with BBa-J04450:, Liquid culture and Patch plates.

Liquid culture
1:1000 from liquid: FR-433 (M13), 10 ml
pir+ E.coli: from plate, 25 ml
XL10: from plate 10 ml

Gel: rest of circular backbone PCR product, 1% Agar, 100V, 20 min
SPCR4-7-8-9-10 (40.5) SPCR4-7-8-9-10 (60.5)
Gel picture:
didn’t work

Trafo of BBa_E1010 (pSB1C3 backbone) into NEB turbo
1) Thaw competent cells on ice.
2) Place 20 µl of cells in a pre-chilled Eppendorf tube.
3) Add 2.5 µl of plasmid (from Biobrick stock)
4) Mix gently by flicking the tube.
5) Chill on ice for 10 minutes.
4) Heat shock at 42 °C for 30 seconds
5) Return to ice for 2 minutes.
6) Add 200 µl LB medium and recover the cells by shaking at 37 °C.
Chloramphenicol: 60-120 minutes
7) Plate out the cells on selective LB (10ul)
8) Incubate at 37 °C. Transformants should appear within 12 hrs.

Glycerol Stock FR-433 (M13) -> sSP012
Glycerol Stock pir+ -> sSP013
Glycerol Stock pKD13 -> sSP014
Glycerol Stock NEB turbo with BBa-J04450 -> sSP015
Take 1.5 ml of ON culture + 500ul Glycerol (60%)
Freeze at -80°C

Making electro competent cells of pir+ E.coli
Preparation of Electrocompetent Cells
Note: Competent cells should never be vortexed, as this will cause them to lyse and release salts into the media. Resuspend cells by pipetting up and down with a large pasteur pipet. Once they are chilled, cells should be continuously cold.

1) The night before the transformation, start an overnight culture of cells.
pir+ E.coli
2) The day of the transformation, dilute the cells 100X.
100 ml LB
Grow at 30°C for about 90 minutes.
3) When the cells reach an OD600 of 0.2.
4) Harvest the cells.
When the cells reach an OD600 of between 0.6 and 0.8.
Split the culture into 2x 50 ml falcon tubes, on ice.
Centrifuge at 4 °C for 10 min at 4000 rpm.
5) Wash and combine the cells.
Remove the supernatant.
Resuspend the cells in 2x 25 ml of ice cold water.
Combine the volumes in a single 50 ml falcon tube.
6) Wash the cells 2 more times.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 50 ml of ice cold water.
Repeat.
7) Wash and concentrate the cells for electroporation.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 1-2 ml of ice cold water.
We will use 200 µl of washed cells per transformation.

Transforming pKD13 into pir+ E.coli
1) Prepare BD tubes with a pipette filled with LB at the interior of each tube (pipette supplied with the electroporation cuvette)

2) Test the purity of the electrocompetent cells.
Add 200 ul of washed cells to a cuvette.

3) Mix the cells and DNA in a cuvette.
200 ul of washed cells with 200 ng of PCR product.
Keep the cuvette on ice until just before the electroporation.

4) Preload a pipette with 1 ml of LB.

5) Pulse the cuvette with voltage.
Dry the electrodes with a kimwipe prior to loading.
Use the EC2 setting.

6) Listen for arcing.
A cracking sound means all the cells are dead.
Note the time constant: 5 is good, 5.8 is great.

7) Immediately recover the cells.
Add the 1 ml of preloaded LB and pipet up and down to mix.
Collect 1 ml of cells, some volume is lost in the cuvette.

8) Incubate 2 h at 37 °C with shaking.

9) Plate 100 ul of recovered cells on selective plates.
Use antibiotic appropriate to the part being integrated.
Let the other 900 ul rest overnight at room temperature.

10) Concentrate and plate the remaining cells
Spin down quickly and resuspend in 100 ul LB before plating.

Transformed cells should be incubated at 37 °C.
Colonies should appear 24-48 h after plating.

Miniprep NEB turbo with BBa-J04450:
1) Pellet 2x 9 ml of liquid culture (4000rpm, 10 min)
2) Discard supernatant
3) resuspend the cells in 250 µl of resuspension solution
4) add 250 µl of lysis solution, mix by inverting 4-6 times
5) add 350 µl of neutralization solution
4) centrifuge for 5 min
5) transfer supernatant to spin column
6) centrifuge for 1 min
7) discard flow through
8) add 500 µl wash solution and centrifuge for 1 min , discard flow through(repeat this step)
9) centrifuge for 1 min to remove left over liquid
10) transfer the column on a 1.5 ml tube
11) add 50ul of elution buffer and incubate for 2 min
12) centrifuge for 2 min
13) Nanodrop the concentration and freeze at -20°

J04450: 0ng/ul

Liquid culture of: sSP012
sSP008
sSP009
sSP010
sSP011
sSP001
sSP002
XL-10 = sSP016
sSP017= Litmus

Patch plates of:
sSP010
sSP013
sSP009s
sSP014
sSP012

Detect

ASDF

Saturday 10^th August

Test of M13 and Liquid culture

Test of M13

1) 100 μ l of plating bacteria per tube
2) Prepare tenfold serial dilutions (10-6 to 10-9 ) of the bacteriophage stock in LB
3) Put 10 μ l/ 100 μ l of each dilution to the bacteria
4) Mix the bacteriophage particles with the bacterial culture by vortexing gently.
5) Add 40 μ l of X-gal solution (working conc) and IPTG (working conc) solution to each of the tubes
6) Add 3ml of Agar to each tube and gently vortexing for 3 seconds
7) Pour the mixture onto plates containing LB medium supplemented with 5 mM MgCl2
8) Swirl the plate gently to ensure an even distribution of bacteria and agar.
9) Incubate them at 37°C.

Liquid culture:
E1010
J04550

Detect

ASDF

Sunday 11^th August

Patches of sSP001-sSP008, sSP015-18 and Stress experiment (Plate reader)

Patches of sSP001-sSP008, sSP015-18

Stress experiment (Plate reader)
sSP001, sSP002, sSP010, sSP011, sSP012 (M13)
1:1000 bacteria in M9 Glucose
Mitomycin C concentrations: 3,3*10^-3, 1,6*10°-3, 6,6*10°-4, 3,3*10°-4
Quadruplets of bacteria (+phage), Triplets of MMC

See also pipetting scheme in folder Experiments on Dropbox

On culture of FR-433, XL-10, delta pyrF
1:1000 culture at 30°

Detect

ASDF

Monday 12^th August

Glycerol Stock, Miniprep, M13 plate test, Patches

Glycerol Stock sSP018 - NEB with E1010
sSP017
sSP016
Take 1.5ml of ON culture + 500ul Glycerol (60%)
Freeze at -80°C

Miniprep
E1010
J04450

1) Pellet 2x 2ml of liquid culture (4000rpm, 10 min)
2) Discard supernatant
3) resuspend the cells in 250ul of resuspension olution
4) add 250ul of lysis solution, mix by inverting 4-6 times
5) add 350ul of neutralization solution
4) centrifuge for 5 min
5) transfer supernatant to spin column
6) centrifuge for 1 min
7) discard flow through
8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)
9) centrifuge for 1 min to remove left over liquid
10) transfer the column on a 1.5ml tube
11) add 50ul of elution buffer and incubate for 2 min
12) centrifuge for 2 min
13) Nanodrop the concentration and freeze at -20°

J04450: ng/ul
E1010: ng/ul

M13 plate test
1) 100 μ l of plating bacteria per tube
2) Prepare tenfold serial dilutions (10-6 to 10-9 ) of the bacteriophage stock in LB
3) Put 10 μ l/ 100 μ l of each dilution to the bacteria
4) Mix the bacteriophage particles with the bacterial culture by vortexing gently.
5) Add 40 μ l of X-gal solution (working conc) and IPTG (working conc) solution to each of the tubes
6) Add 3ml of Agar to each tube and gently vortexing for 3 seconds
7) Pour the mixture onto plates containing LB medium supplemented with 5 mM MgCl2
8) Swirl the plate gently to ensure an even distribution of bacteria and agar.
9) Incubate them at 37°C.

Patches
check them and prepare new ones of those that haven’t been done yet

Detect

ASDF

Tuesday 13^th August

PCR circular and linear 40.5°C/ 60°C, Conjugation of XL-10 (with sSP011), Patches, Digestion M13 backbone, RFP insert and Gel of PCR

PCR circular and linear, 40.5°C, 60° of pSB1A3, pSB1C3

Reagent	Volume
	1x
Nuclease-free water	37,25µL
5x Phusion HF Buffer	10µL
10 mM dNTPs	1µL
Forward Primer (10 µM)	0.5µL
Reverse Primer (10 µM)	0.5µL
Template Plasmid	0.25µL
Phusion DNA Polymerase	0.5µL
Total Volume	50µL

Thermocycler Protocol: NEB Phusion
	Temp	Time
Start	98°C	30 sec	Melt

Cycle 1	98°C	5 sec	Melt	35 cycles
Cycle 2	40.5°C / 60°C	25 sec	Anneal
Cycle 3	72°C	30 sec per kb	Extend

Finish	72°C	5 min	Extend
Store	10°C	Forever	Store

Conjugation of XL-10 (with sSP011)
1) From O/N cultures Dilute strains 1/100 in LB
2) Wait for OD to reach O,2
3) Prepare tube (in BD tubes) :
- Tube = 0,5mL LB with Strain (sSP011) + 0,5mL LB with Strain (XL-10 Kan)
4) Incubate 2 hours at 37°C (actually not in the shaker, but we accidently kept them in the shaker...)
5) Plate 20ul for mixed tube on LB antiobiotics (Tet, Kan)
6) Incubate overnight at 37°C

Patches
check and make new ones

Digestion M13 backbone, RFP insert
for Backbone (M13mp18 plasmid): 3ug
7,58 ul plasmid (c=395ng/ul)
3 ul EcoRI
3 ul PstI
3ul 10x Fast Digest
13,42 ul H20
incubate for 12 min on 37°
heat inactivation: 80° 5 min
for insert (BBa_J04450): 5ug
31,4 ul plasmid
5 ul EcoRi
5 ul PstI
3,6 ul H20
incubate for 20 min at 37°
heat inactivation: 80° 5min

Gel of PCR (Amp 40.5 circ, lin, Chl 60° lin, circ)
100V, 20 min 1% gel

Detect

ASDF

Wednesday 14^th August

Gel of PCR, Gel of Digest, Gel Extraction, DpnI digest of PCR products, PCR purification

Gel of PCR (Amp 60° circ, lin, Chl 40.5 circ, lin) 100V, 20 min 1% gel

Gel of Digest
100V, 20 min 1% gel

Gel Extraction
Excise the DNA fragment from the agarose gel with a clean, sharp scalpel. Minimize the size of the gel slice by removing extra agarose.
Weigh the gel slice in a colorless tube. Add 3 volumes of Buffer QG to 1 volume of gel (100 mg ~ 100 μl). To help dissolve gel, mix by vortexing the tube every 2–3 min during the incubation.
After the gel slice has dissolved completely, check that the color of the mixture is yellow (similar to Buffer QG without dissolved agarose).
Add 1 gel volume of isopropanol to the sample and mix (actually only needed for very small products or very big products)
To bind DNA, apply the sample to the QIAquick column, and centrifuge for 1 min.
Discard flow-through and place QIAquick column back in the same collection tube.
To wash, add 0.75 ml of Buffer PE to QIAquick column and centrifuge for 1 min.
11. Discard the flow-through and centrifuge the QIAquick column for an additional 1 min at 17,900 x g (13,000 rpm). 12. Place QIAquick column into a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 30 μl elution buffer to the center of the QIAquick membrane, let the column stand for 1 min, and then centrifuge for 1 min.

DpnI digest of PCR products:
SPCR4 (40ul) - add 1 ul DpnI
SPCR 7 (150ul) - add 3 ul of DpnI
SPCR8 (60 ul) - add 3 ul of DpnI
SPCR 9 (150ul) - add 3 ul of DpnI
SPCR10 (110ul) - add 3 ul of DpnI
Incubate for 15 min at 37°C

PCR purification
Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through. Place the QIAquick column back into the same tube
To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 50 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.

Detect

ASDF

Thursday 15^th August

Liquid cultures

Liquid cultures:
sSp009
sSP012
sSP016
sSp020
Xgal Bacteria from Aude

Detect

ASDF

Friday 16^th August

Liquid M13 Test, Glycerol Stock, Miniprep

Liquid M13 Test

OD (sSP020=XL10 KanR with F+)=0,557
OD (sSP016=XL10 KanR)=0,515
OD (sSP009= delta pyrF with F+)=0,561
OD(sSP012=FR-433=M13)=0,695

Prepare Falcons containing 500ul of each strain, adding 500ul of 10^-6 dilution of FR-433
add 1ul of IPTG and 1ul of Xgal
Incubate at 37° on shaker

Glycerol Stock sSP019 (pir+ E.coli transformed with pKD13)
sSP020 (XL10 KanR with F+)

Miniprep
sSP019
sSP017

1) Pellet 2x 2ml of liquid culture (4000rpm, 10 min)
2) Discard supernatant
3) resuspend the cells in 250ul of resuspension olution
4) add 250ul of lysis solution, mix by inverting 4-6 times
5) add 350ul of neutralization solution
4) centrifuge for 5 min
5) transfer supernatant to spin column
6) centrifuge for 1 min
7) discard flow through
8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)
9) centrifuge for 1 min to remove left over liquid
10) transfer the column on a 1.5ml tube
11) add 50ul of elution buffer and incubate for 2 min
12) centrifuge for 2 min
13) Nanodrop the concentration and freeze at -20°

pKD13: 311ng/ul
Litmus 28i: 93ng/ul

Detect

ASDF

Monday 19^th August

Restreak XL-1 Blue Litmus28i, PCR, PCR purification Backbone (M13mp18), Ligation (RFP into M13mp18 backbone), Trafo of Ligation product (RFP in M13mp18 plasmid) into NEB turbo and Test Xgal

Restreak XL-1 Blue Litmus28i

PCR

SPCR5, SPCR6, 49,3°C

Reagent	Volume
	1x
Nuclease-free water	37,25µL
5x Phusion HF Buffer	10µL
10 mM dNTPs	1µL
Forward Primer (10 µM)	0.5µL
Reverse Primer (10 µM)	0.5µL
Template Plasmid	0.25µL
Phusion DNA Polymerase	0.5µL
Total Volume	50µL

Thermocycler Protocol: NEB Phusion
	Temp	Time
Start	98°C	30 sec	Melt

Cycle 1	98°C	5 sec	Melt	35 cycles
Cycle 2	40.5°C / 60°C	25 sec	Anneal
Cycle 3	72°C	30 sec per kb	Extend

Finish	72°C	5 min	Extend
Store	10°C	Forever	Store

PCR purification Backbone (M13mp18)
Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through. Place the QIAquick column back into the same tube
To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 50 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.

Ligation (RFP into M13mp18 backbone)
3ul Backbone
14 ul Insert
2ul 10x T4 DNA Ligase HC Buffer
1 ul T4 DNA Ligase

Incubate for at least 10min at 22°C

Trafo of Ligation product (RFP in M13mp18 plasmid) into NEB turbo
1) Thaw competent cells on ice.
2) Place 20 ul of cells in a pre-chilled Eppendorf tube.
3) Add 3 ul of plasmid (from Biobrick stock)
4) Mix gently by flicking the tube.
5) Chill on ice for 10 minutes.
4) Heat shock at 42 °C for 30 seconds
5) Return to ice for 2 minutes.
6) Add 200 ul LB medium and recover the cells by shaking at 37 °C.
7) Plate out the cells on LB (200ul)
8. Incubate at 37 °C. Transformants should appear within 12 hrs.

Test Xgal
3ml of Liquid culture with
1) Xgal from iGEM 2012 (Jake) (+IPTG)
2) Xgal from last week (in DMF) (+IPTG)

Detect

ASDF

Tuesday 20^th August

Gel of PCR and Xgal Test

Gel of PCR

1%, 100V, 20min

Result: PCR didn’t work

Xgal Test

MG1655 (of Jake) in liquid culture with Xgal of iGEM 2012, Aude and new one (Anne)

Result:
All cultures turn blue (Aude, less blue)

Detect

ASDF

Wednesday 21^st August

Gradient PCR SPCR5, SPCR6, M13 Test, Electrocompetent Cells (sSP017-XL-1 Blue, Litmus 28i), Transformation

Gradient PCR SPCR5, SPCR6

Reagent	Volume
	1x
Nuclease-free water	37,25µL
5x Phusion HF Buffer	10µL
10 mM dNTPs	1µL
Forward Primer (10 µM)	0.5µL
Reverse Primer (10 µM)	0.5µL
Template Plasmid	0.25µL
Phusion DNA Polymerase	0.5µL
Total Volume	50µL

Gradient:
Pos 1: 40.1°
Pos 2: 40,8°
Pos 3: 42.2°
Pos 4: 44.2°
Pos 5: 46.7°
Pos 6: 49.4°
Pos 7: 52.1°
Pos 8: 54.7°
Pos 9: 57.1°
Pos 10: 59.0°
Pos 11: 60.2°C

M13 Test
Liquid cultures of sSP012 and sSP020
1) 100 μ l of plating bacteria per tube
2) Prepare tenfold serial dilutions (10-6 to 10-9 ) of the bacteriophage stock in LB
3) Put 10 μ l/ 100 μ l of each dilution to the bacteria
4) Mix the bacteriophage particles with the bacterial culture by vortexing gently.
5) Add 40 μ l of X-gal solution (working conc) and IPTG (working conc) solution to each of the tubes
6) Add 3ml of Agar to each tube and gently vortexing for 3 seconds
7) Pour the mixture onto plates containing LB medium supplemented with 5 mM MgCl2
8) Swirl the plate gently to ensure an even distribution of bacteria and agar.
9) Incubate them at 37°C.

Electrocompetent Cells (sSP017-XL-1 Blue, Litmus 28i)
1) The night before the transformation, start an overnight culture of cells.
sSP017 (XL1 Blue Litmus 28i)
2) The day of the transformation, dilute the cells 100X.
100 ml LB Amp.
Grow at 30°C for about 90 minutes.
3) When the cells reach an OD600 of 0.2.
4) Harvest the cells.
When the cells reach an OD600 of between 0.6 and 0.8 (OD: 0,683)
Split the culture into 2x 50 ml falcon tubes, on ice.
Centrifuge at 4 °C for 10 min at 4000 rpm.
5) Wash and combine the cells.
Remove the supernatant.
Resuspend the cells in 2x 25 ml of ice cold water.
Combine the volumes in a single 50 ml falcon tube.
6) Wash the cells 2 more times.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 50 ml of ice cold water.
Repeat.
7) Wash and concentrate the cells for electroporation.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 1-2 ml of ice cold water.
We will use 200 ul of washed cells per transformation.

