Team:NJU China/Project

Exosomes are lipid bilayer vesicles that are secreted by all cell types, and its diameter ranges from 30nm to 100nm. Given its role as a natural transporter of bioactive molecules, we want to utilize exosomes as our drug carrier. The first problem we met is which chassis to choose to produce the exosomes we want. After screening through a large amount of different cell types, we choose to use HEK 293T cells as our chassis.

HEK 293T cell is a subtype of human embryonic kidney cells and we choose this as our chassis for three main reasons. The first reason is that HEK 293T cells can secrete large amounts of exosomes, so we can get enough exosomes by using HEK 293T cells as our chassis.

The second reason is that HEK 293T cells are derived from human, so the exosomes they secrete will be more human compatible and have little chance of inducing immune response compared to other non-human cells.

The last reason is that HEK 293T cells are immortalized cells, which means that after genetically engineering them to produce the exosomes we want, we can simply subculture the cell line and keep them as cell factory to produce our desired exosomes massively.

Based on the utilization of natural exosome produced by HEK 293T cells and the modification of the surface protein, lamp-2b, now we have got a site-specific drug carrier, which can bring medicine to cells with a certain kind of receptors. In order to expand power of our system, we decide to pack the carrier with our disease-killing device, siRNA.

Recently, small interfering RNA (siRNA) is emerging as a promising therapeutic drug against a wide array of diseases. siRNA functions through the RNA interference pathway. Normal double-stranded RNA is first processed by Dicer and Argo to become short double-stranded RNA, which is about 21-25bp in length. Then it will recruit other proteins to form RISC( RNA induced silencing complex). One of the two RNA stands in the RISC will be degraded and the remaining strand can specifically recognize other mRNA by base pairing. Once the RISC bind to other complementary mRNA, it will destroy the mRNA through the RNAi pathway. By designing siRNA against certain virus genes, we can use siRNA as molecular medicine for diseases treatment. siRNAs are well tolerated and have suitable pharmacokinetic properties.


This discovery encouraged us to harness siRNA as specific targeted drugs producing a therapeutic benefit in our system. Now, not only can we carry drugs into a specific site, but also the drug itself specifically turn off the disease-causing gene expression rather than destroy the whole cell or disrupt normal protein production in a healthy cell.

Design
We carried out this experiment in the HBV testing model to verify that our big idea can work in real human disease. The first step in designing a siRNA for viral gene silencing is to choose the siRNA target sites. Firstly, we should find 21 nt sequences in the target mRNA from Hepatitis b virus (HBV) genome that begin with an AA dinucleotide.
And then, choose target sites from among the ‘AA sequences’ based on guidelines like ‘Target sequence should have a GC content of around 50%’; ‘Avoid stretches of 4 or more bases such as AAAA, CCCC; ’‘Avoid regions with GC content <30% or > 60%.’
We completed the first two steps in the software, siRNA Designer.
Finally, we performed BLAST homology search to avoid off-target effects on other genes or sequences

After screening the HBV genome using the methods mentioned above, we ultimately find three candidates as our anti-HBV siRNA
siRNA 308 TATGCCTCAAGGTCGGTCGTT against HBx gene in HBV genome
siRNA 467 TCCCATAGGAATCTTGCGAAA against HBsAG gene in HBV genome
siRNA 516 ACAAATGGCACTAGTAAACTG against HBsAg gene in HBV genome
The number 308, 467 and 516 in the siRNA indicates their target sites within their target gene.


We cloned these three siRNAs into the vector pENTR/U6, which is a plasmid backbone for high yield of siRNA.
By cloning the siRNAs into eukaryotic expression vectors, large amounts of corresponding siRNAs can be produced by the cell, instead of chemically synthesizing the siRNAs.
In these vectors, we use an RNA polymerase Ⅲpromoter U6 to direct the transcription of siRNA， and an enhancer which greatly increases the gene transcription

Results
1.siRNA screen
Since we have designed three types of siRNA target to different HBV genes, we need to determine which one would be optimal for HBV treatment.

