Team:Imperial College/Protocols

From 2013.igem.org

Revision as of 22:35, 16 September 2013 by Jps09 (Talk | contribs)

Materials

Waste Conditioned Media (WCM)

We added 1g [http://en.wikipedia.org/wiki/Refuse-derived_fuel SRF] (Solid Recovered Fuel) /50 mL LB and then autoclaved the mixture. Once autoclaved, large waste chunks were removed through filter sterilisation (0.2uM filters) before being used in growth assays as waste conditioned media (WCM).



Protocols and Assays

PCR

We used Pfu Ultra polymerase for all reactions where we use the DNA for anything afterwards. Download the exact manual from here

We used MyTaq polymerase for colony PCR and checking plasmids. You can download the manual [http://www.bioline.com/documents/product_inserts/MyTaq%E2%84%A2%20DNA%20Polymerase.pdf#zoom=130 here].

Sequencing

We used VF", VR, G1004 and G1005 primers in order to verify the sequence of most of the biobrick parts. We also designed internal sequencing primers to verify the reads in long parts, such as phaCAB.

[http://parts.igem.org/Part:BBa_G00100 VF2 (BBa_G00100)] tgccacctgacgtctaagaa Tm=62 [http://parts.igem.org/Part:BBa_G00100 VR (BBa_G00101)] attaccgcctttgagtgagc Tm=60

[http://parts.igem.org/Part:BBa_G1004 BBa_G1004] (=prefix) gtttcttcgaattcgcggccgcttctag Tm=63 [http://parts.igem.org/Part:BBa_G1004 BBa_G1005] (=revcompl sufix) gtttcttcctgcagcggccgctactagta Tm=64<6p>

Waste Growth Assay O/N cultures of MG1655 transformed with (BBa_K639003) were diluted to OD 0.05 in either fresh LB or waste conditioned media and plated into 96 well plates (200ul/well). OD600 was read at the indicated time points and media only (LB) was taken away as background signal.

[http://biolabs.tmcc.edu/Micro%20Web/SerialDilutions.pdf Serial Dilution]

Preparation of Poly DEGA plates. <p> In addition to LB, place 0.5% poly DEGA in 20 mM Tris-HCl at pH 8.0 into the solution. In a 300 mL solution this translates to 1.5 mL poly DEGA. As poly DEGA is very viscous, before addition, ensure LB agar is kept at 70°C. We then used a magnetic stirrer to ensure that the poly DEGA was thoroughly mixed.


Our Sponsors

TueSponsorsEppendorf.png 125px Invitrogen.jpg Geneart.jpg CSynBI.JPG