Transforming pKD13 into pir+ E.coli
1) Prepare BD tubes with a pipette filled with LB at the interior of each tube (pipette supplied with the electroporation cuvette)

2) Test the purity of the electrocompetent cells.
Add 200 ul of washed cells to a cuvette.

3) Mix the cells and DNA in a cuvette.
200 ul of washed cells with 200 ng of PCR product.
Keep the cuvette on ice until just before the electroporation.

4) Preload a pipette with 1 ml of LB.

5) Pulse the cuvette with voltage.
Dry the electrodes with a kimwipe prior to loading.
Use the EC2 setting.

6) Listen for arcing.
A cracking sound means all the cells are dead.
Note the time constant: 5 is good, 5.8 is great.

7) Immediately recover the cells.
Add the 1 ml of preloaded LB and pipet up and down to mix.
Collect 1 ml of cells, some volume is lost in the cuvette.

8) Incubate 2 h at 37 °C with shaking.

9) Plate 100 ul of recovered cells on selective plates.
Use antibiotic appropriate to the part being integrated.
Let the other 900 ul rest overnight at room temperature.

10) Concentrate and plate the remaining cells
Spin down quickly and resuspend in 100 ul LB before plating.

Transformed cells should be incubated at 37 °C.
Colonies should appear 24-48 h after plating.

Detect

ASDF

Thursday 22^nd August

Gel of gradient PCR product (Pictures 6,5,5), PCR purification and pooling, Digestion M13 backbone, RFP insert, Test Digestion in Gel, Gel Extraction, Liquid culture, Purification of Backbone Cloning and Miniprep sSP015.

Gel of gradient PCR product
1%, 100V, 20 min

PCR purification and pooling
Pool all samples that worked
Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through. Place the QIAquick column back into the same tube
To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 50 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.

c(SPCR5)= ng/ul
c(SPCR6)= ng/ul

Digestion M13 backbone, RFP insert

Backbone/Insert (double the amount)

Regent	Volume
Purified Plasmid	20 ul
H2O	65 ul
10x FastDigest Buffer	10 ul
FastDigest Enzyme 1 (EcoRI)	2,5 ul
FastDigest Enzyme 2 (PstI)	2,5 ul
FastAP Phosphatase	0 ul
Total Volume	100ul

Digest for 2.5 hours at 37 °C with shaking.

Test Digestion in Gel
1%, 100V, 20 min

Gel Extraction
Excise the DNA fragment from the agarose gel with a clean, sharp scalpel. Minimize the size of the gel slice by removing extra agarose.
Weigh the gel slice in a colorless tube. Add 3 volumes of Buffer QG to 1 volume of gel (100 mg ~ 100 μl). To help dissolve gel, mix by vortexing the tube every 2–3 min during the incubation.
After the gel slice has dissolved completely, check that the color of the mixture is yellow (similar to Buffer QG without dissolved agarose).
Add 1 gel volume of isopropanol to the sample and mix (actually only needed for very small products or very big products)
To bind DNA, apply the sample to the QIAquick column, and centrifuge for 1 min.
Discard flow-through and place QIAquick column back in the same collection tube.
To wash, add 0.75 ml of Buffer PE to QIAquick column and centrifuge for 1 min.
11. Discard the flow-through and centrifuge the QIAquick column for an additional 1 min at 17,900 x g (13,000 rpm). 12. Place QIAquick column into a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 30 μl elution buffer to the center of the QIAquick membrane, let the column stand for 1 min, and then centrifuge for 1 min.

c=13,6ng/ul

Liquid culture
sSP015

Purification of Backbone Cloning
Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through. Place the QIAquick column back into the same tube
To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 30 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.

Miniprep sSP015
1) Pellet 2x 2ml of liquid culture (4000rpm, 10 min)
2) Discard supernatant
3) resuspend the cells in 250ul of resuspension solution
4) add 250ul of lysis solution, mix by inverting 4-6 times
5) add 350ul of neutralization solution
4) centrifuge for 5 min
5) transfer supernatant to spin column
6) centrifuge for 1 min
7) discard flow through
8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)
9) centrifuge for 1 min to remove left over liquid
10) transfer the column on a 1.5ml tube
11) add 50ul of elution buffer and incubate for 2 min
12) centrifuge for 2 min
13) Nanodrop the concentration and freeze at -20°

Detect

ASDF

Friday 23^rd August

Stress Experiment (sSP001, sSP002, sSP010, sSP011, M13, MMC), Microscope, Gradient PCR of SPCR2, Digestion of SPCR 5 and SPCR7 and Purification of Digestion.

Stress Experiment (sSP001, sSP002, sSP010, sSP011, M13, MMC)
Dilute ON culture 1:100
Centrifuge (1 min, 10rpm)
Wash 1x with 70% of Volume M9 Glucose
Centrifuge again
Take up in 70% of the VOlume M9 Gluo
100ul in each 96 well plate (see pipetting file)
Add MMC 10ug/ml in corresponding wells and incubate in the plate reader
After 90 min add phages into correscponding wells
put back on the plate reader

Microscope
look at the shape and fluorescence at t=0 of sSP001
look at the shape and fluorescence at=90 mi of sSP001 + 10ug/ml MMC
take photos

Gradient PCR of SPCR2
iSP001 (gblock) and iS002

Reagent	Volume
	1x
Nuclease-free water	37,25µL
5x Phusion HF Buffer	10µL
10 mM dNTPs	1µL
Forward Primer (10 µM)	0.5µL
Reverse Primer (10 µM)	0.5µL
Template Plasmid	0.25µL
Phusion DNA Polymerase	0.5µL
Total Volume	50µL

Thermocycler Protocol: NEB Phusion
	Temp	Time
Start	98°C	30 sec	Melt

Cycle 1	98°C	5 sec	Melt	35 cycles
Cycle 2	40.5°C / 60°C	25 sec	Anneal
Cycle 3	72°C	30 sec per kb	Extend

Finish	72°C	5 min	Extend
Store	10°C	Forever	Store

Digestion of SPCR 5 and SPCR7

Reagent	Volume
Purified PCR Product	16 ul
H2O	0 ul
10x FastDigest Buffer	2 ul
FastDigest Enzyme 1	1 ul
FastDigest Enzyme 2	1 ul
Total Volume	20 ul

Incubate at 37°C for 1h shaking

Purification of Digestion
Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through. Place the QIAquick column back into the same tube
To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 30 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.

Detect

ASDF

Sunday 25^th August

Gel of Gradient PCR, Liquid Cultures, Ligation M13 + RFP, Ligation SPCR5, SPCR7, Electrocompetent cells, Gibson Assembly, Transformation (Gibson)and Transformation (Gibson, Ligations.

Gel of Gradient PCR
1%, 100V, 20min

Liquid Cultures
NEB Turbo
XL10

Ligation

Ligation M13 + RFP
0.5ul Vector (M13)
2.6ul Insert (RFP)
5.4ul H20
1.0ul T4 buffer
0.5ul T4 Ligase

Ligation SPCR5, SPCR7
1.0ul Vector (SPCR5)
1.5ul Insert (SPCR7)
6.0ul H20
1.0ul T4 buffer
0.5ul T4 Ligase

Incubate ~30min at 37 C

Electrocompetent cells
1) Start Culture
2) When the cells reach an OD600 of 0.2.
3) Harvest the cells.
When the cells reach an OD600 of between 0.6 and 0.8 (OD: 0,683)
Centrifuge at 4 °C for 10 min at 4000 rpm.
4) Wash and combine the cells.
Remove the supernatant.
Resuspend the cells in 25 ml of ice cold water
5) Wash the cells 2 more times.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 50 ml of ice cold water.
Repeat. 6) Wash and concentrate the cells for electroporation.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 1-2 ml of ice cold water.
We will use 200 ul of washed cells per transformation.

Gibson Assembly

Amount per Reaction
Positive Control**

PCR Fragment(s)
+ linearized vector
2-10 μl (0.02–0.5 pmols)*

Gibson
Assembly Master
Mix (2X)
10 μl

Deionized H2O
XX μl

Total Volume
20 μl

Incubate samples in a thermocycler at 50°C for 15 minutes. After incubation, store the samples on ice or at -20°C for subsequent transformation
Note: Extended incubation up to 60 minutes may help to improve assembly efficiency in some cases (for further details see FAQ section).
Transform NEB 5-alpha Competent E. coli cells (provided with the kit) with 2 μl of the assembly reaction, following the transformation protocol.

Transformation (Gibson)
Thaw competent cells on ice.
Add 2 μl of the chilled assembly product to the competent cells. Mix gently by pipetting up and down or by flicking the tube 4–5 times. Do not vortex.
Place the mixture on ice for 30 minutes. Do not mix.
Heat shock at 42°C for 30 seconds. Do not mix.
Transfer tubes to ice for 2 minutes.
Add 950 μl of room-temperature SOC media to the tube.
Incubate the tube at 37°C for 60 minutes. Shake vigorously (250 rpm) or rotate.
Warm selection plates to 37°C.
Spread 100 μl of the cells onto the selection plates. Use Amp plates for positive control sample.
Incubate overnight at 37°C.

Transformation (Gibson, Ligations)
1) Prepare BD tubes with a pipette filled with LB at the interior of each tube (pipette supplied with the electroporation cuvette)

2) Test the purity of the electrocompetent cells.
Add 200 ul of washed cells to a cuvette.

3) Mix the cells and DNA in a cuvette.
200 ul of washed cells with 200 ng of PCR product.
Keep the cuvette on ice until just before the electroporation.

4) Preload a pipette with 1 ml of LB.

5) Pulse the cuvette with voltage.
Dry the electrodes with a kimwipe prior to loading.
Use the EC2 setting.

6) Listen for arcing.
A cracking sound means all the cells are dead.
Note the time constant: 5 is good, 5.8 is great.

7) Immediately recover the cells.
Add the 1 ml of preloaded LB and pipet up and down to mix.
Collect 1 ml of cells, some volume is lost in the cuvette.

8) Incubate 2 h at 37 °C with shaking.

9) Plate 100 ul of recovered cells on selective plates.
Use antibiotic appropriate to the part being integrated.
Let the other 900 ul rest overnight at room temperature.

10) Concentrate and plate the remaining cells
Spin down quickly and resuspend in 100 ul LB before plating.

Transformed cells should be incubated at 37 °C.
Colonies should appear 24-48 h after plating.

Detect

ASDF

Monday 26^th August

Picking colonies (Trafo Gibson, BBC SPCR5/7)
chosing 5-7 colonies and start liquid cultures

Detect

ASDF

Tuesday 27^th August

Starting liquid cultures and Miniprep of pS.005 and pS.006.

Starting liquid cultures
sSP001, sSP002, sSP010, sSP011, sSP012, sSP020

Miniprep of pS.005 and pS.006
1) Pellet 2x 9ml of liquid culture (4000rpm, 10 min)
2) Discard supernatant
3) resuspend the cells in 250ul of resuspension solution
4) add 250ul of lysis solution, mix by inverting 4-6 times
5) add 350ul of neutralization solution
4) centrifuge for 5 min
5) transfer supernatant to spin column
6) centrifuge for 1 min
7) discard flow through
8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)
9) centrifuge for 1 min to remove left over liquid
10) transfer the column on a 1.5ml tube
11) add 50ul of elution buffer and incubate for 2 min
12) centrifuge for 2 min
13) Nanodrop the concentration and freeze at -20°

Colony PCR

Reagent	Volume
Forward Primer (10 uM)	0,5 ul
Reverse Primer (10 uM)	0,5 ul
Template DNA (Miniprep)	0,5 ul
Quick-Load® Taq 2X Master Mix	12,5 ul
Nuclease-free water	10,0 ul
Total volume	25 ul

Thermocycler Protocol: Dream Taq Green
	Temp	Time
Start	95°C	30 sec1	Melt

Cycle 1	95°C	15 sec	Melt	35 cycles
Cycle 2	46,8°C	30 sec	Anneal
Cycle 3	68°C	1 min per kb	Extend	cellule 2

Finish	68°C	5 min	Extend
Store	10°C	Forever	Store

Detect

ASDF

Wednesday 28^th August

Gel Colony PCR, Liquid Cultures (1:100), Analytical Digest, Gel Ligation/Gibson, Gel Analytical digest, DpnI digest of SPCR5, SPCR6, SPCR7, Gel DpnI digest, PCR purification of DpnI digested SPCR5, SPCR6, SPCR7, Stress test microscope and M13 Test.

Gel Colony PCR
pS005 (C1-C5) - pS006 (C1-C7)
1% 100V 20 min

Liquid Cultures (1:100)
sSP001, sSP002, sSP010, sSP011, sSP012, sSP020

Analytical Digest

Reagent	Volume
Plasmid Miniprep	5 ul
H2O	12 ul
c10x FastDigest Buffer	2ul
FastDigest Enzyme 1	0,5 ul
FastDigest Enzyme 2	0,5 ul
Total Volume	20,0 ul

Digest for 15 minutes at 37 °C with shaking

Gel Ligation/Gibson
pS005 - pS006 - M13/RFP
1% 100V 20min

Gel Analytical digest
pS005 (C1-C5)-pS006 (C1-C7)
1% 100V 20min

DpnI digest of SPCR5, SPCR6, SPCR7
add 4ul of DpnI into each tube, mix and incubate for 1h at 37°C

Gel DpnI digest
let each 5ul run on a gel
1%, 100V 20min

PCR purification of DpnI digested SPCR5, SPCR6, SPCR7
Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through. Place the QIAquick column back into the same tube
To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 30 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.

Stress test microscope
Dilute ON cultures of sSP001, sSP002, sSP010, sSP011, sSP012 1:100 and incubate up to an OD of 0.3
Take out 2ml of sSP001, sSP002, sSP010, sSP011
add:
sSP001: 10ug/ml MMC
sSP002: 10ug/ml MMC
sSP010: 20ul sSP012 supernatant
sSP011: 20ul sSP012 supernatant

incubate for 90 min

take pictures under the microscope (trans and YFP) of (un-)treated samples

M13 Test
Liquid cultures of sSP012 and sSP020
1) 100 μ l of plating bacteria per tube (OD 0.6)
2) Prepare tenfold serial dilutions (10-6 to 10-9 ) of the bacteriophage stock in LB
3) Put 10 μ l/ 100 μ l of each dilution to the bacteria
4) Mix the bacteriophage particles with the bacterial culture by vortexing gently.
5) Add 40 μ l of X-gal solution (working conc) and IPTG (working conc) solution to each of the tubes
6) Add 3ml of Agar to each tube and gently vortexing for 3 seconds
7) Pour the mixture onto plates containing LB medium supplemented with 5 mM MgCl2 and 2x IPTG and Xgal
8) Swirl the plate gently to ensure an even distribution of bacteria and agar.
9) Incubate them at 37°C.

Detect

ASDF

Friday 30^th August

M13 test, DpnI digest (SPCR5,6,7), Gel SPCR5,6,7 and PCR purification of DpnI digested SPCR5, SPCR6, SPCR7

M13 test
dilute ON cultures (NEB turbo, FR-433) 1: 100, grow up to an OD of ~0.6
1) 100 μ l of plating bacteria per tube (OD 0.6)
2) Prepare tenfold serial dilutions (10-6 to 10-9 ) of the bacteriophage stock in LB
3) Put 10 μ l/ 100 μ l of each dilution to the bacteria
4) Mix the bacteriophage particles with the bacterial culture by vortexing gently.
5) Add 40 μ l of X-gal solution (working conc) and IPTG (working conc) solution to each of the tubes
6) Add 3ml of Agar to each tube and gently vortexing for 3 seconds
7) Pour the mixture onto plates containing LB medium supplemented with 5 mM MgCl2 and 2x IPTG and Xgal
8) Swirl the plate gently to ensure an even distribution of bacteria and agar.
9) Incubate them at 37°C.

DpnI digest (SPCR5,6,7)
add 8ul DpnI per tube and digest for 1h at 37°, shaking

Gel SPCR5,6,7
1%, 100V, 20min

PCR purification of DpnI digested SPCR5, SPCR6, SPCR7
Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through. Place the QIAquick column back into the same tube
To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 30 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.

Detect

ASDF

Day Number^suffix Month

Place your twit here

Place your note here

Detect

ASDF

Wednesday 4^th September

Starting Liquid culture, PCRs, Gel, DpnI digest, Digestion of SPCR5,7, Purification of Digestion, Ligation of SPCR5,7, Gibson Assembly, Making Electrocompetent Cells, Transformation, Redo SPCR12/13 ,

Starting Liquid culture
NEB turbo, grow up to an OD of 0.6

PCRs
SPCR1, SPCR2, SPCR4, SPCR12, SPCR13

Reagant	Volume
	1x (SPCR2)	11x (SPCR12)	11x (SPCR13)	8x (SPCR1)	8x (SPCR4)
Nuclease-free water	37.25 µl	447 µl	447 µl	335,25µl	335,25µl
5x Phusion HF Buffer	10 µl	120 µl	120 µl	90 µl	90 µl
10 mM dNTPs	1 µl	12 µl	12 µl	9 µl	9 µl
Forward Primer (10 uM)	0.5 µl	6 µl	6 µl	4.5 µl	4.5 µl
Reverse Primer (10 uM)	0.5 µl	6 µl	6 µl	4.5 µl	4.5 µl
Template Plasmid	0.25 µl	3 µl	3 µl	2.25 µl	2.25 µl
Phusion DNA Polymerase	0.5 µl	6 µl	6 µl	4,5 µl	4,5 µl
Total Volume	50 µl	600 µl	600 µl	450 µl	450 µl

for SPCR 12/13 gradient, 2,5 min
for SPCR3, SPCR11 51°, 45s
for SPCR 1, SPCR2, 48,8°, 2 min
for SPCR4, 40,8°, 1 min

Gel
1%, 100V, 20 min

1.small gel (SPCR1,2,3,4,11)
2. big gel (SPCR12)
3. big Gel (SPCR13)

DpnI digest
SPCR 1: add 10ul DpnI
SPCR4: add 10ul DpnI
SPCR2,3,11: add 1 ul DpnI

incubate for 1h at 37°

Digestion of SPCR5,7

Reagent	Volume
Purified PCR Product	16 µl
H2O	0 µl
10x FastDigest Buffer	2 µl
XbaI	1 µl
SpeI	1 µl
Total Volume	20.0 µl

Incubate for 1h at 37°, shaking

Purification of Digestion
Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through. Place the QIAquick column back into the same tube
To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 30 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.