To achieve this goal, we first tested their relative expression level in cells and exosomes. Expression of them was confirmed by quantitative PCR (qPCR) analysis of transfected HEK 293t cells and exosomes collected from the culture medium. The result suggested that 467 siRNA had much higher level of expression in both cells (Fig.1) and exosomes (36h post-transfection)(Fig.2). Since we need high yield of siRNA in the exosome, we decided to choose 467 as our ‘kill device’.


Fig.1 :qPCR analysis of relative siRNA level in 293t cells. Result showed that 467 siRNA has a relatively higher level of expression than that of 308 siRNA and 516 siRNA.


Fig.2 :qPCR analysis of relative siRNA level in 293t cells. 24 hours after transfection, 516 has a relatively higher expression level in exosomes. However, after 36h’s transfection, 467 performed a significant increase in expression level, almost 100 times of that of 516 and 308. Therefore, together with the data from Fig.1, we eliminated 516 siRNA and 308 siRNA from our list.

2.Silencing effect of siRNA 4667 towards HBsAG
We investigated the silencing effectiveness of siRNA 467 towards HBsAG to guarantee that it would work as we want. By qPCR analysis of HepG2 cell co-transfected with both siRNA 467 plasmid and HBsAg plasmid, we observed the significant down-regulation of HBsAg gene (Fig.3). This demonstrated that our siRNA 467 does function to silence the target gene, yet it could not prove that 467 siRNA would also work when it was encapsulated into our exosomes.


Fig. 3 :Silencing of HBsAg by siRNA 467. All groups were transfected by Lipo 2000. Control group was transfected with empty plasmid. siRNA-free group was transfected with HBsAg overexpression plasmid, and experimental group with both HBsAg overexpression plasmid and 467 siRNA plasmid. The result suggested that 467 siRNA successfully down-regulatethe HBsAg gene.

3.Silencing effect of siRNA 467 towards HBsAg after encapsulated in exosome
After transfecting 293t cells with 467 siRNA plasmids, we collected exsomes and then co-cultured them with HepG2 cells which had been transfected with HBsAg over-expression plasmid. qPCR analysis confirmed that the down-regulation of HBsAg was significant(Fig.4), and thus proved that our 467 siRNA could work effectively in exosomes.


Fig.4: All groups were transfected by Lipo. The first group was transfected without any plasmid while other three groups were transfected with HBsAg over-expression plasmid. Second group cultured without exogenous exosomes. Third group co-cultured with empty exosomes, and fourth with exosomes containing siRNA 467. These two kinds of exosomes were collected from 293t cells transfected without and with 467 siRNA plasmid, respectively. Then every group was analyzed for their HBsAg gene expression level through qPCR. Since group 2 and group 3 showed a similar level of expression, either of which is significantly higher than group 1, the HBsAg gene did express in those cells. Yet group 4, which was co-cultured with 467 exosomes, showed a relatively lower HBsAg expression level. That may indicate that 467 contained in exosomes had down-regulated the target gene.

4.Absolute quantification of siRNA 467 encapsulated into exosome
In order to better apply our exosomes in further experiment (mice experiment, for example), we needed to absolutely quantify the siRNA productivity in each μg of exosomes (whose quantity is measured base on protein concentration). By qPCR analysis of a series of siRNA with given concentration, we drew a standard curve (Fig.5). Then using this curve, we were able to determine the siRNA quantity within exosomes. Also, we tested the quantity of siRNA from both 24h post-transfection and 48h post-transfection in each experiment. The results showed that 24 hours after the transfection, the quantity of siRNA per 1μg exosome was 8*10-2 fmol in exosomes(Fig.6). However, after 48 hours, the number nearly doubled. It was 2*10-1 fmol(siRNA)/μg(exosome) in exosomes. The results helped us determine the dose of injection for mouse and establish the mathematical model.


Fig.5 siRNA 467 Standard Curve drawn through a series siRNA with given concentration.


Fig.6 Absolute quantification of siRNA 467 in exosomes, 24h and 48h post transfection, respectively.