Ligation of SPCR5,7

Reagent	Volume
Vector	1 µl
Insert	3 µl
H2O	4.5 µl
Fermentas T4 Ligase Buffer	1 µl
Fermentas T4 Ligase Enzyme	0.5 µl
Total Volume	10 µl

Incubate at room temperature for ~1h

Gibson Assembly

Amount per Reaction : Positive Control**

PCR Fragment(s)+ linearized vector : 2-10 μl (0.02–0.5 pmols)*

Gibson Assembly Master Mix (2X): 10 μl

Deionized H2O : XX μl

Total Volume : 20 μl

Incubate samples in a thermocycler at 50°C for 15 minutes.
Put on Ice
Insert: 2,4 ul
Vector: 0,6 ul

Making Electrocompetent Cells

1) Start a liquid culture of cells. NEB turbo
2) dilute the cells 100X.
100 ml LB.
Grow at 30°C for about 90 minutes.
3) Harvest the cells.
When the cells reach an OD600 of between 0.6 and 0.8
Split the culture into 2x 50 ml falcon tubes, on ice.
Centrifuge at 4 °C for 10 min at 4000 rpm.
5) Wash and combine the cells.
Remove the supernatant.
Resuspend the cells in 2x 25 ml of ice cold water.
Combine the volumes in a single 50 ml falcon tube.
6) Wash the cells 2 more times.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 50 ml of ice cold water.
Repeat.
7) Wash and concentrate the cells for electroporation.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 1-2 ml of ice cold water.
We will use 200 ul of washed cells per transformation.

Transformation
pS005, pS006, SPCR3 (IDT plasmid) M13mp18
1) Prepare BD tubes with a pipette filled with LB at the interior of each tube (pipette supplied with the electroporation cuvette)

2) Test the purity of the electrocompetent cells.
Add 200 ul of washed cells to a cuvette.

3) Mix the cells and DNA in a cuvette.
200 ul of washed cells with 200 ng of PCR product.
Keep the cuvette on ice until just before the electroporation.

4) Preload a pipette with 1 ml of LB.

5) Pulse the cuvette with voltage.
Dry the electrodes with a kimwipe prior to loading.
Use the EC2 setting.

6) Listen for arcing.
A cracking sound means all the cells are dead.
Note the time constant: 5 is good, 5.8 is great.

7) Immediately recover the cells.
Add the 1 ml of preloaded LB and pipet up and down to mix.
Collect 1 ml of cells, some volume is lost in the cuvette.

8) Incubate 2 h at 37 °C with shaking.

9) Plate 10/200 ul of recovered cells on selective plates.
Use antibiotic appropriate to the part being integrated.
Let the other 900 ul rest overnight at room temperature.

10) Concentrate and plate the remaining cells
Spin down quickly and resuspend in 100 ul LB before plating.

Transformed cells should be incubated at 37 °C.
Colonies should appear 24-48 h after plating.

Redo SPCR12/13

Reagent	Volume
	11x (SPCR12)	11x (SPCR13)
Nuclease-free water	447 µl	447 µl
5x Phusion HF Buffer	120 µl	120 µl
10 mM dNTPs	12 µl	12 µl
Forward Primer (10 uM)	6 µl	6 µl
Reverse Primer (10 uM)	6 µl	6 µl
Template Plasmid	3 µl	3 µl
Phusion DNA Polymerase	6 µl	6 µl
Total Volume	600 µl	600 µl

Cycling protocol as usual + gradient + topdown

Detect

ASDF

Thursday 5^th September

Gel, Colony PCR, Topdown PCR and gels

Gel
SPCR12, SPCR13
1%, 100V, 20 min

Pictures: 13/09/05_SPCR12_corresponding primers

13/09/05_SPCR13_corresponding primers

Colony PCR

Reagent	Volume
Forward Primer (10 uM)/td>	0.5 ul
Reverse Primer (10 uM)	0.5 ul
Template DNA (from above)	1.5 ul
Quick-Load® Taq 2X Master Mix	12.5 ul
Total Volume	25 ul

Thermocycler Protocol: DreamTaq Green PCR MM
	Temp	Time
Start	95°C	1 min	Melt

Cycle 1	95°C	30 sec	Melt	35 cycles
Cyle 2	52.6/46.8 °C	30 sec	Anneal
Cycle 3	72°C	1 min per kb	Extend

Finish	72°C	10 min	Extend
Store	10°C	Forever	Store

Topdown PCR
SPCR 1,4,12,13

Reagent	Volume
	x1>/b>
Nuclease-free water	37.25 µl
5x Phusion HF Buffer	10 µl
10 mM dNTPs	1 µl
Forward Primer (10 uM)	0.5 µl
Reverse Primer (10 uM)	0.5 µl
Template Plasmid	0.25 µl
Phusion DNA Polymerase	0.5 µl
Total Volume	50 µl

increases every cycle 1°C, starting from 40°

Gels
1%, 100V, 20+ Min

Pictures:
13/09/05_colony PCR_pS005_C1-C8_BB verification primers

13/09/05_colony PCR_pS005_C9-C16_BB verification primers

13/09/05_colony PCR_pS006_C1-C8_BB verification primers

13/09/05_colony PCR_pS006_C9-C16_BB verification primers

13/09/05_top down PCR_SPCR1,4,12,13

Detect

ASDF

Friday 6^th September

Place your twit here

Digestions: linearized pSB1C3, linearized pSB1A3, SPCR2, SPCR3, SPCR11

Reagent	Volume
Purified PCR Product	16 µl
H2OH2O	0 µl
10x FastDigest Buffer	2 µl
FastDigest Enzyme 1	1 µl
cFastDigest Enzyme 2	1 µl
Total Volume	4 µl

SPCR5, pSB1C3: XbaI/SpeI
SPCR11, pSB1A3, pSB1C3: EcoRI/PstI
SPCR13, pSB1A3, pSB1C3: EcoRI/PstI
SPCR2, pSB1A3, pSB1C3: EcoRI/PstI

1h at 37° shaking

Detect

ASDF

Saturday 7^th September

Ligation, Making Electrocompetent Cells, Gibson Assembly, Transformation, Liquid culture of E1010

Ligation

Reagent	Volume
Vector	1 µl
Insert	3 µl
H2O	4.5 µl
Fermentas T4 Ligase Buffer	1
Fermentas T4 Ligase Enzyme	0.5
Total Volume	10 µl

SPCR5, pSB1C3
SPCR11, pSB1A3, pSB1C3
SPCR13, pSB1A3, pSB1C3
SPCR2, pSB1A3, pSB1C3

Incubate at room temperature for 10 minutes.

Making Electrocompetent Cells
1) Start a liquid culture of cells.
NEB turbo
2) dilute the cells 100X.
100 ml LB.
Grow at 30°C for about 90 minutes.
3) Harvest the cells.
When the cells reach an OD600 of between 0.6 and 0.8
Split the culture into 2x 50 ml falcon tubes, on ice.
Centrifuge at 4 °C for 10 min at 4000 rpm.
5) Wash and combine the cells.
Remove the supernatant.
Resuspend the cells in 2x 25 ml of ice cold water.
Combine the volumes in a single 50 ml falcon tube.
6) Wash the cells 2 more times.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 50 ml of ice cold water.
Repeat.
7) Wash and concentrate the cells for electroporation.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 1-2 ml of ice cold water.
We will use 200 ul of washed cells per transformation.

Gibson Assembly

Amount per Reaction
Positive Control**

PCR Fragment(s)
+ linearized vector
2-10 μl (0.02–0.5 pmols)*

Gibson
Assembly Master
Mix (2X)
10 μl

Deionized H2O
XX μl

Total Volume
20 μl

Incubate samples in a thermocycler at 50°C for 15 minutes.
Put on Ice

Transformation pS002 (Chl), pS002 (Amp), pS003 (Amp), pS004 (Chl), pS004 (Amp), pS005 (Chl), pS006-7 (Chl), pS007 (Chl), pS008 (Amp), pS009 (Chl), pS012 (Amp), pS013 (Chl), pS013 (Amp)

1) Prepare BD tubes with a pipette filled with LB at the interior of each tube (pipette supplied with the electroporation cuvette)

2) Test the purity of the electrocompetent cells.
Add 200 ul of washed cells to a cuvette.

3) Mix the cells and DNA in a cuvette.
200 ul of washed cells with 200 ng of PCR product.
Keep the cuvette on ice until just before the electroporation.

4) Preload a pipette with 1 ml of LB.

5) Pulse the cuvette with voltage.
Dry the electrodes with a kimwipe prior to loading.
Use the EC2 setting.

6) Listen for arcing.
A cracking sound means all the cells are dead.
Note the time constant: 5 is good, 5.8 is great.

7) Immediately recover the cells.
Add the 1 ml of preloaded LB and pipet up and down to mix.
Collect 1 ml of cells, some volume is lost in the cuvette.

8) Incubate 1/2 h at 37 °C with shaking.

9) Plate 10/200 ul of recovered cells on selective plates.
Use antibiotic appropriate to the part being integrated.
Let the other 900 ul rest overnight at room temperature.

10) Concentrate and plate the remaining cells
Spin down quickly and resuspend in 100 ul LB before plating.

Transformed cells should be incubated at 37 °C.
Colonies should appear 24-48 h after plating.

Liquid culture of E1010

Detect

ASDF

Sunday 8^th September

Replating of transformation and Miniprep of E1010

Replating of Transformation

Miniprep of E1010
1) Pellet liquid culture (4000rpm, 10 min)
2) Discard supernatant
3) resuspend the cells in 250ul of resuspension olution
4) add 250ul of lysis solution, mix by inverting 4-6 times
5) add 350ul of neutralization solution
4) centrifuge for 5 min
5) transfer supernatant to spin column
6) centrifuge for 1 min
7) discard flow through
8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)
9) centrifuge for 1 min to remove left over liquid
10) transfer the column on a 1.5ml tube
11) add 50ul of elution buffer and incubate for 2 min
12) centrifuge for 2 min
13) Nanodrop the concentration and freeze at -20°

Detect

ASDF

Monday 16^th September

Result Cloning, Protocol: E. coli Colony PCR, Extraction of DNA, PCR Reaction and Gels

Result Cloning:
Colonies?
pS002 (Chl): no
pS002 (Amp): yes
pS003 (Amp):yes
pS004 (Chl): no
pS004 (Amp): yes
pS005 (Chl): yes
pS006-7 (Chl): yes
pS006 (Chl): no
pS007 (Chl): yes
pS008 (Amp): yes
pS009 (Chl): yes
pS012 (Amp): yes
pS013 (Chl): no
pS013 (Amp): yes

Protocol: E. coli Colony PCR
Using the Dream Taq Master Mix

Extraction of DNA

1) Pick a single colony into 50 ul of H20.

2) Boil for 5 minutes.

PCR Reaction (pS002 (Chl-Lig), pS005 (Chl-G), pS006-7 (Chl-Lig), pS007 (Chl-G), pS008 (Amp-G), pS009 (Chl-G))

Keep all the reagents at 4 °C while preparing the mixture.
Pre-heat the thermocycler to 95 °C and transfer your reaction directly from 4 °C.

Reagent	Volume
Forward Primer (10 uM)	0.5 ul
Reverse Primer (10 uM)	0.5 ul
Template DNA (from above)	1.5 ul
Quick-Load® Taq 2X Master Mix	12.5 ul
Nuclease-free water	10 ul
Total Volume	25 ul

Thermocycler Protocol: NEB Quick-Load
	Temp	Time
Start	95°C	30 sec	Melt

Cycle 1	95°C	15 sec	Melt	35 cycles
Cycle 2	45.8 °C	30 sec	Anneal
Cycle 3	72°C	1 min per kb	Extend

Finish	72 °C	15 min	Extand
Store	10°C	Forever	Store

Gels
100V, 25-30 min, 1%

Pictures:
13/09/16_colony PCR_ps007.BMP

13/09/16_colony PCR_pS006-7.BMP

13/09/16_colony PCR_ps005.BMP

Result: didn’t work

Detect

ASDF

Tuesday 17^th September

PCR Reaction (pS003 (Amp-G), pS004 (Amp-Lig), pS012 (Amp-G), pS013 (Chl-Lig))

PCR Reaction (pS003 (Amp-G), pS004 (Amp-Lig), pS012 (Amp-G), pS013 (Chl-Lig))

Keep all the reagents at 4 °C while preparing the mixture.
Pre-heat the thermocycler to 95 °C and transfer your reaction directly from 4 °C.

Reagent	Volume
Forward Primer (10 uM)	0.5 ul
Reverse Primer (10 uM)	0.5 ul
Template DNA (from above)	1.5 ul
Quick-Load® Taq 2X Master Mix	12.5 ul
Nuclease-free water	10 ul
Total Volume	25 ul

Thermocycler Protocol: NEB Quick-Load
	Temp	Time
Start	95°C	30 sec	Melt

Cycle 1	95°C	15 sec	Melt	35 cycles
Cycle 2	45.8 °C	30 sec	Anneal
Cycle 3	72°C	1 min per kb	Extend

Finish	72 °C	15 min	Extand
Store	10°C	Forever	Store

Gels
100V, 30 min, 1%

Pictures: 13/09/17_colony PCR_pS009.JPG

13/09/17_colony PCR_pS008_pS002.jpg

13/09/17_colony PCR_pS003.JPG

13/09/17_colony PCR_pS004.JPG

13/09/17_colony PCR_pS012.JPG

13/09/17_colony PCR_pS013.JPG

Result:
pS003: row 3,5 might have worked -> analytical digest
pS004: all might have worked -> analytical digest
pS013: all might have worked -> analytical digest
pS012: row 3,4,5 might have workes -> analytical digest

Sequencing
Bringing primers/plasmids away for sequencin
Bacbbone, SPCR2 with iS002, iS032, iS028, iS029, iS030

Detect

ASDF

Wednesday 16^th September

Ligations

Ligation

SPCR2 - Chl

Reagent	Volume
SPCR2	1 µl
Chl	2,95 µl
H2O	4.55 µl
Fermentas T4 Ligase Buffer	1.0 µl
Fermentas T4 Ligase Enzyme	0.5 µl
Total Volume	10 µl

SPCR2 - Amp

Reagent	Volume
SPCR2	1 µl
Amp	3.4 µl
H2O	4.1 µl
Fermentas T4 Ligase Buffer	1.0 µl
Fermentas T4 Ligase Enzyme	0.5 µl
Total Volume	10 µl

SPCR3 - Chl

Reagent	Volume
SPCR3	1 µl
Amp	1.79 µl
H2O	5.71 µl
Fermentas T4 Ligase Buffer	1.0 µl
Fermentas T4 Ligase Enzyme	0.5 µl
Total Volume	10 µl

SPCR3 - Amp7

Reagent	Volume
Amp	1 µl
SPCR 3	1.56 µl
H2O	5.94 µl
Fermentas T4 Ligase Buffer	1.0 µl
Fermentas T4 Ligase Enzyme	0.5 µl
Total Volume	10 µl

SPCR5 - Chl

Reagent	Volume
SPCR 5	0.5 µl
Chl	4.55 µl
H2O	3.45 µl
Fermentas T4 Ligase Buffer	1.0 µl
Fermentas T4 Ligase Enzyme	0.5 µl
Total Volume	10 µl

SPCR11 - Chl

Reagent	Volume
Chl	1 µl
SPCR11	1.3 µl
H2O	6.2 µl
Fermentas T4 Ligase Buffer	1.0 µl
Fermentas T4 Ligase Enzyme	0.5 µl
Total Volume	10 µl

SPCR2 - Amp

Reagent	Volume
Amp	1 µl
SPCR11	1.13 µl
H2O	6.37 µl
Fermentas T4 Ligase Buffer	1.0 µl
Fermentas T4 Ligase Enzyme	0.5 µl
Total Volume	10 µl

at 16° for 1h

Transformation
1) Thaw competent cells on ice (Gibson Kit competent cells)
2) Place 20 ul of cells in a pre-chilled Eppendorf tube.
3) Add 2.5 ul of plasmid (from Biobrick stock)
4) Mix gently by flicking the tube.
5) Chill on ice for 10 minutes.
4) Heat shock at 42 °C for 30 seconds
5) Return to ice for 2 minutes.
6) Add 200 ul LB medium and recover the cells by shaking at 37 °C.
Ampicillin: 15-30 minutes
Chloramphenicol: 60-120 minutes
7) Plate out the cells on selective LB (10ul)
8. Incubate at 37 °C. Transformants should appear within 12 hrs.

Gel of Ligation products
1%, 100V, 40 min

Detect

ASDF

Sunday 22^nd September

PCR and Gels

PCR
M13 backbone

SPCR16,17

Reagent	Volume
	x1
Nuclease-free water	37.25 µl
5x Phusion HF Buffer	10 µl
10 mM dNTPs	1 µl
Forward Primer (10 uM)	0.5 µl
Reverse Primer (10 uM)	0.5 µl
Template Plasmid	0.25 µl
Phusion DNA Polymerase	0.5 µl
Total Volume	50 µl

Protocol see fotos

Gel 100V, 1%, 1,5h

Detect

ASDF

Monday 23^rd September

Gels and PCR

Gel
100V, 1%, 1,5h

Picture: 13/09/23_SPCR16_17_corresponding primers - PCRs didn't worked

PCR
SPCR 16 (normal phusion at 48°C)

Reagent	Volume
	x1
Nuclease-free water	37.25 µl
5x Phusion HF Buffer	10 µl
10 mM dNTPs	1 µl
Forward Primer (10 uM)	0.5 µl
Reverse Primer (10 uM)	0.5 µl
Template Plasmid	0.25 µl
Phusion DNA Polymerase	0.5 µl
Total Volume	50 µl

Thermocycler Protocol: NEB Phusion
	Temp	Time
Start	98°C	30 sec	Melt

Cycle 1	98°C	5 sec	Melt	35 cycles
Cycle 2	72°C	30 sec	Anneal
Cycle 3	72°C	30 sec per kb	Extend

Finish	72 °C	5 min	Extand
Store	10°C	Forever	Store

Detect

ASDF

Tuesday 24^th September

Overlap PCR, PCR of Overlap, Digestion, Gel extraction, Gels, PCR Purification, PCR (SPCR2, SPCR3, SPCR5, SPCR6, SPCR7, SPCR8, SPCR9, SPCR10, SPCR11, linearize pSB1C3) and liquid culture

Overlap PCR
SPCR5-SPCR2

Reagent	Volume
	x1
Nuclease-free water	37.25 µl
5x Phusion HF Buffer	10 µl
10 mM dNTPs	1 µl
Template Plasmid(10 uM)	1 µl
Template Plasmid (10 uM)	1 µl
Phusion DNA Polymerase	0.5 µl
Total Volume	50 µl

PCR of Overlap

Digestion
M13 (EcoRI, PstI), pSB1C3 (EcoRI, PstI), psB1C3 (XbaI, SpeI)

Reagent	Volume
Purified Plasmid	20 µl
H2O	63 µl
10x FastDigest Buffer	10 µl
FastDigest Enzyme 1	2.5 µl
FastDigest Enzyme 2	2.5 µl
FastAP Phosphatase	2 µl
Total Volume	100 µl

SPCR2 (EcoRI, PstI), SPCR5 (XbaI, SpeI)

Reagent	Volume
Purified PCR Product	16 µl
H2O	0 µl
10x FastDigest Buffer	2 µl
FastDigest Enzyme 1	1 µl
FastDigest Enzyme 2	1 µl
Total Volume	20 µl

Gel
pSB1C3
1%, 100V, 1h
Picture: 13/09/24_pSB1C3 digest_EcoRI/PstI_XbaI/SpeI - digest worked

Gel extraction
1. Excise the DNA fragment from the agarose gel with a clean, sharp scalpel. Minimize the size of the gel slice by removing extra agarose.
2. Weigh the gel slice in a colorless tube. Add 3 volumes of Buffer QG to 1 volume of gel (100 mg ~ 100 μl). To help dissolve gel, mix by vortexing the tube every 2–3 min during the incubation.
3. After the gel slice has dissolved completely, check that the color of the mixture is yellow (similar to Buffer QG without dissolved agarose).
4. Add 1 gel volume of isopropanol to the sample and mix (actually only needed for very small products or very big products) 5. To bind DNA, apply the sample to the QIAquick column, and centrifuge for 1 min.
6. Discard flow-through and place QIAquick column back in the same collection tube.
7. To wash, add 0.75 ml of Buffer PE to QIAquick column and centrifuge for 1 min.
8. Discard the flow-through and centrifuge the QIAquick column for an additional 1 min at 17,900 x g (13,000 rpm).
9. Place QIAquick column into a clean 1.5 ml microcentrifuge tube.
10. To elute DNA, add 30 μl elution buffer to the center of the QIAquick membrane, let the column stand for 1 min, and then centrifuge for 1 min.

Gel
PCR Overlap
1%, 100V, 1h
Picture: 13/09/24_Overlap PCR PCR SCPR5_SPCR2 - PCR didn't work

PCR Purification (M13 (EcoRI, PstI), SPCR2 (EcoRI, PstI), SPCR5 (XbaI, SpeI))
Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through. Place the QIAquick column back into the same tube
To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 50 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.

PCR (SPCR2, SPCR3, SPCR5, SPCR6, SPCR7, SPCR8, SPCR9, SPCR10, SPCR11, linearize pSB1C3)
each 8x

Reagent	Volume
	1x
Nuclease-free water	37.25 µl
5x Phusion HF Buffer	10 µl
10 mM dNTPs	1 µl
Forward Primer (10 uM)	0.5 µl
Reverse Primer (10 uM)	0.5 µl
Template Plasmid	0.25 µl
Phusion DNA Polymerase	0.5 µl
Total Volume	50 µl

Thermocycler Protocol: Fermentas Phusion
	Temp	Time
Start	98°C	30 sec	Melt

Cycle 1	98°C	5 sec	Melt	35 cycles
Cycle 2		25 sec	Anneal
Cycle 3	72°C	30 sec per kb	Extend

Finish	72 °C	5 min	Extand
Store	10°C	Forever	Store

Liquid culture
NEB, sSP004, Fr-433

Detect

ASDF

Wednesday 25^th September

Gel of PCR, PCR (SPCR5,6) and Miniprep Cas9, M13mp18

Gel of PCR
1%, 100V, 1h

Picture: 13/09/25_SPCR2-11 - SPCR2: worked, SPCR3: worked, SPCR5: didn't work, SPCR6: didn't work, SPCR7: didn't work, SPCR8: didn't work, SPCR9: didn't work, SPCR10: didn't work, SCPR11: worked

PCR (SPCR5,6)

Reagent	Volume
	x1
Nuclease-free water	37.25 µl
5x Phusion HF Buffer	10 µl
10 mM dNTPs	1 µl
Forward Primer (10 uM)	1 µl
Reverse Primer (10 uM)	1 µl
Template Plasmid)	0.25 µl
Phusion DNA Polymerase	0.5 µl
Total Volume	50 µl

Thermocycler Protocol: Fermentas Phusion
	Temp	Time
Start	98°C	30 sec	Melt

Cycle 1	98°C	5 sec	Melt	35 cycles
Cycle 2		25 sec	Anneal
Cycle 3	72°C	30 sec per kb	Extend

Finish	72 °C	5 min	Extand
Store	10°C	Forever	Store

Miniprep Cas9, M13mp18
1) Pellet liquid culture (4000rpm, 10 min)
2) Discard supernatant
3) resuspend the cells in 250ul of resuspension olution
4) add 250ul of lysis solution, mix by inverting 4-6 times
5) add 350ul of neutralization solution
4) centrifuge for 5 min
5) transfer supernatant to spin column
6) centrifuge for 1 min
7) discard flow through
8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)
9) centrifuge for 1 min to remove left over liquid
10) transfer the column on a 1.5ml tube
11) add 50ul of elution buffer and incubate for 2 min
12) centrifuge for 2 min
13) Nanodrop the concentration and freeze at -20°

Detect

ASDF

Thursday 26^th September

Gel PCR 5,6, Digestion, PCR (SPCR7-10) and PCR purification

Gel PCR 5,6 1%, 100V, 1h

Picture: 13/09/26_SPCR5_6 - PCR didn't work

Digestions: SPCR2 (EcoRI, PstI), SPCR3 (EcoRI, PstI), SPCR4 (EcoRI, PstI), SPCR11 (EcoRI, PstI), lin pSB1C3 (EcoRI, PstI), lin pSB1A3 (EcoRI, PstI), SPCR5 (XbaI, SpeI), SPCR7 (XbaI, SpeI), lin pSB1C3 (XbaI, SpeI), in pSB1A3 (XbaI, SpeI)

Reagent	Volume
Purified PCR Product	16 µl
H2O	0 µl
10x FastDigest Buffer	2 µl
FastDigest Enzyme 1	1 µl
FastDigest Enzyme 2	1 µl
Total Volume	20 µl

PCR (SPCR7-10)

Reagent	Volume
	x1
Nuclease-free water	37.25 µl
5x Phusion HF Buffer	10 µl
10 mM dNTPs	1 µl
Forward Primer (10 uM)	1 µl
Reverse Primer (10 uM)	1 µl
Template Plasmid)	0.25 µl
Phusion DNA Polymerase	0.5 µl
Total Volume	50 µl

Thermocycler Protocol: Fermentas Phusion
	Temp	Time
Start	98°C	30 sec	Melt

Cycle 1	98°C	5 sec	Melt	35 cycles
Cycle 2		25 sec	Anneal
Cycle 3	72°C	30 sec per kb	Extend

Finish	72 °C	5 min	Extand
Store	10°C	Forever	Store

PCR Purification: (SPCR2 (EcoRI, PstI), SPCR3 (EcoRI, PstI), SPCR4 (EcoRI, PstI), SPCR11 (EcoRI, PstI), lin pSB1C3 (EcoRI, PstI), lin pSB1A3 (EcoRI, PstI), SPCR5 (XbaI, SpeI), SPCR7 (XbaI, SpeI), lin pSB1C3 (XbaI, SpeI), in pSB1A3 (XbaI, SpeI)

Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through. Place the QIAquick column back into the same tube
To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 50 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.

Detect

ASDF

Friday 27^th September

Gel SPCR7-10, NEB liquid culture, Ligation, Electrocompetent cells and transformation

Gel SPCR7-10
1%, 100V, 1h

Picture: 13/09/27_SPCR7_8_9_10 - PCRs worked

NEB liquid culture
1:1000 of ON culture

Ligation

pS006

Reagent	Volume
SPCR5	1 µl
SPCR7	0,28 µl
H2O	7.22 µl
Fermentas T4 Ligase Buffer	1 µl
Fermentas T4 Ligase Enzime	0.5 µl
Total Volume	10 µl

pS006’

Reagent	Volume
SPCR5	1 µl
lin pSB1C3 (XbaI/SpeI)	0,47 µl
H2O	7.03 µl
Fermentas T4 Ligase Buffer	1 µl
Fermentas T4 Ligase Enzime	0.5 µl
Total Volume	10 µl

pS006*

Reagent	Volume
SPCR5	1 µl
lin pSB1A3 (XbaI/SpeI)	0,67 µl
H2O	6.83 µl
Fermentas T4 Ligase Buffer	1 µl
Fermentas T4 Ligase Enzime	0.5 µl
Total Volume	10 µl

pS013

Reagent	Volume
SPCR4	1 µl
SPCR11	0,24 µl
H2O	7.26 µl
Fermentas T4 Ligase Buffer	1 µl
Fermentas T4 Ligase Enzime	0.5 µl
Total Volume	10 µl

pS013'

Reagent	Volume
lin pSB1C3 (EcoRI, SpeI)	1 µl
SPCR11	0,28 µl
H2O	7.22 µl
Fermentas T4 Ligase Buffer	1 µl
Fermentas T4 Ligase Enzime	0.5 µl
Total Volume	10 µl

pS013*

Reagent	Volume
lin pSB1A3 (EcoRI, PstI))	1 µl
SPCR11	0,3 µl
H2O	7.2 µl
Fermentas T4 Ligase Buffer	1 µl
Fermentas T4 Ligase Enzime	0.5 µl
Total Volume	10 µl

pS004

Reagent	Volume
SPCR4	1 µl
SPCR3	0,2 µl
H2O	7.3 µl
Fermentas T4 Ligase Buffer	1 µl
Fermentas T4 Ligase Enzime	0.5 µl
Total Volume	10 µl

pS004'

Reagent	Volume
lin pSB1C3 (EcoRI, PstI)	1 µl
SPCR3	0,3 µl
H2O	7.2 µl
Fermentas T4 Ligase Buffer	1 µl
Fermentas T4 Ligase Enzime	0.5 µl
Total Volume	10 µl

pS004*

Reagent	Volume
lin pSB1A3 (EcoRI, PstI)	1 µl
SPCR3	0,27 µl
H2O	7.23 µl
Fermentas T4 Ligase Buffer	1 µl
Fermentas T4 Ligase Enzime	0.5 µl
Total Volume	10 µl

pS002'

Reagent	Volume
SPCR2	1 µl
lin pSB1C3 (EcoRI, PstI)	0,8 µl
H2O	6.7 µl
Fermentas T4 Ligase Buffer	1 µl
Fermentas T4 Ligase Enzime	0.5 µl
Total Volume	10 µl

pS002*

Reagent	Volume
SPCR2	1 µl
lin pSB1A3 (EcoRI, PstI)	0,6 µl
H2O	6.9 µl
Fermentas T4 Ligase Buffer	1 µl
Fermentas T4 Ligase Enzime	0.5 µl
Total Volume	10 µl

45min at 22°, 15 min at 16°

Electrocompetent cells
1) Start Culture
2) When the cells reach an OD600 of 0.2.
3) Harvest the cells.
When the cells reach an OD600 of between 0.6 and 0.8 (OD: 0,683)
Centrifuge at 4 °C for 10 min at 4000 rpm.
4) Wash and combine the cells.
Remove the supernatant.
Resuspend the cells in 25 ml of ice cold water
5) Wash the cells 2 more times.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 50 ml of ice cold water.
Repeat.
6) Wash and concentrate the cells for electroporation.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 1-2 ml of ice cold water.
We will use 200 ul of washed cells per transformation.

Transformation
pS006, pS006’, pS006*, pS013, pS013’, pS013*, pS004, pS004’, pS004*, pS002’, pS002*

1) Prepare BD tubes with a pipette filled with LB at the interior of each tube (pipette supplied with the electroporation cuvette)

2) Test the purity of the electrocompetent cells.
Add 200 ul of washed cells to a cuvette.

3) Mix the cells and DNA in a cuvette.
200 ul of washed cells with 200 ng of PCR product.
Keep the cuvette on ice until just before the electroporation.

4) Preload a pipette with 1 ml of LB.

5) Pulse the cuvette with voltage.
Dry the electrodes with a kimwipe prior to loading.
Use the EC2 setting.

6) Listen for arcing.
A cracking sound means all the cells are dead.
Note the time constant: 5 is good, 5.8 is great.

7) Immediately recover the cells.
Add the 1 ml of preloaded LB and pipet up and down to mix.
Collect 1 ml of cells, some volume is lost in the cuvette.

8) Incubate 1/2 h at 37 °C with shaking.

9) Plate 10/200 ul of recovered cells on selective plates.
Use antibiotic appropriate to the part being integrated.
Let the other 900 ul rest overnight at room temperature.

10) Concentrate and plate the remaining cells
Spin down quickly and resuspend in 100 ul LB before plating.

Transformed cells should be incubated at 37 °C.
Colonies should appear 24-48 h after plating.

Detect

ASDF

Saturday 28^th September

Extraction of Genomic DNA, PCR Reaction and Restreak plates

Protocol: E. coli Colony PCR (pS006’, pS006*, pS013, pS004, pS004*, pS002*)

Extraction of Genomic DNA

1) Pick a single colony into 50 ul of H20.
Fresh colonies (grown that day) work best, but they can also come from 4 C.
Pipet 2ul onto plates to have C1-C8
Pipet 2 ul into 5ml Media with antibiotics to make liquid cultures

2) Boil for 5 minutes.
1.5 ul of this can be used directly for PCR.
Best if used directly, but can also be stored at 4 C for a few days.

PCR Reaction

Keep all the reagents at 4 °C while preparing the mixture.
Pre-heat the thermocycler to 95 °C and transfer your reaction directly from 4 °C.

Reagent	Volume	9x Volume
Forward Primer (10 uM)	0.5 µl	4.5 µl
Reverse Primer (10 uM)	0.5 µl	4.5 µl
Template DNA (from above)	1.5 µl	13.5 µl
Quick-Load® Taq 2X Master Mix	12.5 µl	112.5 µl9x Volume
Nuclease-free water	10 µl	90 µl
Total Volume	25 µl	125 µl

Thermocycler Protocol: Green Dream Taq
	Temp	Time
Start	95°C	30 sec	Melt

Cycle 1	95°C	15 sec	Melt	35 cycles
Cycle 2	46.8°C	30 sec	Anneal
Cycle 3	72°C	1 min per kb	Extend

Finish	72 °C	10 min	Extand
Store	10°C	Forever	Store

Restreak plates
Some of the plates were too full grown -> Rstreak for single colonies

Detect

ASDF

Monday 30^th September

Extraction of Genomic DNA, PCR reaction, Gels, Miniprep, PCR: SPCR5, SPCR6 and Liquid culture of pS004’ and pS013’

Protocol: E. coli Colony PCR (pS006, pS013’,pS013*, pS004’, pS002’)

Extraction of Genomic DNA

1) Pick a single colony into 50 ul of H20.
Fresh colonies (grown that day) work best, but they can also come from 4 C.
Pipet 2ul onto plates to have C1-C8

2) Boil for 5 minutes.
1.5 ul of this can be used directly for PCR.
Best if used directly, but can also be stored at 4 C for a few days.

PCR Reaction

Keep all the reagents at 4 °C while preparing the mixture.
Pre-heat the thermocycler to 95 °C and transfer your reaction directly from 4 °C.

Reagent	Volume	9x Volume
Forward Primer (10 uM)	0.5 µl	4.5 µl
Reverse Primer (10 uM)	0.5 µl	4.5 µl
Template DNA (from above)	1.5 µl	13.5 µl
Quick-Load® Taq 2X Master Mix	12.5 µl	112.5 µl9x Volume
Nuclease-free water	10 µl	90 µl
Total Volume	25 µl	125 µl

Thermocycler Protocol: Green Dream Taq
	Temp	Time
Start	95°C	30 sec	Melt

Cycle 1	95°C	15 sec	Melt	35 cycles
Cycle 2	46.8°C	30 sec	Anneal
Cycle 3	72°C	1 min per kb	Extend

Finish	72 °C	10 min	Extand
Store	10°C	Forever	Store

Gels
1%, 100V, 45 min

Pictures + Results
13/09/30_colony pcr_pS004_pS013 - 1-8: pS004 (gRNA - Amp), 9-16: pS013 (crRNA - Amp) - seems to have worked beside pS013 C7

13/09/30_colony PCR_pS004*_pS002* - 1-8: pS004* (gRNA - Amp), 9-16: pS002 (reporter - Amp) - pS004* seems to have worked (C1, C2, C3, C6)

13/09/30_colony PCR_pS006'_pS006* - 1-8: pS006' (Cas9 - Chl), 9-16: pS006* (Cas9 - Amp) - didn’t work

13/09/30_Colony PCR_pS013'_pS013* - 1-8: pS013' (crRNA - Chl), 9-16: pS013* (crRNA - Amp) - Seems to have worked beside 13’ C7, C8

13/09/30_colony PCR_pS004'_pS002' - 1-8: pS004' (gRNA - Chl), 9-16: pS002' (reporter - Chl) - pS004' seems to have worked beside C6

13/09/30_Colony PCR_pS006 - didn’t work

other gel images that proof that the reporter as well as the Cas9 construct worked will follow soon!

Miniprep
pS013, pS004
1) Pellet liquid culture (4000rpm, 10 min)
2) Discard supernatant
3) resuspend the cells in 250ul of resuspension olution
4) add 250ul of lysis solution, mix by inverting 4-6 times
5) add 350ul of neutralization solution
4) centrifuge for 5 min
5) transfer supernatant to spin column
6) centrifuge for 1 min
7) discard flow through
8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)
9) centrifuge for 1 min to remove left over liquid
10) transfer the column on a 1.5ml tube
11) add 50ul of elution buffer and incubate for 2 min
12) centrifuge for 2 min
13) Nanodrop the concentration and freeze at -20°

PCR: SPCR5, SPCR6 (gradient + touch down 55-75, -1°/cycle)

Reagent	Volume
	11x
Nuclease-free water	37.25 µl
5x Phusion HF Buffer	10 µl
10 mM dNTPs	1 µl
Forward Primer (10 uM)	0.5 µl
Reverse Primer (10 uM)	0.5 µl
Template Plasmid)	0.25 µl
Phusion DNA Polymerase	0.5 µl
Total Volume	50 µl

Thermocycler Protocol: Fermentas Phusion
	Temp	Time
Start	98°C	30 sec	Melt

Cycle 1	98°C	5 sec	Melt	35 cycles
Cycle 2		25 sec	Anneal
Cycle 3	72°C	30 sec per kb	Extend

Finish	72 °C	5 min	Extand
Store	10°C	Forever	Store

Liquid culture of pS004’ and pS013’

Detect

ASDF

Tuesday 1^st October

Miniprep pS013’, pS004’

1) Pellet liquid culture (4000rpm, 10 min)
2) Discard supernatant
3) resuspend the cells in 250ul of resuspension olution
4) add 250ul of lysis solution, mix by inverting 4-6 times
5) add 350ul of neutralization solution
4) centrifuge for 5 min
5) transfer supernatant to spin column
6) centrifuge for 1 min
7) discard flow through
8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)
9) centrifuge for 1 min to remove left over liquid
10) transfer the column on a 1.5ml tube
11) add 50ul of elution buffer and incubate for 2 min
12) centrifuge for 2 min
13) Nanodrop the concentration and freeze at -20°

Detect

ASDF

Wednesday 2^nd October

Preparation killing assay

Liquid cultures
R16, R26, R26f, delta PyrF, parental delta PyrF, NEB, M13, Litmus + Helper, Litmus GFP + helper

Detect

ASDF

Wedsnesday 3^rd October

Killing assay to test specifity of CRISPR Cas

Electrocompetent cells (delta PyrF, parental, NEB)
1) Start Culture
2) When the cells reach an OD600 of 0.2.
3) Harvest the cells.
When the cells reach an OD600 of between 0.6 and 0.8 (OD: 0,683)
Centrifuge at 4 °C for 10 min at 4000 rpm.
4) Wash and combine the cells.
Remove the supernatant.
Resuspend the cells in 25 ml of ice cold water
5) Wash the cells 2 more times.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 50 ml of ice cold water.
Repeat.
6) Wash and concentrate the cells for electroporation.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 1-2 ml of ice cold water.
We will use 200 ul of washed cells per transformation.

Transformation
Cotransform into parental/keio delta pyRF: pS006* (Cas9 in Amp BB) + pS004'(gRNA in Chl BB).
1) Prepare BD tubes with a pipette filled with LB at the interior of each tube (pipette supplied with the electroporation cuvette)
2) Test the purity of the electrocompetent cells.
Add 200 ul of washed cells to a cuvette.
3) Mix the cells and DNA in a cuvette.
200 ul of washed cells with 200 ng of PCR product.
Keep the cuvette on ice until just before the electroporation.
4) Preload a pipette with 1 ml of LB.
5) Pulse the cuvette with voltage.
Dry the electrodes with a kimwipe prior to loading.
Use the EC2 setting.
6) Listen for arcing.
A cracking sound means all the cells are dead.
Note the time constant: 5 is good, 5.8 is great.
7) Immediately recover the cells.
Add the 1 ml of preloaded LB and pipet up and down to mix.
Collect 1 ml of cells, some volume is lost in the cuvette.
8) Incubate 1/2 h at 37 °C with shaking.
9) Plate 10/200 ul of recovered cells on selective plates.
Use antibiotic appropriate to the part being integrated.
Let the other 900 ul rest overnight at room temperature.
10) Concentrate and plate the remaining cells
Spin down quickly and resuspend in 100 ul LB before plating.
Transformed cells should be incubated at 37 °C.
Colonies should appear 24-48 h after plating.

Plating of 10/100ul on
1. Amp plates -> selection for only Cas9
2. Chl plates -> selection for only gRNA
3. Amp/Chl plates -> selection for theoretically functional system

Detect

ASDF

Monday 14^th October

Liquid cultures sSP008, sSP009, R16, R26, R26f, sT007, sSP021, SCPR2-A3, SPCE2-C3

Detect

ASDF

Tuesday 15^th October

Digestion Reporter and SPCR3

BB: SpeI, PstI
SPCR: XbaI, PstI
2h 37°, heat inactivation

Electrocompetent cells: sSP008, sSP009
Transform SPCR2-A3/C3 both into sSP008/9

Detect

ASDF

Wednesday 16^th October

Miniprep of pS002, pS002’, pS006* Liquid culture sSP017, pS004, pS004’ Glycerols

Detect

ASDF

Thursday 17^th October

Place your twit here

Miniprep sSP017, pS004, pS004’

Digest Litmus pS018 EcoRI/PstI, EcoRI/XbaI 2h 37° shaking

PCR purify

Ligation:
1. gRNA+phagmid (10,4+6)
2.phagemid+gRNA+reporter (9,6+1,86+2)
3.phagemid+gRNA+Cas9 (10,2+2,04+3)

1h at 22°

Transform
Heat shock, cells matt
Recover, plate

Detect

ASDF

Friday 18^th October

Miller assay and Liquid phagemid

Place your note here

Detect

ASDF

Saturday 19^th October

Miller
Miniprerp phagemid
Digest phagemid E/P, E/X, SPCR3 E,P

Detect

ASDF

Tuesday 22^nd October

Liquid for Miller and Digest&purify SPCR3 E,P

Detect

ASDF

Thursday 24^th October

Digest phagemid E/P
Purify it

Ligation:
1. SPCR3 E/P + phagemid E/P
2. SPCR3 E/P + SPCR5 P/X+ phagemid E/X
2. SPCR3 E/P + SPCR2 P/X+ phagemid E/X

trafo Ligations

electrocmpetent cells parental+sSP009+pS002’
trafo:
1. parental+pS002
2. parental+pS002’
3. parental+pS006*
4. parental+pS002’+pS006*
5. sSP009 pS002’ + pS006*

trafo helper into NEB

liquid cultures: sSP009, pRECA strains Ariel, sSP008+pS002, sSP008+pS002’

Detect

ASDF

Friday 25^th October

Colony PCR
Liquid Cloning

Liquid: NEB helper, parental pS002, parental pS006*, sSP008+pS002, sSP008+pS002’

Trafo: NEB helper+phageid-gRNA, parental ps006*+pS002’, pyrfF F+ pS002’+pS006*

conjugation of parental pS006* with pS009

Miniprep phagemid gRNA

Liquid library
Restreak for library

1) sSP008+pS002/pS002’ +Xgal
2) sSP008+pS002/pS002’ +Xgal + MMC
3) sSP008+pS002/pS002’ +MMC

Target

ASDF

Monday 10^th June

Design of SirA genes for synthesis

SirA

Mycobacterium tuberculosis
Reference: Pinto et al. 2007. Sulfite Reduction in Mycobacteria doi: 10.1128/JB.00487-07
Primers:
TBsirA F GGAATTCCATATGTCCGCGAAGGAGAACCCC
TBsirA R AAGGAAAAAAGCGGCCGCTCATCGCAGGTCGTCCTCCTCGGCCCGGAT
We blasted the above primers used to clone sirA from M. tuberculosis into E. coli. We then extracted the sequence from genbank to retrieve the following sequence which includes the restriction sites introduced by Pinto et al.

ggaattccat atgtccgcga aggagaaccc ccaaatgacc actgcacgtc
ccgccaaggc tcgaaatgag ggccagtggg cgctgggaca tcgcgagcca
ctcaacgcca acgaagagct gaagaaggcc ggcaacccgc tcgacgtgcg
ggagcgcatc gaaaacatct acgccaaaca gggtttcgac agcatcgaca
agaccgacct gcgagggcgc tttcgctggt ggggcctgta cacccagcgt
gagcagggct acgacggcac ctggaccggt gacgacaaca tcgacaagct
cgaggccaaa tacttcatga tgcgggtgcg ttgcgacggc ggcgcgctct
cggctgccgc gctgcgcacg ctgggccaga tctcgacgga gttcgcgcgc
gataccgccg atatctccga ccggcagaac gtgcaatacc actggatcga
agtggaaaac gtccctgaaa tctggcgacg gttagacgat gtcggactgc
agaccaccga ggcgtgcggt gactgcccgc gggtagtgct gggctcgccg
ttggccggcg agtcgctcga cgaagtgctc gacccgacct gggcgatcga
ggagatcgtg cgtcgctaca tcggcaagcc cgacttcgcc gacttgccgc
gcaagtacaa gaccgccatc tctggcctgc aggacgtcgc gcacgagatc
aacgacgtcg ccttcatcgg cgtcaaccat cccgagcacg gaccaggcct
ggatctgtgg gtgggcggtg gactgtcgac caacccgatg ctggcccagc
gggtcggcgc ctgggttcca ctgggcgaag tgcccgaggt gtgggcggcg
gtcacctcgg tgtttcgcga ctacggctac cggcgactgc gcgccaaggc
ccggctgaaa tttctgatca aagactgggg catagcgaag ttccgcgaag
tgctcgaaac cgagtacctc aagcgtccgc tgatcgacgg tccggccccc
gaaccggtca agcatccgat cgaccacgtc ggggtgcaac gactcaagaa
cgggctcaac gccgtcggag tcgcccccat cgccgggcgg gtatcgggca
ccatcctcac ggcggtcgcc gacctgatgg cgcgggccgg ttccgaccgg
atccggttca ccccctacca gaagctggtc atcctcgaca ttccggacgc
cttgctcgac gacttgatcg ccggtctgga cgcgctgggg ctgcagtcgc
gcccgtcgca ttggcgccgg aacttgatgg cgtgcagcgg gattgagttc
tgcaagttgt cattcgccga aacccgggtt cgagcacagc atttggtgcc
cgagctggaa cgccggcttg aggacatcaa ctcgcagctc gacgtaccga
tcaccgtcaa catcaacggc tgcccgaact catgtgcgcg aattcaaatc
gccgacatcg gattcaaggg acagatgatc gacgacggac acggcggctc
cgtcgaaggc ttccaggtgc atctgggcgg acacctcggc ctggatgccg
gattcggccg caaactgcgc cagcacaagg tcaccagtga cgaactcggc
gactacatcg accgggtggt gcgcaacttc gtcaaacacc gcagcgaagg
tgaacgcttc gcgcagtggg tcatccgggc cgaggaggac gacctgcgat
gagcggccgc ttttttcctt

This sequence was then inserted into Geneious. The PstI and EcoRI sites were manually removed and replaced with silent mutations. A NcoI site was inserted at the start codon and an extra glycine was added after the start codon for the NcoI site to function properly. We chose glycine as it is small an unlikely to interfere with either polar or non-polar domains within the protein. We used GGC as the codon as it is the highest used glycine codon in e. coli. We also added an AvrII site on the 3’ end of the site. We then added biobrick restriction sites on the ends of the sequence (EcoRI, XbaI, SpeI, PstI). This will allow us to clone into our expression vector pACYCDuet-1 with NcoI and AvrII enzymes and into a biobrick registry with EcoRI and PstI. The insertion into pACYCDuet-1 removes both protein tags and cuts out the second MCS resulting in vector pACYCDuet-TBsirA. The resulting sequence for TB SirA follows:

catggaattc tagaccatgg gctccgcgaa ggagaacccc caaatgacca
ctgcacgtcc cgccaaggct cgaaatgagg gccagtgggc gctgggacat
cgcgagccac tcaacgccaa cgaagagctg aagaaggccg gcaacccgct
cgacgtgcgg gagcgcatcg aaaacatcta cgccaaacag ggtttcgaca
gcatcgacaa gaccgacctg cgagggcgct ttcgctggtg gggcctgtac
acccagcgtg agcagggcta cgacggcacc tggaccggtg acgacaacat
cgacaagctc gaggccaaat acttcatgat gcgggtgcgt tgcgacggcg
gcgcgctctc ggctgccgcg ctgcgcacgc tgggccagat ctcgacggag
ttcgcgcgcg ataccgccga tatctccgac cggcagaacg tgcaatacca
ctggatcgaa gtggaaaacg tccctgaaat ctggcgacgg ttagacgatg
tcggacttca gaccaccgag gcgtgcggtg actgcccgcg ggtagtgctg
ggctcgccgt tggccggcga gtcgctcgac gaagtgctcg acccgacctg
ggcgatcgag gagatcgtgc gtcgctacat cggcaagccc gacttcgccg
acttgccgcg caagtacaag accgccatct ctggccttca ggacgtcgcg
cacgagatca acgacgtcgc cttcatcggc gtcaaccatc ccgagcacgg
accaggcctg gatctgtggg tgggcggtgg actgtcgacc aacccgatgc
tggcccagcg ggtcggcgcc tgggttccac tgggcgaagt gcccgaggtg
tgggcggcgg tcacctcggt gtttcgcgac tacggctacc ggcgactgcg
cgccaaggcc cggctgaaat ttctgatcaa agactggggc atagcgaagt
tccgcgaagt gctcgaaacc gagtacctca agcgtccgct gatcgacggt
ccggcccccg aaccggtcaa gcatccgatc gaccacgtcg gggtgcaacg
actcaagaac gggctcaacg ccgtcggagt cgcccccatc gccgggcggg
tatcgggcac catcctcacg gcggtcgccg acctgatggc gcgggccggt
tccgaccgga tccggttcac cccctaccag aagctggtca tcctcgacat
tccggacgcc ttgctcgacg acttgatcgc cggtctggac gcgctggggc
ttcagtcgcg cccgtcgcat tggcgccgga acttgatggc gtgcagcggg
attgagttct gcaagttgtc attcgccgaa acccgggttc gagcacagca
tttggtgccc gagctggaac gccggcttga ggacatcaac tcgcagctcg
acgtaccgat caccgtcaac atcaacggct gcccgaactc atgtgcgcga
gttcaaatcg ccgacatcgg attcaaggga cagatgatcg acgacggaca
cggcggctcc gtcgaaggct tccaggtgca tctgggcgga cacctcggcc
tggatgccgg attcggccgc aaactgcgcc agcacaaggt caccagtgac
gaactcggcg actacatcga ccgggtggtg cgcaacttcg tcaaacaccg
cagcgaaggt gaacgcttcg cgcagtgggt catccgggcc gaggaggacg
acctgcgatg agcggccgcc taggactact agtctgcagt ttttcctt

Mycobacterium smegmatis
This reference also contains the cloning of sirA from T. smegmatis. We used the primers below taken from Pinto et al, blasted against the T. smegmatis genome and extracted the sirA sequence from genbank as above.
Primers:
smegsirA F TACAGCTGATGCTCGAAGACGAGTACTTCAT
smegsirA R CCCAAGCTTTCACGTTGCCTACCTCAAATCCGCTTCGTC

tacagctgat gctcgaagac gagtacttca tgctgcgcgt gcgctgcgat
ggtggcgcgc tgaccactgc agcgctgcgc acgctcggcg gcatctcgac
cgagttcgcg cgcgacaccg ccgacatctc cgaccgcgag aacgtccagt
accactggat ccaggtcgag aacatgcccg agatctggaa gcgcctcgac
gccgtcggcc tgcagaccac cgaggcgtgc ggcgactgcc cgcgtgtggt
cctcggctcg ccgctggccg gtgagtccct cgacgaggtg atcgacggga
cccccgcgat cgacgagatc gtgcgccgct acatcggcaa gcccgagtac
tcgaacctgc cgcgcaagtt caagaccgcg atctcggggc ttcaggacgt
ggtccacgag gtcaacgacg tcgcgttcat cggcgtcaac caccccgagc
acggcccggg cttcgacctg tgggtcggtg gcggcctgtc gaccaacccg
atgctggccc agcgcgtcgg ggtgtgggtg ccgctcgacg aggtgcccga
cgtctgggag ggcgtcgtca gcatcttccg cgactacggt taccggcgtc
tgcggtcgaa ggcgcggctg aagttcctga tcaaggactg gggcgtcgaa
aagttcaggg aagtgctgga aaccgagtac ctcaagcgcc ccctgatcga
cggcccggca cccgaaccgg tgacccgccc catcgaccac gtcggtgtgc
agaagctcaa gaacggcctc aacgccgtgg gcgtcgcccc gatcgcgggt
cgcgtctcgg gcacgatcct gaccaaggtg gccgatctcg ccgaggccgc
cgggtccgac cggatccgct tcacgccgta ccagaagctg atcatcctcg
acgtgcccga cgacaagatc gacgaactgc gcgctggcct cgacgcgctc
ggactgccgt cgacgccgtc gcactggcgc cgcaacctca tggcgtgcac
gggtatcgag ttctgcaagc tgagcttcgc cgagacccgc aagcgtgccc
aggtgctggt tcccgagctg gagaaacggc tcgacgacat caacgcccag
ctcgacgtgc ccatcacggt caacatcaac ggctgcccca actcgtgcgc
ccgtatccag gtcgccgaca tcgggttcaa gggccagatg gtcgacgatg
gcaacggccc cgaggagggt ttccaggtgc atctgggcgg cagcctgggc
ctggacagcg ggttcggccg caagctgcgc cagcacaagg tgctctcgtc
cgagctcggc gactacatcg agcgcgtcgt gcgcaacttc gtgaaacaac
gcgaggacgg cgagcgtttc gcccagtggg ccgtgcgggc cgacgaagcg
gatttgaggt aggcaacgtg aaagcttggg

As above, the sequence was imported into geneious, the biobrick restriction sites were manually removed from the sequence and restriction sites were added to the 5’ and 3’ ends in the same fashion as TB sirA. This resulted in the following sequence for synthesis:

tacagaattc tagaccatgg gcctcgaaga cgagtacttc atgctgcgcg
tgcgctgcga tggtggcgcg ctgaccacta cagcgctgcg cacgctcggc
ggcatctcga ccgagttcgc gcgcgacacc gccgacatct ccgaccgcga
gaacgtccag taccactgga tccaggtcga gaacatgccc gagatctgga
agcgcctcga cgccgtcggc ctacagacca ccgaggcgtg cggcgactgc
ccgcgtgtgg tcctcggctc gccgctggcc ggtgagtccc tcgacgaggt
gatcgacggg acccccgcga tcgacgagat cgtgcgccgc tacatcggca
agcccgagta ctcgaacctg ccgcgcaagt tcaagaccgc gatctcgggg
cttcaggacg tggtccacga ggtcaacgac gtcgcgttca tcggcgtcaa
ccaccccgag cacggcccgg gcttcgacct gtgggtcggt ggcggcctgt
cgaccaaccc gatgctggcc cagcgcgtcg gggtgtgggt gccgctcgac
gaggtgcccg acgtctggga gggcgtcgtc agcatcttcc gcgactacgg
ttaccggcgt ctgcggtcga aggcgcggct gaagttcctg atcaaggact
ggggcgtcga aaagttcagg gaagtgctgg aaaccgagta cctcaagcgc
cccctgatcg acggcccggc acccgaaccg gtgacccgcc ccatcgacca
cgtcggtgtg cagaagctca agaacggcct caacgccgtg ggcgtcgccc
cgatcgcggg tcgcgtctcg ggcacgatcc tgaccaaggt ggccgatctc
gccgaggccg ccgggtccga ccggatccgc ttcacgccgt accagaagct
gatcatcctc gacgtgcccg acgacaagat cgacgaactg cgcgctggcc
tcgacgcgct cggactgccg tcgacgccgt cgcactggcg ccgcaacctc
atggcgtgca cgggtatcga gttctgcaag ctgagcttcg ccgagacccg
caagcgtgcc caggtgctgg ttcccgagct ggagaaacgg ctcgacgaca
tcaacgccca gctcgacgtg cccatcacgg tcaacatcaa cggctgcccc
aactcgtgcg cccgtatcca ggtcgccgac atcgggttca agggccagat
ggtcgacgat ggcaacggcc ccgaggaggg tttccaggtg catctgggcg
gcagcctggg cctggacagc gggttcggcc gcaagctgcg ccagcacaag
gtgctctcgt ccgagctcgg cgactacatc gagcgcgtcg tgcgcaactt
cgtgaaacaa cgcgaggacg gcgagcgttt cgcccagtgg gccgtgcggg
ccgacgaagc ggatttgagg taggcaacgt gaaagcctag gtactagtct
gcagtggg

Target

ASDF

Tuesday 11^th June

Design of FdrA genes for synthesis

FdrA

Mycobacterium tuberculosis
Reference: McLean et al. 2003. Kinetic, spectroscopic and thermodynamic characterization of the Mycobacterium tuberculosis adrenodoxin reductase homologue FprA. doi: 10.1042/BJ20021692
Primers:
MtbfdrA F TATGACTCATATGCGTCCCTATTACATCGCCATCG
MtbfdrA R ATCCGGGATCCTCAGCCGAGCCCAATCCGCAACAGC
The above primers were blasted to retrieve sequence of FprA from genebank resulting in the following sequence:

tatgactcat atgcgtccct attacatcgc catcgtgggc tccgggccgt
cggcgttctt cgccgcggca tccttgctga aggccgccga cacgaccgag
gacctcgaca tggccgtcga catgctggag atgttgccga ctccctgggg
gctggtgcgc tccggggtcg cgccggatca ccccaagatc aagtcgatca
gcaagcaatt cgaaaagacg gccgaggacc cccgcttccg cttcttcggc
aatgtggtcg tcggcgaaca cgtccagccc ggcgagctct ccgagcgcta
cgacgccgtg atctacgccg tcggcgcgca gtccgatcgc atgttgaaca
tccccggtga ggacctgccg ggcagtatcg ccgccgtcga tttcgtcggc
tggtacaacg cacatccaca cttcgagcag gtatcacccg atctgtcggg
cgcccgggcc gtagttatcg gcaatggaaa cgtcgcgcta gacgtggcac
ggattctgct caccgatccc gacgtgttgg cacgcaccga tatcgccgat
cacgctttgg aatcgctacg cccacgcggt atccaggagg tggtgatcgt
cgggcgccga ggtccgctgc aggccgcgtt caccacgttg gagttgcgcg
agctggccga cctcgacggg gttgacgtgg tgatcgatcc ggcggagctg
gacggcatta ccgacgagga cgcggccgcg gtgggcaagg tctgcaagca
gaacatcaag gtgctgcgtg gctatgcgga ccgcgaaccc cgcccgggac
accgccgcat ggtgttccgg ttcttgacct ctccgatcga gatcaagggc
aagcgcaaag tggagcggat cgtgctgggc cgcaacgagc tggtctccga
cggcagcggg cgagtggcgg ccaaggacac cggcgagcgc gaggagctgc
cagctcagct ggtcgtgcgg tcggtcggct accgcggggt gcccacgccc
gggctgccgt tcgacgacca gagcgggacc atccccaacg tcggcggccg
aatcaacggc agccccaacg aatacgtcgt cgggtggatc aagcgcgggc
cgaccggggt gatcgggacc aacaagaagg acgcccaaga caccgtcgac
accttgatca agaatcttgg caacgccaag gagggcgccg agtgcaagag
ctttccggaa gatcatgccg accaggtggc cgactggcta gcagcacgcc
agccgaagct ggtcacgtcg gcccactggc aggtgatcga cgctttcgag
cgggccgccg gcgagccgca cgggcgtccc cgggtcaagt tggccagcct
ggccgagctg ttgcggattg ggctcggctg aggatcccgg at

As previously, the sequence was imported into geneious, the biobrick restriction sites were manually removed from the sequence and restriction sites were added to the 5’ and 3’ ends in the same fashion as TB sirA. However, in the case of FdrA, the restriction sites added for cloning into the vector pCOLAduet-1 were NdeI and AvrII. As a result, there was no need to add an additional glycine after the start codon. The resulting sequence is as follows:

tatgaattct agatcatatg cgtccctatt acatcgccat cgtgggctcc
gggccgtcgg cgttcttcgc cgcggcatcc ttgctgaagg ccgccgacac
gaccgaggac ctcgacatgg ccgtcgacat gctggagatg ttgccgactc
cctgggggct ggtgcgctcc ggggtcgcgc cggatcaccc caagatcaag
tcgatcagca agcaattcga aaagacggcc gaggaccccc gcttccgctt
cttcggcaat gtggtcgtcg gcgaacacgt ccagcccggc gagctctccg
agcgctacga cgccgtgatc tacgccgtcg gcgcgcagtc cgatcgcatg
ttgaacatcc ccggtgagga cctgccgggc agtatcgccg ccgtcgattt
cgtcggctgg tacaacgcac atccacactt cgagcaggta tcacccgatc
tgtcgggcgc ccgggccgta gttatcggca atggaaacgt cgcgctagac
gtggcacgga ttctgctcac cgatcccgac gtgttggcac gcaccgatat
cgccgatcac gctttggaat cgctacgccc acgcggtatc caggaggtgg
tgatcgtcgg gcgccgaggt ccgcttcagg ccgcgttcac cacgttggag
ttgcgcgagc tggccgacct cgacggggtt gacgtggtga tcgatccggc
ggagctggac ggcattaccg acgaggacgc ggccgcggtg ggcaaggtct
gcaagcagaa catcaaggtg ctgcgtggct atgcggaccg cgaaccccgc
ccgggacacc gccgcatggt gttccggttc ttgacctctc cgatcgagat
caagggcaag cgcaaagtgg agcggatcgt gctgggccgc aacgagctgg
tctccgacgg cagcgggcga gtggcggcca aggacaccgg cgagcgcgag
gagctgccag ctcagctggt cgtgcggtcg gtcggctacc gcggggtgcc
cacgcccggg ctgccgttcg acgaccagag cgggaccatc cccaacgtcg
gcggccgaat caacggcagc cccaacgaat acgtcgtcgg gtggatcaag
cgcgggccga ccggggtgat cgggaccaac aagaaggacg cccaagacac
cgtcgacacc ttgatcaaga atcttggcaa cgccaaggag ggcgccgagt
gcaagagctt tccggaagat catgccgacc aggtggccga ctggctagca
gcacgccagc cgaagctggt cacgtcggcc cactggcagg tgatcgacgc
tttcgagcgg gccgccggcg agccgcacgg gcgtccccgg gtcaagttgg
ccagcctggc cgagctgttg cggattgggc tcggctgagg atccctagga
ctagtctgca gttacg

Mycobacterium smegmatis
We didn't find a reference of M. Smegmatis FprA being cloned into E. coli so we used the following sequenced data:

atgcgcccgt accacgtagc gatcgtcggc tcaggaccct ccggattctt
tgctgccgca tcgctgctga agtttgccga ctctcaaccc gaccgcgatg
tccgcgtgga catgctcgag atgctgccga ccccgtgggg tctggtgcgc
tccggcgtcg ctcccgacca tccgaagatc aagtcgatca gcgcccagtt
cgagaagacc gcggccgacc cccgcttccg gttcttcggc aacgtccggg
tcggtgagca cgtccaaccg ggcgaactcg ccgaacgcta cgacgccgtc
gtctacgcca ccggcgcaca gtccgaccgc gcgctgaaca tccccggcga
ggagctgccg ggcagcgtcg cggccgtcga cttcgtgggt tggtacaacg
cgcatccgca tttccgcgag atggcgcccg atctctccgg cgggcgcgcc
gtggtggtcg gcaacggcaa cgtcgcactc gatgtcgcac gcatcctggt
cagcgatccg aaggcgttgg ccaacaccga cattgccgac catgcgctgg
acaagctgga cacgcgcggt gtggacgagg tcgtggtgct cggccggcgt
ggtccgctgc aggcgacgtt caccacgctg gagttgcgtg aactcggcga
catggagggc ctcggcgacg tcgacgtgat cctggatccg gccgatttcg
ccgacatcac cgacgaggat ctcgaagccg cgggcaagac cgtcaagcag
aacatcaagg tgctgcgcgg ttacgccgag cgggaaccgc gaggcgccaa
gcggcgcatc gtgttccggt tcttcacctc accgatcgag ctgcgcggcg
aggaccgcgt ggaatcgatc gtgttgggac gcaacgaact cgtgcgcggc
gccgacggca ggatggtggc caaggacacc ggtgagcgcg aagaactgcc
ggcacagctg gtggtgcgtg cggtcggata ccgcggcgtg ccgactccag
gcctgccgtt cgacgagcgt tcgggcacca tcccgcacac cgacggccgc
gtcgagggca gcgccaacga gtacgtggtg ggctggatca agcgcggacc
gtccggcgtc atcggcagca acaagaagga ctcacaggac accgtcaaca
ccctgctcga cgacctcgcc gcggcccggc tgccccagcg cgggcccgac
cactccgaga agctcgcggc gtggttgctg gaacgtcagc ccaaggtggt
cacgggcgag cactggaagc tgatcgacga ctacgagcgc gccgcgggcg
aaccgaccgg ccgaccccgg gtgaagctgg cgagcgtggc tgaactgctg
cgcgtgggcc acggctga

As above, the sequence was imported into geneious, the biobrick restriction sites were manually removed from the sequence and restriction sites were added to the 5’ and 3’ ends in the same fashion as TB sirA. Again, the restriction sites added for cloning into the vector pCOLAduet-1 were NdeI and AvrII. As a result, there was no need to add an additional glycine after the start codon. The resulting sequence is as follows:

tatgaattct agatcatatg cgcccgtacc acgtagcgat cgtcggctca
ggaccctccg gattctttgc tgccgcatcg ctgctgaagt ttgccgactc
tcaacccgac cgcgatgtcc gcgtggacat gctcgagatg ctgccgaccc
cgtggggtct ggtgcgctcc ggcgtcgctc ccgaccatcc gaagatcaag
tcgatcagcg cccagttcga gaagaccgcg gccgaccccc gcttccggtt
cttcggcaac gtccgggtcg gtgagcacgt ccaaccgggc gaactcgccg
aacgctacga cgccgtcgtc tacgccaccg gcgcacagtc cgaccgcgcg
ctgaacatcc ccggcgagga gctgccgggc agcgtcgcgg ccgtcgactt
cgtgggttgg tacaacgcgc atccgcattt ccgcgagatg gcgcccgatc
tctccggcgg gcgcgccgtg gtggtcggca acggcaacgt cgcactcgat
gtcgcacgca tcctggtcag cgatccgaag gcgttggcca acaccgacat
tgccgaccat gcgctggaca agctggacac gcgcggtgtg gacgaggtcg
tggtgctcgg ccggcgtggt ccgcttcagg cgacgttcac cacgctggag
ttgcgtgaac tcggcgacat ggagggcctc ggcgacgtcg acgtgatcct
ggatccggcc gatttcgccg acatcaccga cgaggatctc gaagccgcgg
gcaagaccgt caagcagaac atcaaggtgc tgcgcggtta cgccgagcgg
gaaccgcgag gcgccaagcg gcgcatcgtg ttccggttct tcacctcacc
gatcgagctg cgcggcgagg accgcgtgga atcgatcgtg ttgggacgca
acgaactcgt gcgcggcgcc gacggcagga tggtggccaa ggacaccggt
gagcgcgaag aactgccggc acagctggtg gtgcgtgcgg tcggataccg
cggcgtgccg actccaggcc tgccgttcga cgagcgttcg ggcaccatcc
cgcacaccga cggccgcgtc gagggcagcg ccaacgagta cgtggtgggc
tggatcaagc gcggaccgtc cggcgtcatc ggcagcaaca agaaggactc
acaggacacc gtcaacaccc tgctcgacga cctcgccgcg gcccggctgc
cccagcgcgg gcccgaccac tccgagaagc tcgcggcgtg gttgctggaa
cgtcagccca aggtggtcac gggcgagcac tggaagctga tcgacgacta
cgagcgcgcc gcgggcgaac cgaccggccg accccgggtg aagctggcga
gcgtggctga actgctgcgc gtgggccacg gctgacctag gactagtctg
cagttacg

Target

ASDF

Wednesday 12^th June

Design of FdxC and FdxA genes for synthesis

FdxC

Mycobacterium tuberculosis
Reference: Cole, S.T. et al. 1998. Deciphering the biology of Mycobacterium tuber- culosis from the complete genome sequence. doi:10.1038/31159.
We couldn’t find a reference of FdxC being cloned into E. coli and so we took the sequence data from genbank which is as follows:

gtgacgtaca cgatcgccga accctgtgtc gacatcaagg acaaggcatg
cattgaggag tgcccggtcg attgcatcta cgagggcgcc cggatgctgt
atatccaccc cgacgaatgc gtcgactgtg gggcttgcga gccggtctgc
cccgttgaag ctatcttcta cgaagacgat gtgcccgaac agtggagcca
ttacacccag atcaacgccg atttcttcgc cgagctggga tcgccgggcg
gtgcggccaa ggttggcatg accgagaacg acccgcaagc ggtcaaggat
ctggcgccgc agagcgagga cgcctga

The Gtg was replaced with the NcoI cut site and a glycine codon (ccatgggc) and a HindIII site was added to the end of the sequence. The biobrick restriction sites were then added to the ends of the sequence resulting in the following sequence:

cttagaattc tagaccatgg gcacgtacac gatcgccgaa ccctgtgtcg
acatcaagga caaggcatgc attgaggagt gcccggtcga ttgcatctac
gagggcgccc ggatgctgta tatccacccc gacgaatgcg tcgactgtgg
ggcttgcgag ccggtctgcc ccgttgaagc tatcttctac gaagacgatg
tgcccgaaca gtggagccat tacacccaga tcaacgccga tttcttcgcc
gagctgggat cgccgggcgg tgcggccaag gttggcatga ccgagaacga
cccgcaagcg gtcaaggatc tggcgccgca gagcgaggac gcctgaagct
tgactagtct gcagaaatg

FdxA

Mycobacterium smegmatis
Reference: Ricagno S. et al. 2008. The crystal structure of FdxA, a 7Fe ferredoxin from Mycobacterium smegmatis. http://dx.doi.org/10.1016/j.bbrc.2007.06.013 http://www.metacyc.org/MSME246196/NEW-IMAGE?type=GENE-IN-MAP&object=GJ4Y-1124
Sequence:

atgacatacg tgatcggccg gccgtgcgtg gacgtcaaag accgcgcatg
cgtggatgag tgcccggtcg actgcatcta cgagggcgcg cggatgctct
acatccaccc cgacgaatgt gtcgactgtg gcgcgtgtga acccgtgtgc
ccggtggagg cgatctacta cgaggacgac ctgcccgagg atctgcagcc
gtaccaggag gagaacgcga agttcttcac cgatgtcctg cccgggcgtg
cccaaccgct cggatcaccg ggcggtgccg cgaaactcgg tgtcgtggac
gccgatacgc ccatggttgc ggagctaccg ccgcaggggg attga

The NcoI cut site and a glycine codon (ccatgggc) replaced the atg in green and a HindIII site was added to the end of the sequence. The biobrick restriction sites were then added to the ends of the sequence resulting in the following sequence:

cttagaattc tagaccatgg gcacatacgt gatcggccgg ccgtgcgtgg
acgtcaaaga ccgcgcatgc gtggatgagt gcccggtcga ctgcatctac
gagggcgcgc ggatgctcta catccacccc gacgaatgtg tcgactgtgg
cgcgtgtgaa cccgtgtgcc cggtggaggc gatctactac gaggacgacc
tgcccgagga tcttcagccg taccaggagg agaacgcgaa gttcttcacc
gatgtcctgc ccgggcgtgc ccaaccgctc ggatcaccgg gcggtgccgc
gaaactcggt gtcgtggacg ccgatacgcc catggttgcg gagctaccgc
cgcaggggga ttgagcctag gtactagtct gcagtggg

Target

ASDF

Tuesday 18^th June

In Silico Cloning

We used geneious to perform in silico cloning on our constructed gene sequences to ensure that they were properly made. SirA and pACYCDuet-1 were both cut with NcoI and AvrII and then the large fragments were extracted and ligated together to form vector pD001. FdxA and pETDuet-1 were both cut with NcoI and HindIII and the large fragments were extracted and ligated together to form vector pD002. FprA and pD002 were both cut with NdeI and AvrII and the large fragments were extracted and ligated together to form vector pD003. Please see Geneious files on Google Drive (or send request for files) for exact sequences.

Target

ASDF

24^th June

Codon Optimization

The ORF of M. Smegmatis SirA, FprA, and FdxA were codon optimized for E. coli K-12 using JCat (www.jcat.de) with options to avoid using rho-independent terminators, prokaryotic RBS, and restriction sites used in vector construction (AvrII, HindIII, NdeI, NcoI) and Biobrick restriction sites (EcoRI, PstI, SpeI, XbaI). The optimization charts are shown below:

Target

ASDF

Monday 1^st July

Media was made, Strains sD001-sD004 were received, inoculated, and put into stock and catalog.

4 strains were received from Jake:

E. coli: BL21 (DE3) ko20 ΔcysI, Δfpr, ΔydbK
E. coli: NEBTurbo zmSIR Chloramphenicol
E. coli: NEBTurbo zmFNR Spectinomycin
E. coli: NEBTurbo soFD, zmSIR Chloramphenicol

Media and Glycerol stock were prepared

Media Preparation

3 500ml bottles of LB broth and LB agar were prepared by standard methods.
12.5g/500ml powder/water for broth and 20g/500ml powder/water for agar.
Bottles were autoclaved. Additionally 1 flask of 500ml of LB broth was made in the same fashion.

Glycerol Stocks

Single colonies from agar plates were picked and used to innoculate 5ml LB broth overnight.
750ml of overnight culture was added to 250ml of 60% glycerol in a cryotube.
Two sets of Glycerol stocks were used for each of sD001, sD002, sD003, sD004; one set was frozen at -20ºC and the other set was frozen at -80ºC.

Target

ASDF

Tuesday^2nd July

MiniPrep: Plasmids pD004, pD005 and pD006 were extracted from NEBturbo vectors

Plasmid Extraction
Plasmids pD004 (pCDF.ew12 zmFNR Spectinomycin), pD005 (pACYC.ew13 soFD, zmSIR Chloramphenicol), pD006 (pACYC.ew17 zmSIR Chloramphenicol) were extracted from NEBTurbo cells using a Thermo Scientific GeneJet Plasmid mini prep kit as described in protocol (). Lacking Resuspention solution we used some from a different mini prep upstairs. Plasmids were eluted in 100ul of nanopure water and frozen at -20ºC. More notes here tra la lalal

Target

ASDF

Wednesday 3^rd July

Chemically Competent Cells : BL21 (DE3) dCysI dFpr dydbk, NEBturbo stocks

Chemically Competent BL21 (DE3) Cells were made
We grew 5ml of sD001 cells overnight from a single colony. This 5ml was used to innoculate 500ml of LB broth.
Broth was incubated for 1.5h and optical density was read at 0.62 OD600.
Cells were alloquoted into 10 falcon tubes (50ml each) and centrifuged at 4000xg for 20 minutes at 4C.
Supernatant was removed and cells were resuspended in 200ml of Buffer 1 (4x 50ml) and left on ice for 20 minutes.
Cells were centrifuged again for 20 minutes at 4000xg.
Supernatant was removed and cells were resuspended in 12ml Buffer 2.
Cells were alloquoted at 500ul into microcentifuge tubes and frozen at -80C.
Buffer 1: 50mM CaCl2
Buffer 2:

0.53ml 2M CaCl2
2.8ml 60% Glycerol
8.67ml sterile H2O

This is the correct Chemical Competent Cells protocol (Similar to Protocol 2) , that we should have used instead of the one above:

Take a single colony of E. coli cells and inoculate 5ml of LB broth.
Incubate over night at 37C and 200rpm and innoculate about 500ml to 1L sterile LB broth.
DO NOT ADD antibiotics since these cells do not have a plasmid in them.
Work as sterile as possible.
Inoculate about 300-400ml sterile LB broth with 500ul of preculture.
Grow the cells on a shaker at 37C until they reach an OD @ 600nm of 0.3 to 0.4 (1cm pathlength of the cuvette).
Centrifuge at 3000xg for 10 minutes at 4C. Ice down 100mM CaCl2 and 100mM MgCl2 solutions at this point.
Gently resuspend the bacteria pellet on ice in 50ml of ice cold 100mM MgCl2, taking 3-5 minutes for this procedure.
Centrifuge the cell suspension at 3000xg for 10 minutes at 4C.
Resuspend the bacteria pellet on ice 50ml of ice cold 100mM CaCl2, incubate the cells for 10 minutes on ice.
Centrifuge the cell suspension at 3000xg for 10 minutes at 4C and resuspend the cell pellet in 4ml of ice cold, sterile 100mM CaCl2 in 15%(w/v) glycerol.
Dispense in 50uL aliquots and freeze cells at -80C.

Chemically competent cells (NEB Turbo)
Prepared via iGEM chemically competent protocol with following changes.
500ul of preculture used to inoculate 500ml LB broth. Grown at 37C for 3h hours to an OD600 of 0.536.
Cells centrifuged at 3200 rpm on old centrifuge for 10m at 4C. Pellets resuspended in 80ml of CCMB80 buffer.
Incubated on ice for 20m. Centrifuged for 10m at 3200 rpm for 10m at 4C.
Pellets resuspended in 5ml of CCMB80 buffer. Aliquoted into Microcentrifuge tubes and frozen at -80C.

Target

ASDF

Thursday 4^th July

Heat Shock Transformation

Preparation of Agar Plates
LB Agar was melted; 100ml was used to make 8 ampicillin plates,
100ml was used to make 8 spectinomycin plates and the remaining was used to make 20 chloramphenicol plates.
Antibiotic concentrations are: Ampicillin 50ug/ml, Spectinomycin 50ug/ml, Chloramphenicol 34ug/ml.

Heat Shock Transformation
sD001: BL21 (DE3) with deletions, was transformed with the following plasmids and plasmid combinations:

sD001+pD004 ( FNR, Spectinomycin)
sD001+pD005 ( SIR, Fdx, Chloramphenicol)
sD001+pD006 (Sir, Chloramphenicol)

Transformation was done according to protocol 1 with the following specifications:
BL21 (DE3) chemically competent cells were thawed on Ice. 1ul of plasmid DNA was added to a tube of BL21 (DE3) cells.
Cells were incubated on ice for 30 minutes. Cells were transfered to heating block at 42C for 45s.
Cells were returned to ice for 2 minutes. 1ml of LB Broth was added to the cells and they were incubated at 37C for 1h.
Cells were then plated on agar with appropriate antibiotics (specified previously). These transformations worked; single colonies were lifted from plates, entered to catalog and stocked in glycerol stock (protocol 3).
Catalog names:

sD006= sD001+pD004 ( FNR, Spectinomycin)
sD007= sD001+pD005 ( SIR, Fdx, Chloramphenicol)
sD008= sD001+pD006 (Sir, Chloramphenicol)

Target

ASDF

Friday 5^th July

Planning transformations for the next week

We decided to partly reproduce Figure 3C from: http://www.jbioleng.org/content/5/1/7:

So, we would pursue to grow the following strains on a minimal media M9 plate, supplemented with all amino acids

aside from the sulfur containing ones, and sulfite ans the only sulfur source:

We already thought we have all of the strains we need, however, an overnight culture was launched of a few single colonies from this double plasmid strain (sD001+pD004+pD005, which supposedly had all 3 genes SIR FNR and Fdx) and it didn't grow.

This most likely occurred because the strains didn't have Spec antibiotics resistance, as the other spec resistant strain containing

the FNR gene (pD004), was found not to be resistant as well.

Illustration 1: Strains will be grown on a minimal media M9 plate, supplemented with all amino acids aside from the sulfur containing ones; plates will have increased glucose, and sulfite as the only sulfur source. Growth is expected only for WT and the strain containing all three alternative genes of sulfur reduction.

Therefore, we would re-make:

sD001+pD004+pD005 E.coli:ΔcysI, Δfpr, ΔydbK:: soFD, zmSIR ;Chloramphenicol ,zmFNR; Spectinomycin- with all three genes.
sD001+pD004: E.coli:ΔcysI, Δfpr, ΔydbK:: zmFNR; Spectinomycin

and make

sD001+pD004+pD006 E.coli: ΔcysI, Δfpr, ΔydbK::zmFNR; Spectinomycin, zmSIR; Chloramphenicol

These transformations will be done by using two strains of competent cells prepared using Protocol 2 :

sD001 competent cells were transformed with:
- pD004
- Double transformation: pD005 +pD004
sD007 (sD001+pD005) competent cells were transformed with:
- pD004

These transformations will be done by heat shock using protocol 1.

Target

ASDF

Tuesday 16^th July

Transformation efficiency measurements

Transformation of Puc18 to sD001 (BL21 ED3) competent cells. We have made a transformation of pUC18 into our sD001 BL21(DE3) strain of competent cells.
Transformation was done by heat shock protocol 1 with the following specifications:
200 ul Chemically Competent Cells were thawed on Ice. 0.5 ul DNA was added and incubate on ice for 30 minutes.
HEAT SHOCK cells were Incubated at 42C for 45 seconds then incubated on ice for 2 minutes. 200 ul of LB broth was added and cells were incubated at 37C for 1 hour.
10 ul of cells were plated on agar supplemented with Ampicillin. During the night 18 colonies grew.

Target

ASDF

Wednesday 17^th July

Making sD001+pD004 (Spect), sD001+pD005 (Chl31) competent

Making sD001+pD004 (Spect), sD001+pD005 (Chl31) competent, by using protocol 2 with these specifications:
The night before, cells were inoculated in a 5 ml culture and grown overnight with selection.
0.05 ml of the cell culture was diluted ~ 1:200 into 10 ml of selective media (Chl31,Spect) and grew to an OD600 of 0.6 – 0.7
(sD001+pD004 didn’t grow and protocol was continued for sD001+pD005 - see comment). Cells were Spun down at 4 ºC, 4000 rpm, 15 minutes.
Then were resuspended in 15 ml, ice-cold 100 mM CaCl2 and left for 3 hours.
Next, cells were spun down at 4 ºC, 4000 rpm, for 15 minutes, Resuspended in 4 ml, ice-cold 100 mM CaCl2 + 15% glycerol
and aliquoted into pre-chilled Eppendorf tubes. Tubes were immediately stored at -80ºC.
10 ml CaCl2 100nM + glycerol 15% was made from:

3.33 ml Glycerol 60% solution.
6.17 ml Sterile water
0.5 ml CaCl2 2 M solution.

Comment: sD001+pD004 did not grow overnight (and possibly always) in Streptavidin
instead of Spectinomycin so they most likely lost their resistance and we will make them again tomorrow by tranforming the BL21(DE3) cells with pD004.

Target

ASDF

Thursday 18^th July

Heat shock Transformation

Transformations made:

sD001+pD004+pD005 E.coli:ΔcysI, Δfpr, ΔydbK:: soFD, zmSIR ;Chloramphenicol ,zmFNR; Spectinomycin- with all three genes
sD001+pD004 E.coli:ΔcysI, Δfpr, ΔydbK:: ,zmFNR; Spectinomycin
sD001+pD004+pD006 E.coli: ΔcysI, Δfpr, ΔydbK::zmFNR; Spectinomycin, zmSIR; Chloramphenicol

Transformations were made with protocol 1 with the following specifications:
BL21 (DE3) chemically competent cells were thawed on Ice.
2ul of plasmid DNA was added to 20ul of BL21 (DE3) cells. Cells were incubated on ice for 30 minutes.
Cells were transfered to heating block at 42C for 45s. Cells were returned to ice for 2 minutes.
200ul of LB Broth was added to the cells and they were incubated at 37C for 1h.
After incubations cells of each transformation were plated on two plates: one with 5 ul , and the other with 100 ul of the post recovery cells culture.

Target

ASDF

Friday 19^th July

TRANSFORMATIONS WORKED!!! cells were stocked and entered in catalog.

sD012/sD013=sD001+pD004+pD005 E.coli:ΔcysI, Δfpr, ΔydbK:: soFD, zmSIR ;Chloramphenicol ,zmFNR; Spectinomycin- with all three genes
sD016/sD017=sD001+pD004 E.coli:ΔcysI, Δfpr, ΔydbK:: ,zmFNR; Spectinomycin
sD014/sD015=sD001+pD004+pD006 E.coli: ΔcysI, Δfpr, ΔydbK::zmFNR; Spectinomycin, zmSIR; Chloramphenicol

Glycerol Stocks were made of the above mentioned strains
2 Single colonies from each agar plate of above mentioned strains were picked and used to inoculate 5ml LB broth overnight.
750ml of overnight culture was added to 250ml of 60% glycerol in a cryotube.
Two sets of Glycerol stocks were used for each of sD001+pD004, sD001+sD004+sD005, sD001+sD004+sD006;
one set was frozen at -20ºC and the other set was frozen at -80ºC.

Target

ASDF

Wednesday 24^th July

24/7/13

Made 500 ml of M9 Minimal Plates with Sulfur Dropout Powder accouding to the following recipe:

Recipe: M9 Minimal Plates with Sulfur Dropout Powder

These stock solutions can be pre-sterilized and stored indefinitely:

5x M9 Salts (from scratch)

Reagent	Quantity
Na2HPO4	17 g
KH2PO4	7.5 g
NaCl	1.25 g
(NH4)2SO4	3.0 g

Bring to a total volume of 500 ml.

Adjust pH to 7.4 with NaOH.

Sterilize by autoclaving or filtration

or

5x M9 Salts (from Difco Powder)

Reagent	Quantity
M9 Salts	28.2 g

Bring to a total volume of 500 mL.

Sterilize by autoclaving or filtration

2x Yeast Plate Agar

Reagent	Quantity
Agar	30 g

Bring to a total volume of 500 ml.

Sterilize by autoclaving

5x Amino Acid Dropout Powder

Reagent	Quantity
Sulfur dropout powder	0.5 g

Bring to a total volume of 200 ml.

Sterilize by autoclaving

Sulfur dropout powder is a rich supplement mix with cysteine and methionine omitted:

Amino acids		Nucleotide bases
Alanine	2.0 g	Leucine	10.0 g	Adenine	0.5 g
Arginine	2.0 g	Lysine	2.0 g	Uracil	2.0 g
Asparagine	2.0 g	Methionine	0.0 g
Aspartic acid	2.0 g	Phenylalanine	2.0 g	Vitamins
Cysteine	0.0 g	Proline	2.0 g	p-Aminobenzoic acid	0.2 g
Glutamic acid	2.0 g	Serine	2.0 g	Inositol	2.0 g
Histidine	2.0 g	Tyrosine	2.0 g
Isoleucine	2.0 g	Valine	2.0 g

Recipe: M9 Minimal Plates with Sulfur Dropout Powder

The plates can be made fresh from pre-sterilized stock solutions.

Reagent	Quantity
5x M9 Salts	200 mi
5x Amino Acid Dropout Powder	200 mi
1 M MgSO4	2 ml
20% Glucose	20 ml
1M CaCl2	0.1 ml

Bring to a total volume of 500 mL

Stir and warm on a hot plate to about 60 C (hot to the touch)

Melt 500 ml 2x Yeast Plate Agar in the microwave for ~8 minutes on high

Cool to about 60 C (hot to the touch)

This takes about 30 minutes on the bench or 5 minutes in a water bath.

Add the 2x Yeast Plate agar to the other reagents to make 1 L of media.

This recipe will prepare 20 plates at 25 ml / plate.

made 7 plates without antibiotics and 20 with Chloramphenicol and Spectinomycin - by mistake.

Used one plate without AB to plate the following strains:

sD007=sD001+pD005
sD008=sD001+pD006
sD013= sD001+pD005+ pD004
sD015= sD001+pD006+ pD004

Target

ASDF

Monday 5^thAugust

Confirmation of strains SD002 - SD018

Strains sd002-sd018 were grown overnight in 5ml LB.

Target

ASDF

Monday 5^thAugust

Confirmation of strains SD002 - SD018 using colony PCR

Fresh single colonies of strains SD002-SD018 were prepared for PCR using the colony pcr protocol. The primers used for were FD_F, FD_R, FNR_F, FNR_R and SirA_F and SirA_R for each strain.

Strains SD002-SD018 were confirmed.

Target

ASDF

Day Number^suffix Month

Place your twit here

Received FrpA and FdxA from IDT.
Started cloning strategy:
Ligated FdxA G block into pJET plasmid for stock purposes, using the following protocol:

1. Set up the blunting reaction on ice:

Component	Volume
2X Reaction Buffer	10 µl
Non-purified PCR product or purified PCR product/other sticky-end DNA fragment	1 µl 0.15 pmol ends
Water, nuclease-free	to 17 µl
DNA Blunting Enzyme	1 µl
Total volume	18 µl

Vortex briefly and centrifuge for 3-5 s.

2. Incubate the mixture at 70°C for 5 min. Chill on ice.

3. Set up the ligation reaction on ice. Add the following to the blunting reaction mixture:

Component	Volume
pJET1.2/blunt Cloning Vector (50 ng/µl)	1 µl (0.05 pmol ends)
T4 DNA Ligase	1 µl
Total volume	20 µl

Vortex briefly and centrifuge for 3-5 s to collect drops.

4. Incubate the ligation mixture at room temperature (22°C) for 5 min.

Target

ASDF

Tuesday 20^th August

Cloning of FdxA and FprA

Digestion of FprA with NdeI and AvrII
Gel Clean up of FprA fragment
Digestion of pETDuet-1 with NdeI and AvrII
Digestion of FdxA with NcoI and HindIII
Digestion of pETDuet-1 NcoI and HindIII

Target

ASDF

Wednesday 21^st August

Ligation and Transformations

Ligation of FprA NdeI AvrII with pET NdeI AvrII
Ligation of FdxA NcoI HindIII with pET NcoI HindIII
Transformation of pET FprA into NEBTurbo
Transformation of pET FdxA into NEBTurbo

Target

ASDF

Thursday 22^nd August

Nano drop

Plasmid mini-prep of transformations
Nano dropped

pETDuet: 59.1ng/ul
pETDuet: 45.9ng/ul
pJET Fdx: 54.2ng/ul
pLS FRP: 19.7ng/ul

Digest pLS FrpA with NdeI and AvrII
Digest pETDuet with NdeI and AvrII
Digest FdxA gBlock with NcoI and HindIII
Digest pETDuet with NcoI and HindIII
Ligation of FprA with pETDuet
Ligation of FdxA with pETDuet
Transformation of pET FprA and pET FdxA into NEBTurbo
PCR of

FdxA gBlock with FdxA F/R
pLS FprA with FprA F/R
pET duet with MCSI F/R
pACYC duet with MCSI F/R

Target

ASDF

Friday 23^rd August

Patching

Patched colonies of pET FprA and colonies of pJET FdxA
Transformations of pET Fdx didn't work
Checking strains containing plasmids fpr to make sure genes are there.
Results from Thursdays PCR:

no band for fdxA
band for fprA
band for pET
no band for pACYC

Target

ASDF

Saturday 24^th August

Weekend warriors!

Nanodrop

FdxA 1 3.1ng/ul
FdxA 2 4.3ng/ul
pET Duet 6.2ng/ul
pET Duet 4.9ng/ul

Checking FdxA gBlock by PCR

1 ul Fdx F
1 ul Fdx R
1 ul Template
7 ul H20
10 ul dreamTaq 2x master mix

Target

ASDF

Sunday 25^th August

Ligations

For FprA and pET Duet:

Miniprep more plasmid
Digest plasmid and vector backbone
Check DNA concentration
Ligate

Target

ASDF

Monday 26^th August

P1 phage transduction

The p1 phage lysate was prepared as described in the P1 phage transduction protocol.
BL21 (DE3) ΔCysI Δfpr ΔydbK was grown in 5ml Lb.
One colony was discovered in transformed plate. This colony was re-streaked and grown overnight.
the ligation product from overnight ligation was used to transorm NEB cc cells by heatshock
5ul plate gave a few colonies
10ul plate gave many colonies

Target

ASDF

Tuesday 27^th August

Sequencing FdxA

pJET FdxA sent for sequecing

Steps 2-7 of the P1 phage transduction: Lysate preparation were carried out.

BL21(AI) was picked and placed into 5ml LB and incubated at 37C overnight.

Target

ASDF

Wednesday 28^th August

P1 phage transduction

The transduction section of the P1 phage transduction protocol was carried out. Cells were plated on Kanamyocin plates to select for resistance and grown overnight.

Target

ASDF

Thursday 29^th August

Colonies from the P1 phage transduction grew on the Kanomycin plates.

Selected colonies were patched onto Kan and LBA plates and left to grow overnight.

Target

ASDF

Friday 30^th August

Confirmation of P1 phage transduction:

Colony PCR was used on patched colonies from the p1 phage transduction. The primers used for each colony were CysI F/R and KanR F/R.

PCR confirmed that CysI was deleted in BL21(AI) and replaced with a Kanomycin resistance gene.

2 Single colonies from each agar plate of the patched p1 phage transduced plates were picked and used to inoculate 5ml LB broth overnight. 750ml of overnight culture was added to 250ml of 60% glycerol in a cryotube. </div>

Target

ASDF

Monday 9^th September

Sevres Workshop

Sevres Workshop

Target

ASDF

Tuesday 10^th September

Sevres Workshop

Sevres Workshop

Target

ASDF

Monday 16^th September

Cloning gBlock FdxA and Biobricking FprA and SirA

FprA and SirA were PCRed with FprA BB F, FprA BB R, SirA BB F and SirA BB R primers respectfully. The PCR was run with an annealing temperature of 60C with an extension time of 1m40s using Phusion polymerase. The band of ~1400bp was cut out and cleaned up using a Quagen Gel Extraction Kit.

Restriction Digestion of gBlock FdxA with NcoI and HindIII. pET FprA was also digested with NcoI and HindIII. Digestion lasted 30 minutes at 37C afterwhich enzymes were heat inactivated at 80C for 20 minutes. Digestions were ligated together using 6.5ul of FdxA insert and 2ul of FprA into a total volume of 10ul.

PCR products for FprA and SirA along with linearized pSB1c3 backbone were digested with EcoRI and PstI for 30m at 37C. Restriction enzymes were then heat inactivated at 80C for 20 minutes. Digestions were then ligated together using equal amounts of 2ul insert to 2ul of backbone.

Target

ASDF

Tuesday 17^th September

Transforming gBlock FdxA and Biobricking FprA and SirA

Ligations were transformed into E. coli NEBTurbo Chemically Competent Cells by Heat Shock transformation. Cells were recovered for 1.5 hours before being plated. pSB1c3 fprA and pSB1c3 SirA were plated onto Chloramphenicol plates (34ug/ul) and pET FprA FdxA were plated onto Ampicillin (50ug/ul) plates.

Target

ASDF

Wednesday 18^th September

Patching gBlock FdxA and Biobricking FprA and SirA

Colonies from Transformation were patched onto appropriate antibiotic plates, 15 colonies from SirA were patched, 6 colonies from FprA were patched and 4 colonies from FdxA were patched.

Target

ASDF

Thursday 19^th September

PCR Verification of vectors

Vectors (pET FprA FdxA, pSB1c3 SirA, and pSB1c3 FprA) were used for colony PCR using DreamTaq. Primers used were:

pET FprA FdxA: MCSI F/R, MCSII F/R, FprA F/R, FdxA F/R

pSB1c3 SirA: SB-prep-3P-1/SB-prep-2Ea, SirA F/R

pSB1c3 FprA: SB-prep-3P-1/SB-prep-2Ea, FprA F/R

Target

ASDF

Saturday 21^st September

Weekend Rush

Gibson assembly of pSB9S1, pSB10K1, and pSB3C7.

Digestion of sirA, fprA, fdxA and linearized backbone with XbaI and SpeI

Digestion of Linearized pSB1C3 with XbaI, SpeI, and DpnI

Ligation of sirA, fprA, and fdxA with pSB1C3

Heat Shock transformation of pSB1C3 sirA, pSB1C3 fprA and pSB1C3 fdxA into NEBTurbo

Heat Shock transformation of pSB9S1, pSB10K1 and pSB3C7 into NEBTurbo

Target

ASDF

Sunday 22^nd September

Verifying shipment vectors

Growing Culture of pSB1C3 sirA, pSB1C3 fprA and pSB1C3 fdxA.

Mini-prep of pSB1C3 sirA, pSB1C3 fprA and pSB1C3 fdxA vectors

Colony PCR of pSB1C3 sirA, pSB1C3 fprA and pSB1C3 fdxA with sirA F/R, fprA F/R, fdxA F/R, and biobrick verification primers F/R

Target

ASDF

Friday 27^th September

Growth Curves

IPTG Concentrations by column: 1 0nM, 2 10nM, 3 50nM, 4 100nM, 5 500nM, 6 1uM, 7 5uM, 8 10uM, 9 50uM, 10 100uM, 11 500uM, 12 1mM

Arabinose Concentrations by column: 1 0%, 2 0.01%, 3 0.02%, 4 0.03%, 5 0.04%, 6 0.05%, 7 0.06%, 8 0.07%, 9 0.08%, 10 0.09%, 11 0.1%, 12 0.2%

Row A: BL21 AI dcysI pACYC SirA pET FprA FdxA 1 Row B: BL21 AI dcysI pACYC SirA pET FprA FdxA 1 Row C: BL21 AI dcysI pACYC SirA pET FprA FdxA 2 Row D: BL21 AI dcysI pACYC SirA pET FprA FdxA 2

Row E: BL21 (DE3) dcysI pACYC SirA pET FprA FdxA 1 Row F: BL21 (DE3) dcysI pACYC SirA pET FprA FdxA 1 Row G: BL21 (DE3) dcysI pACYC SirA pET FprA FdxA 2 Row H: BL21 (DE3) dcysI pACYC SirA pET FprA FdxA 2 10mL 5x M9 Salts, 10mL 5x Amino Acid Sulfur dropout, 0.5mL MgSO4, 2mL 20% Glucose, 5ul CaCl2, 27.5mL H2O

Target

ASDF

Saturday 28^th September

Growth Curves

Growth curves of BL21 (DE3) dcysI pACYC SirA pET FprA FdxA and BL21 AI dcysI pACYC SirA pET FprA FdxA. Column 1: Positive control WT E. coli BL21 (DE3), 2: Negative Control BL21 AI dcysI, 3: BL21 AI dcysI pACYC SirA pET FprA FdxA 0 Arabinose 0 IPTG, 4: 0.1% Arabinose 10uM IPTG, 5: 0.05% Arabinose 50uM IPTG, 6: 0.01% Arabinose 100uM IPTG, 7: 0.2% Arabinose 1mM IPTG, 8: Negative Control BL21 (DE3) dcysI dfpr dydbf, 9: BL21 (DE3) dcysI pACYC SirA pET FprA FdxA 0 IPTG, 10: 50nM IPTG, 11: 1uM IPTG, 12: 50uM IPTG

Grown in M9 Media with Galactose.

10mL 5x M9 Salts, 10mL 5x Amino Acid Sulfur dropout, 0.5mL MgSO4, 2mL 20% Galactose, 5ul CaCl2, 27.5mL H2O

Target

ASDF

Sunday 29^th September

PCR's and more!

Colony PCR on new Backbones. RFP and Biobrick verification primers This is for pSB2C and pSB3K

Colony PCR on SirA, FprA, and FdxA Biobricked parts Using Biobrick primers and SirA, FprA and FdxA primers respectfully https://2013.igem.org/File:20130929_BioB.jpg https://2013.igem.org/File:20130929_RFP.jpg https://2013.igem.org/File:20190929_pSB3K.jpg

Phusion PCR on Duet vectors and pSB1C3 using standard cloning primers

Gel Clean up

Digestion with NcoI and AvrII

Standard cloning of new backbones (1h ligation at 16C)

Transform into NEBTurbo

Cutting Biobrick SirA, FprA, FdxA and Linearized backbone with EcoRI and SpeI

Standard clonging of Biobrick parts (1h ligation at 16C)

Transform into NEBTurbo

Treat XbaI SpeI cut Backbone with TSAP 1h.

Standard cloning of Biobrick parts (cut with XbaI, SpeI) into TSAP'd backbone (1h @ 16C)

Colony PCR on BL21 (DE3) dcysI pACYC SirA pET FprA FdxA and BL21 AI dcysI pACYC SirA pET FprA FdxA

Target

ASDF

Monday 30^th September

Growth Curves

We performed Growth Curves with the following strains in each column:

WT BL21 AI
BL21 AI dcysI
BL21 AI dcysI pD002 pD003 0uM IPTG 0% Arabinose
BL21 AI dcysI pD002 pD003 10uM IPTG 0.05% Arabinose
BL21 AI dcysI pD002 pD003 100uM IPTG 0.1% Arabinose
BL21 AI dcysI pD002 pD003 1mM IPTG 0.2% Arabinose
WT BL21 DE3
BL21 DE3 dcysI dfpr dydbf
BL21 DE3 dcysI dfpr dydbf pD002 pD003 0uM IPTG
BL21 DE3 dcysI dfpr dydbf pD002 pD003 10uM IPTG
BL21 DE3 dcysI dfpr dydbf pD002 pD003 100uM IPTG
BL21 DE3 dcysI dfpr dydbf pD002 pD003 1mM IPTG

Target

ASDF

Tuesday 1^st October

Israeli Collaboration

Plasmids arrived. PCR CI plasmid with CI biobrick F/R primers.

Gel Clean-up of CI promoter PCR

Z score of BL21 dCysI pD002 pD003:Didn't Grow, forgot Sucrose in M9

Transform pSB1A3 E0240 and pSB3K3 into NEB Turbo

Target

ASDF

Wednesday 2^nd October

Race to finish stuff

Grew up 5ml cultures of pSB3K3 and pSB1A3 E0240 from transformations

Plasmid mini preps of pSB3K3 and pSB1A3 E0240

Restriction Digest of CI promoter PCR product with XbaI and PstI

Restriction Digest of Linearized Backbone pSB1C3 with XbaI, PstI, and DpnI

Make new NEB Turbo Chemically Competent Cells: Modified protocol. 4mL of NEBTurbo into 2 x 2mL tubes. Centrifuge at 14000 rpm for 1 minute at 4C. Resuspend in 500uL of 100mM MgCl2 Ice cold. Centrifuge at 14000 rpm for 1 minute at 4C. Resuspend in 500uL of iGEM cc cell buffer Ice cold. Centrifige for 1 minute at 14000 rpm at 4C. resuspend in 100ul of iGEM cc cell buffer Ice cold.

Heat Shock Transformation of pSB1C3 SirA, pSB1C3 FprA, pSB1C3 FdxA into NEBTurbo (new chemically competent cells)

Ligation of CI promoter with pSB1C3 backbone.

Heat Shock Transformation of pSB1C3 CI into NEB Turbo

Target

ASDF

Thursday 3^rd October

Race to Finish stuff

Plated new SirA, FprA, and FdxA transformations on CHL

Picked pSB1C3 CI and grew in LB broth

Z Score of BL21 dCysI pD002 pD003 with Gentamicin as positive hit control

Analytical Digestions of New Vectors (pAD1S, pAD2C, pAD3K, pAD4A)

Digest pSB1C3 CI with EcoRI and SpeI

Digest pSB3K3 with EcoRI and PstI

Digest pSB1A3 E0240 with XbaI and PstI

Ligation of CI promoter with GFP reporter and pSB3K3 backbone

Heat Shock Transformation of pSB3K3 CI GRP into NEBTurbo

PCR verify SirA, FprA, FdxA, and CI biobrick constructs

   </div>
 </div>

</html>

Centre for Research and Interdisciplinarity (CRI)
Faculty of Medicine Cochin Port-Royal, South wing, 2nd floor
Paris Descartes University
24, rue du Faubourg Saint Jacques
75014 Paris, France

+33 1 44 41 25 22/25

team2013@igem-paris.org

@@ Line 7,981: / Line 7,981: @@
 </html>
 <html><div id="target_Monday_26th_August.html"</div></html>
-<b>P1 phage transduction</b>
+<html>
+<div class ="tbnote">
+<h2>Target</h2>
+<a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
+<div style="clear: both;"></div>
+<h3>Monday 26<sup>th</sup> August</h3>
+<p><b><em>
+<!-- === Modify from here === -->
+P1 phage transduction
+<!-- === To here          === -->
+</br></em></b></p>
+<!-- === Modify from here === -->
 <br>  The p1 phage lysate was prepared as described in the P1 phage transduction protocol.
 <br>  BL21 (DE3) <i>ΔCysI Δfpr ΔydbK </i>was grown in 5ml Lb.
@@ Line 7,989: / Line 7,999: @@
 <br>5ul plate gave a few colonies
 <br>10ul plate gave many colonies
+</div>
+</html>
 <html><div id="target_Tuesday_27th_August.html"</div></html>
 <html>
@@ Line 8,003: / Line 8,016: @@
 <!-- === Modify from here === -->
 pJET FdxA sent for sequecing
-<!-- === To here === -->
-</div>
-</html>
 <div dir="ltr">
@@ Line 8,015: / Line 8,023: @@
      BL21(AI) was picked and placed into 5ml LB and incubated at 37C overnight.
 </div>
+<!-- === To here === -->
+</div>
+</html>
 <html><div id="target_Wednesday_28th_August.html"</div></html>
+<html>
+<div class ="tbnote">
+<h2>Target</h2>
+<a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
+<div style="clear: both;"></div>
+<h3>Wednesday 28<sup>th</sup> August</h3>
+<p><b><em>
+<!-- === Modify from here === -->
+P1 phage transduction
+<!-- === To here          === -->
+</br></em></b></p>
 <!-- === Modify from here === -->
-<b>P1 phage transduction</b>
-<!-- === To here === -->
 <p>
      The transduction section of the P1 phage transduction protocol was carried out.
-</p>
-<div>
      Cells were plated on Kanamyocin plates to select for resistance and grown overnight.
+</p>
 </div>
+</html>
 <html><div id="target_Thursday_29th_August.html"</div></html>
+<html>
+<div class ="tbnote">
+<h2>Target</h2>
+<a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
+<div style="clear: both;"></div>
+<h3>Thursday 29<sup>th</sup> August</h3>
 <p>
      Colonies from the P1 phage transduction grew on the Kanomycin plates.
@@ Line 8,032: / Line 8,061: @@
      Selected colonies were patched onto Kan and LBA plates and left to grow overnight.
 </div>
+</div>
+</html>
 <html><div id="target_Friday_30th_August.html"</div></html>
 <html>
-<div>
+<div class ="tbnote">
-    <b>Confirmation of P1 phage transduction:</b>
+<h2>Target</h2>
-</div>
+<a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
+<div style="clear: both;"></div>
+<h3>Friday 30<sup>th</sup> August</h3>
+<p><b><em>
+<!-- === Modify from here === -->
+Confirmation of P1 phage transduction:
+<!-- === To here          === -->
+</br></em></b></p>
 <p>
      Colony PCR was used on patched colonies from the p1 phage transduction. The primers used for each colony were CysI F/R and KanR F/R.
@@ Line 8,048: / Line 8,087: @@
 ml of overnight culture was added to 250ml of 60% glycerol in a cryotube.
 </html>
+</div>
 <html><div id="target_Monday_9th_September.html"</div></html>
@@ Line 8,159: / Line 8,199: @@
 </div>
 </html>
-<html><div id="target_Friday_20th_September.html"</div></html>
 <html><div id="target_Saturday_21st_September.html"</div></html>
 <html>

Team:Paris Bettencourt/SebaTemplate

From 2013.igem.org

Revision as of 05:59, 27 October 2013

Detect

Saturday 13th August

Detect

Sunday 14th July

Detect

Monday 15th July

Detect

Tuesday 16th July

Detect

Wednesday 17th of July

Detect

Thursday 18th July

Detect

Monday 22nd July

Detect

Tuesday 23rd July

Detect

Monday 29th July

Detect

Tuesday 30th July

Detect

Wednesday 31st July

Detect

Thursday 1st August

Detect

Friday 2nd August

Detect

Monday 5th August

Detect

Tuesday 6th August

Detect

Wednesday 7th August

Detect

Thursday 8th August

Detect

Friday 9th August

Detect

Saturday 10th August

Detect

Sunday 11th August

Detect

Monday 12th August

Detect

Tuesday 13th August

Detect

Wednesday 14th August

Detect

Thursday 15th August

Detect

Friday 16th August

Detect

Monday 19th August

Detect

Tuesday 20th August

Detect

Wednesday 21st August

Detect

Thursday 22nd August

Detect

Friday 23rd August

Detect

Sunday 25th August

Detect

Monday 26th August

Detect

Tuesday 27th August

Detect

Wednesday 28th August

Detect

Friday 30th August

Detect

Day Numbersuffix Month

Detect

Wednesday 4th September

Detect

Thursday 5th September

Detect

Saturday 13^th August

Sunday 14^th July

Monday 15^th July

Tuesday 16^th July

Wednesday 17^th of July

Thursday 18^th July

Monday 22^nd July

Tuesday 23^rd July

Monday 29^th July

Tuesday 30^th July

Wednesday 31^st July

Thursday 1^st August

Friday 2^nd August

Monday 5^th August

Tuesday 6^th August

Wednesday 7^th August

Thursday 8^th August

Friday 9^th August

Saturday 10^th August

Sunday 11^th August

Monday 12^th August

Tuesday 13^th August

Wednesday 14^th August

Thursday 15^th August

Friday 16^th August

Monday 19^th August

Tuesday 20^th August

Wednesday 21^st August

Thursday 22^nd August

Friday 23^rd August

Sunday 25^th August

Monday 26^th August

Tuesday 27^th August

Wednesday 28^th August

Friday 30^th August

Day Number^suffix Month

Wednesday 4^th September

Thursday 5^th September

Friday 6^th September

Saturday 7^th September

Sunday 8^th September

Monday 16^th September

Tuesday 17^th September

Wednesday 16^th September

Sunday 22^nd September

Monday 23^rd September

Tuesday 24^th September

Wednesday 25^th September

Thursday 26^th September

Friday 27^th September

Saturday 28^th September

Monday 30^th September

Tuesday 1^st October

Wednesday 2^nd October

Wedsnesday 3^rd October

Monday 14^th October

Tuesday 15^th October

Wednesday 16^th October

Thursday 17^th October

Friday 18^th October

Saturday 19^th October

Tuesday 22^nd October

Thursday 24^th October

Friday 25^th October

Monday 10^th June

Tuesday 11^th June

Wednesday 12^th June

Tuesday 18^th June

24^th June

Monday 1^st July

Tuesday^2nd July

Wednesday 3^rd July